Fluorescente

Immunology and Infection
 

Summary

Tra i tre generi di zanzare, vale a dire

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ibridazione in situ fluorescente (FISH) è una tecnica normalmente utilizzata da molti laboratori per determinare la posizione cromosomica di sonde di DNA e RNA. Una importante applicazione di questo metodo è lo sviluppo di mappe fisiche alta qualità utili per migliorare le assemblee genoma di vari organismi. Il modello naturale strisce di cromosomi politenici mitotico e fornisce una guida per l'ordine preciso e l'orientamento delle supercontigs genomici. Tra i tre generi, vale a dire zanzara Anopheles, Aedes e Culex, una consolidata cromosoma base tecnica di mappatura è stata sviluppata solo per Anopheles, i cui membri possiedono cromosomi politenici leggibili 1. Come risultato di sforzi mappatura del genoma, 88% di An. gambiae genoma è stato collocato in posizioni precise cromosoma 2,3. Due generi di zanzare Aedes e altri, Culex, sono scarsamente polytenized b cromosomiecause di sovrarappresentazione significativo di elementi trasponibili nei loro genomi 4, 5, 6. Solo il 31 e il 9% delle supercontings genomici sono stati assegnati senza ordine o l'orientamento di cromosomi di Ae. aegypti 7 e Cx. quinquefasciatus 8, rispettivamente. Preparazione cromosoma mitotico per queste due specie precedentemente limitato a gangli cervello e linee cellulari. Tuttavia, i vetrini preparati cromosoma dai gangli cerebrali di zanzare di solito contengono un basso numero di piastre in metafase 9. Inoltre, sebbene una tecnica FISH è stata sviluppata per i cromosomi mitotici da una linea cellulare di Ae. aegypti 10, l'accumulo di più riarrangiamenti cromosomici nei cromosomi 11 linee cellulari li rende inutili per la mappatura del genoma. Qui si descrive una tecnica semplice ed affidabile per ottenere alta qualità di preparazioni cromosomiche mitotiche da dischi immaginali (ID) di larve di 4 ° instar che cun essere utilizzato per tutti i tre generi di zanzare. Un protocollo FISH standard 12 è ottimizzato per l'utilizzo di cloni BAC di DNA genomico come una sonda su cromosomi mitotici di Ae. aegypti e Cx. quinquefasciatus, e utilizzando un distanziatore intergenica (IGS) regione del DNA ribosomiale (rDNA) come sonda sul An. cromosomi gambiae. Oltre alla mappatura fisica, la tecnica sviluppata può essere applicata a citogenetica popolazione e la tassonomia cromosoma / sistematica di zanzare ed altri insetti gruppi.

Protocol

1. Preparazione dei cromosomi

Le larve di zanzara sono stati allevati utilizzando un protocollo standard descritto in Metodi di ricerca in Anopheles disponibile sul sito web della ricerca sulla malaria e il reagente Centro di Riferimento delle risorse (MR4) 13. Le temperature di allevamento zanzara sono stati modificati per fornire il maggior numero di cromosomi nei dischi immaginali e più basso di mortalità delle larve. Le fasi di sviluppo larve della zanzara sono state determinate sulla base delle misure dei loro capsule testa 13.

  1. Uova di zanzara Hatch a 28 ° C, e dopo 2-3 giorni, il trasferimento di 2 ° o 3 ° larve instar a 16 ° C per Ae. aegypti e Cx. quinquefasciatus ed a 22 ° C per An. gambiae.
  2. Luogo larve di 4 ° instar su ghiaccio per alcuni minuti per l'immobilizzazione.
  3. Trasferimento larva a una diapositiva con una goccia di freddo una soluzione ipotonica (0,5% in modopalladio citrato o cloruro di potassio 0,075 M), e posizionarlo sotto il microscopio stereo.
  4. Selezionare larva con ID ovali (Figura 1B) per la dissezione ulteriormente.
  5. Decapitare larva, e tagliare la cuticola dal lato ventrale del torace larvale con le forbici dissezione (Figura 2A). , Effettuare un taglio ulteriore in secondo o terzo segmento addominale di sezionare l'intestino dalla larva. Le direzioni dei tagli sono mostrate dalle frecce.
  6. Aprire la cuticola, e rimuovere l'intestino e il corpo grasso dalla larva. Rimuovere la soluzione ipotonica dal vetrino utilizzando carta da filtro, e aggiungere una goccia di soluzione di ipotonica direttamente al ID (Figura 2B). Tenere larva in soluzione ipotonica per 10 minuti a RT.
  7. Rimuovere la soluzione ipotonica con carta da filtro, e applicare la soluzione di Carnoy (etanolo / acido acetico in rapporto 3:1). Dopo aver aggiunto la soluzione fissativa, gli ID immediatamente diventano bianchi e diventano facilmente visibili al microscopio (Figura 2C
  8. Usando aghi dissezione, rimuovere ID dalla larva (Figura 2D), e trasferirli in un calo del 50% di acido propionico. Rimuovere eventuali altri tessuti, come l'intestino e grasso corporeo, dalla diapositiva. Coprire con un ID slittamento unsiliconized copertura 22x22, e tenere per 10 minuti a temperatura ambiente.
  9. Coprire il vetrino con carta da filtro, e schiacciare il tessuto toccando la gomma di una matita sul perimetro del vetrino.
  10. Brevemente analizzare la qualità del vetrino utilizzando il microscopio a contrasto di fase a 100x e 200x ingrandimento (Figura 3). Preparati con> 50 spread cromosomiche può essere considerata adatta per i pesci.
  11. Immergere e tenere premuto il vetrino in azoto liquido fino a che non si ferma di bubbling. Rimuovere il vetrino dal vetrino usando una lama di rasoio, e trasferire la diapositiva immediatamente ad un contenitore di 70% etanolo raffreddato a -20 ° C. Conservare a 4 ° C per almeno 1 ora per il miglior risultato disidratazione (se necessario, i vetrini possono essere conservati a til suo passo da alcuni minuti a diversi giorni).
  12. Disidratare i vetrini in una serie di etanolo (70%, 80%, 100%) a 4 ° C per 5 minuti ciascuno, e aria secca a RT.
  13. Conservare i vetrini a secco a -20 ° C prima di utilizzarle per i pesci.

2. Estrazione delle frazioni di DNA ripetitivo

Esecuzione FISH della sonda BAC clone di DNA sui cromosomi di Ae. aegypti e Cx. quinquefasciatus richiede l'utilizzo senza etichetta frazioni ripetute di DNA per bloccare l'ibridazione non specifica delle ripetizioni del DNA ai cromosomi. La riassociazione del DNA a singolo filamento frammentato in pezzi di diverse centinaia bp segue una curva C 0 C t dove 0 è la concentrazione iniziale di DNA a singolo filamento e t è il tempo reannealing. Frazioni di DNA con valori pari a C0T 10 -4 -10 -1 o 10 ° -10 2 sono considerati altamente e moderatamente ripetitivo, rispettivamente.

  1. Estratto 400-500 pg di DNA genomico da zanzara adulta con sangue Qiagen e Cultura Maxikit cellulare, e preparare 100-1.000 ng / soluzione di DNA microlitri 1,2 x SSC.
  2. DNA denaturate ponendo un sicuro bloccaggio del tubo con DNA genomico in un blocco di riscaldamento preriscaldata a 120 ° C per 2 min. Alta temperatura contribuisce a variare il DNA in frammenti di 200-500 bp.
  3. A seconda della concentrazione di DNA, DNA riassocia ponendo la provetta a 60 ° C per 15-150 min per ottenere frazioni di DNA C 0 t C fino a 0 t3 (Tabella 1).
  4. Posizionare la provetta con DNA su ghiaccio per 2 min.
  5. Trasferire il DNA a 42 ° C, aggiungere preriscaldato 10x nucleasi S1 buffer e nucleasi S1 ad una concentrazione finale di 100 U per 1 mg di DNA, e incubare per 1 ora.
  6. DNA precipitato aggiungendo 0,1 volume di 3 M acetato di sodio ed 1 volume di isopropanolo a RT.
  7. Centrifugare a 14.000 rpm per 20 min a 4 ° C.
  8. Lavare DNA in etanolo al 70%, e centrifugare nuovamente a 14.000 rpm per 10 mina 4 ° C.
  9. Asciugare e si sciolgono DNA risospeso nel tampone TE.
  10. Misurare la concentrazione di DNA, e visualizzare mediante elettroforesi su gel. Di solito la quantità finale di frazioni di DNA ripetute rappresenta il 35-50% della quantità di DNA originale.

3. DNA Probe Etichettatura

Due diversi protocolli sono stati utilizzati per l'etichettatura clone BAC DNA sonda e sonda IGS rDNA.

3,1 BAC etichettatura clone utilizzando nick-translation

  1. Estrarre DNA clone BAC dalla libreria BAC di utilizzare il kit Qiagen Construct Grande.
  2. Preparare miscela di reazione per nick-translation etichettatura su ghiaccio con volume finale di 50 pl: 1 ug isolato BAC clone di DNA, 0,05 mM ciascuno di dATP non marcato, dCTP e dGTP e 0,015 mM di dTTP, 1 pl di Cy3-dUTP (o un'altra fluorocromo), 0,05 mg / ml di BSA, 5 pl di 10x nick-translation buffer, 20 U di DNA polimerasi I, e 0,0012 U di DNasi.
  3. Incubare a 15 ° C per 20,5 ore.
  4. Fermare la reazione mediante aggiunta di 1 ml di 0,5 M EDTA.
  5. Sonda Conservare a -20 ° C in un luogo buio.

3,2 IGS rDNA etichettatura mediante PCR

  1. Preparare miscela di reazione in ghiaccio con volume finale di 50 pl: 200 ng di DNA genomico, 0,05 mM ciascuno di dATP non marcato, dCTP e dGTP, dTTP di 0,015 mM, 1 pl di Cy3-dUTP (o altro fluorocromo); 5 microlitri di 10x PCR-buffer, 50 pmol di nuovo; delle Nazioni Unite (GTGTGCCCCTTCCTCGATGT) e viceversa; GA (CTGGTTTGGTCGGCACGTTT) primer per l'amplificazione IGS e 10 U di Taq polimerasi del DNA 14.
  2. Effettuare reazione di PCR utilizzando parametri standard PCR per l'amplificazione IGS: 95 ° C / 5 min x 1 ciclo; (95 ° C / 30 sec, 50 ° C / 30 sec, 72 ° C / 30 sec) x 30 cicli di 72 ° C; / 5 min x 1 ciclo e 4 ° C tenere 14.
  3. Sonda Conservare a -20 ° C in un luogo buio.

4. Ibridazione in situ fluorescente

e Cx. quinquefasciatus e la seconda per l'utilizzo di IGS rDNA sui cromosomi mitotici di An. gambiae. Se si utilizzano sonde di DNA clone BAC, saltare trattamento RNasi passi 4.3, 4.4, e simultanea scivolo / sonda fase di denaturazione 4.19. Se si utilizza IGS rDNA sonda, preparare miscela di ibridazione senza frazioni di DNA C 0 t, e saltare diapositiva separata / sonda denaturazione passi 4.10, 4.11, 4.16, e 4.17.

  1. Incubare i vetrini in 2X SSC per 30 minuti a 37 ° C.
  2. Disidratare i vetrini in una serie di 70%, 80% e 100% di etanolo per 5 minuti ciascuno a temperatura ambiente, e lasciare asciugare all'aria. Se si esegue l'FISH con BAC clone di DNA, passare direttamente al punto 4.5.
  3. Incubare preparazione cromosoma in 0,1 mg / ml soluzione RNase sotto parafilm per 30 min a 37 ° C.
  4. Lavare due volte in 2 x SSC per 5 minuti ciascuna a 37 ° C.
  5. Mettere i vetrinina vaso con la pepsina e 0,01% 0.037% soluzione di HCl, e incubare per 5 minuti a 37 ° C.
  6. Lavare i vetrini in 1x PBS per 5 minuti a temperatura ambiente.
  7. Fissare preparazione cromosoma in un vaso con 1% di formalina in PBS 1x preparato dal 10% formalina tamponata neutra-per 10 minuti a RT.
  8. Lavare i vetrini in 1x PBS per 5 minuti a temperatura ambiente.
  9. Disidratare i vetrini in una serie di 70%, 80% e 100% di etanolo per 5 minuti ciascuno a temperatura ambiente, e le preparazioni di aria secca a 37 ° C. Se si esegue FISH con IGS, passare direttamente al punto 4,12
  10. Diapositive denaturate in un vaso con preriscaldato formammide 70% per 2 min a 72 ° C.
  11. Disidratare i vetrini in serie di freddo (-20 ° C) 70%, 80% e 100% etanolo per 5 minuti ciascuno, e aria secca a 37 ° C.
  12. Preparare miscela di ibridazione:. 5 microlitri di DNA sonda marcata dal passaggio 3, 10 ml di DNA C 0 t dal punto 2 con concentrazione finale di 0,5 microlitri ng / mL, e 5 di 1 mg / pl sonicato DNA di sperma di salmone per i pesci con IGS rDNA, prepararemiscela di ibridazione senza frazioni di DNA C 0 t.
  13. DNA precipitato aggiungendo 0,1 volume di 3 M acetato di sodio e 2 volumi di etanolo. Conservare a -20 ° C per 1-3 ore.
  14. Centrifugare a 14.000 rpm a 4 ° C per 20 minuti, rimuovere l'etanolo, e asciugare il pellet a RT.
  15. Accuratamente sciogliere il precipitato in 10 ml di tampone di ibridazione:. Formammide 50%, 20% di solfato di destrano, 2x SSC Se si esegue FISH con IGS, passare direttamente al punto 4,18
  16. Miscela di ibridazione Denaturare per 7 minuti a 97 ° C, e subito messo in ghiaccio per 1 min.
  17. Prehybridize miscela a 37 ° C per 30 minuti per evitare ibridizzazione non specifica di DNA ripetitivo ai cromosomi.
  18. Porre 10 ml di miscela di ibridazione sul vetrino, e coprire con un coprioggetto 22x22. Evitare la formazione di bolle - bolle d'aria devono essere rimosse con una leggera pressione al coprioggetto Se si esegue FISH con il DNA clone BAC, passare direttamente al punto 4,20 <./ Em>
  19. Denaturare la sonda e DNA cromosomico simultaneamente utilizzando una piastra riscaldante a 75 ° C per 5 min.
  20. Colla vetrino intorno al perimetro con mastice.
  21. Effettuare ibridazione notte in una camera umida a 37 ° C.
  22. Rimuovere mastice e applicare il coprioggetto dalla diapositiva.
  23. Lavare il vetrino 2 min in soluzione preriscaldato 1 (0.4x SSC, 0,3% Nonidet-P40) a 73 ° C.
  24. Lavare i vetrini in soluzione di 2 (2x SSC, 0,1% Nonidet-P40) per 5 min a RT.
  25. Controcolorare diapositiva utilizzando 0,001 mM YOYO-1 in 1x PBS per 10 minuti in camera umida a RT.
  26. Montare in una piccola quantità di prolungare antifade reagente oro con un vetrino coprioggetti.
  27. Analizzare preparazioni sotto un microscopio a fluorescenza utilizzando appositi set di filtri a 1.000 x ingrandimento (Figura 4).

5. Risultati rappresentativi

ID insetti si trovano in ogni segmento della larva. A seconda della posizione, they si trasformano in tessuti diversi nella fase adulta dell'insetto. Gli ID, che sono utilizzati per la preparazione dei cromosomi in questo protocollo, si sviluppano in gambe nella fase adulta della zanzara. Questi ID sono situati sul lato ventrale del torace larvale e sono chiaramente visibili attraverso la cuticola al microscopio (Figura 1). Nella fase iniziale 4 ° instar larvale, ID hanno una forma rotonda (Figura 1A). Il maggior numero di mitosi, ~ 175 in un unico ID 9, vengono accumulati in un secondo "ovale" fase (Figura 1B), che deve essere considerato la fase ottimale per la preparazione del vetrino. In questo momento, l'ID intermedio divide in due: uno trasforma in una gamba e un'altra trasforma in un'ala. Noi preferiamo utilizzare gli ID delle gambe grandi nella fase di "ovale" per la preparazione dei vetrini cromosoma. Figura 1C rappresenta ID al l'ultima fase di sviluppo del 4 ° larve instar. In questa fase, laID sono già sviluppato in zampe e le ali, e contengono una quantità significativa di tessuti differenziati e un basso numero di mitosi. Questa fase di sviluppo ID dovrebbe essere evitato per la preparazione dei cromosomi diapositiva. Raccomandiamo inoltre allevamento di larve della zanzara alle basse temperature:. 16 ° C per Aedes e Culex e 22 ° C per Anopheles Questo aiuta ad aumentare la quantità di mitosi in ID 9.

La figura 2 illustra la dissezione ID dal torace di larva 4 ° stadio. Poiché la cuticola di un insetto vivo è difficile da analizzare, si consiglia di utilizzare le forbici dissezione anziché gli aghi comunemente usati per la preparazione larva. La procedura più importante per ottenere alta qualità di preparazione cromosoma è il trattamento soluzione ipotonica. Per ottenere i migliori risultati, togliere l'intestino e il corpo di grasso dal torace larvale prima di questo trattamento. Gonfiore delle cellule ID durante questa procedura contribuisce a diffondere cromosomas su un vetrino (Figura 3A). La qualità adeguata del trattamento soluzione ipotonica può essere facilmente riconosciuto dalla forma circolare delle celle nelle preparazioni (Figura 3A, B). Cellule con una forma ovale indicare una soluzione di trattamento ipotonico (Figura 3C). Per essere selezionati per FISH, la preparazione cromosoma deve contenere almeno 50 di alta qualità spread cromosoma. Normalmente, ~ 90% dei preparati usando questo protocollo hanno qualità sufficiente per FISH 9.

Vi presentiamo due protocolli FISH leggermente diverse: un protocollo avanzato per FISH con sonda di DNA genomico BAC clone sui cromosomi mitotici di Aedes e Culex e un protocollo FISH semplice per IGS rDNA sonda su cromosomi mitotici di Anopheles. I genomi di Aedes e Culex sono altamente ripetitive a causa della sovrarappresentazione degli elementi trasponibili 7,8. Pertanto, l'esecuzione FISH, che utilizes DNA genomico clone BAC come sonda, è necessario aggiungere etichettati frazioni di DNA ripetute alla sonda di bloccare ibridazione non specifica delle ripetizioni del DNA di cromosomi. Per l'estrazione delle frazioni ripetute di DNA, DNA genomico viene denaturato a 120 ° C per 2 min. DNA ebollizione a temperatura elevata aiuta anche a ottenere il DNA in frammenti di 200-500 bp. DNA è consentito riassociare dopo questo trattamento. I frammenti di DNA altamente ripetitivi tendono a trovare il loro compagno per la riassociazione più veloce di DNA con sequenze uniche fa. Come risultato, la riassociazione del DNA segue una curva C 0 x 0 t dove C è la concentrazione iniziale di DNA a singolo filamento, e t è il tempo reannealing. Frazioni di DNA con C 0 valori di t pari a 10-4 - 10-1 o 100-102 sono considerati altamente e moderatamente ripetitivo, rispettivamente. Il tempo di riassociazione per diverse frazioni di DNA C 0 t può essere calcolato utilizzando the formula t = 0 C t × 4,98 X / C 0, dove t - tempo di incubazione, C 0 t X - C 0 frazione t (C0T 1 = 1, C 0 t 2 = 2, ecc) e C 0 - DNA concentrazione iniziale in pg / pl 15 (Tabella 1). Dopo riassociazione, il DNA a singolo filamento viene digerito con nucleasi S1. Noi preferiamo utilizzare tutte le frazioni di DNA C 0 t C fino a 0 t 3, unitamente al posto della più comune C 0 t 1 frazione di DNA. Queste frazioni C 0 t includono alcune delle sequenze di DNA moderatamente ripetute e insieme rappresentano in genere il 35-50% del valore originario del DNA genomico in Ae. aegypti. Il corretto rapporto tra sonda di DNA marcata e non marcato C 0 frazione DNA t dipende dal componente DNA ripetitivo in ogni particolare clone BAC. In media, usiamo 01:20 sonda per C 0 tDNA frazione percentuale per l'ottenimento di un segnale accettabile / rapporto sfondo del risultato FISH. Preibridazione della sonda di DNA con C 0 t frazioni di DNA in una provetta per 30 minuti prima della ibridizzazione effettivo sul vetrino aiuta anche a ridurre il fondo. Etichettatura, ibridazione in sé, e lavaggio in questo protocollo sono eseguite utilizzando condizioni standard 12.

I risultati di due FISH etichettati in modo diverso BAC sonde di DNA sui cromosomi mitotici clone di Ae. aegypti e Cx. quinquefasciatus sono mostrati nelle Figure 4A e B, rispettivamente. Le sonde di DNA clone BAC produrre segnali forti in un'unica posizione sui cromosomi. Cromosomi mostrati in Figura 1 sono colorate con ioduro YOYO-1. Questo colorante produce gli schemi migliori bande di Ae. cromosomi aegypti 9. In alternativa, altri coloranti fluorescenti, come DAPI o ioduro di propidio, può essere utilizzata per thcromosoma e di contrasto. Per photobleaching soppressione delle diapositive, usiamo Prolong antifade mezzo di oro di montaggio. Questo reagente ha buone capacità di conservazione di segnale e può anche essere facilmente rimosso dal vetrino risciacquo in PBS 1x se è necessario utilizzare la stessa slitta per ibridazioni diversi.

Una versione semplice del protocollo FISH è stato progettato per l'ibridazione di IGS rDNA sonda su cromosomi mitotici di Anopheles. Geni ribosomali in Anopheles sono rappresentati come un gruppo polimorfo di geni localizzati sui cromosomi sessuali 16. Una sonda di DNA in questo protocollo è etichettato con standard di reazione di PCR con l'aggiunta contrassegnati in modo fluorescente Cy3 o Cy5 dNTP. Poiché il blocco ibridazione aspecifica di DNA ripetitivo in eucromatina non è necessaria, tutti i passi relativi all'utilizzo C 0 t frazioni di DNA vengono omessi. Invece, preparazioni cromosomiche vengono pretrattati con RNAsi per impedire l'ibridazione della sonda di rDNA IGSil nucleolo. Cromosomi e la sonda di DNA vengono denaturati simultaneamente riscaldando il vetrino con una sonda in un sistema di ibridazione a 75 ° C per 5 min. Ibridazione e lavaggio in questo protocollo vengono eseguiti anche con condizioni standard per FISH 12. Il risultato della FISH è dimostrato nella figura 4C: il polimorfismo dell'ibridazione IGS rDNA tra due cromosomi X è chiaramente visibile.

0 t 3
DNA concentrazione pg / pl Reannealing tempo, min
C 0 t 2 0,1 100
0,3 33
0,5 20
0,7 14
0,9 11
1 10
0,1 150
0,3 50
0,5 30
0,7 21
0,9 17
1 15

Tabella 1. Concentrazione di DNA e tempi reannealing per la preparazione di C 0 C 0 t2 e t3 frazioni.

Figura 1
Figura 1 Fasi dello sviluppo ID in larva 4 ° instar: A) uno dei primi "rotondo" stadio, B) un intermedio "ovale" fase - ottimale per la preparazione dei cromosomi, C) una fase tardiva - non appropriati per i preparati cromosomici. . Le posizioni di ID sono indicati da frecce sul lato ventrale del torace larvale.

Figura 2
Figura 2 Passi di dissezione ID: A) larva decapitata (la direzione dei tagli indicati dalle frecce), B), larve con budello sezionato in trattamento con una soluzione ipotonica (ID si gonfiano e diventano quasi invisibili), C) larva dopo l'applicazione la soluzione di Carnoy (. ID diventano bianche e ben visibili), D) ID sezionato in soluzione di Carnoy. Posizioni di ID in larva sono contraddistinte da un asterisco.

Figura 3
Figura 3 diverse qualità di spread cromosoma: A) uno spread perfetto cromosoma - forma rotonda delle cellule dimostra trattamento adeguato degli ID in soluzione ipotonica, B) un trattamento perfetto ipotonico - cromosomi sono leggermente undersquashed, C) di uno spread cromosoma povero. - il risultatoinsufficiente il trattamento ipotonico è indicato dalla forma ovale delle cellule.

Figura 4
Figura 4. Esempi di pesce con cloni BAC (A, B) e IGS rDNA (C) nei cromosomi di Ae. aegypti (A), Cx. quinquefasciatus (B), e An. gambiae (C). 1, 2 e 3 - sono numeri di cromosomi, X - cromosoma sessuale femminile in An. gambiae.

Discussion

Non fluorescente ibridazione in situ su cromosomi mitotici di zanzare è stata eseguita per la prima volta nel 1990 da A. e K. Kumar Rai 17. In questo studio, 18S e 28S DNA geni ribosomali, clonato nel plasmide insieme uno, sono stati collocati i cromosomi di 20 specie di zanzare. La sonda di DNA è stato marcato radioattivamente e ibridizzati ai cromosomi gangli cerebrali. Tra i tre generi di zanzare, una tecnica FISH è stato sviluppato solo per i cromosomi mitotici dalla linea cellulare di Ae. aegypti 10,18,19 e non è mai stata eseguita su cromosomi mitotici dalle zanzare dal vivo. Recentemente, abbiamo messo a punto una tecnica semplice ed affidabile per ottenere alta qualità di preparazioni cromosomiche da ID di larve di 4 ° instar 9. Questo metodo permette un elevato numero di cromosomi da ottenere in una diapositiva e può essere usato universalmente per tutte le specie di zanzare. La necessità di usare sta solo larve non, pupa o adultoGES di zanzare, per la preparazione del vetrino è probabilmente l'unica limitazione del metodo. Il metodo FISH standard a 12 è stato ottimizzato per l'utilizzo di genomica BAC clone e IGS rDNA come sonde per i cromosomi mitotici di Aedes, Culex e Anopheles.

In aggiunta a queste specifiche applicazioni, i protocolli FISH qui descritte possono anche essere utilizzati per altri scopi. Il protocollo FISH avanzata, che utilizza C 0 t frazioni di DNA per bloccare ibridazione non specifica, può essere applicato anche per l'ibridazione di cloni BAC o qualsiasi altri frammenti di DNA grandi regioni eterocromatiche di Anopheles. Regioni eterocromatiche si arricchiscono di elementi trasponibili e ripete le altre, e le sonde di queste regioni producono normalmente forte background sui cromosomi 3. Utilizzo senza etichette C 0 frazioni di DNA t contribuirà a ridurre l'ibridazione non specifica della sonda ai cromosomi. La versione semplice della FISH protocol può essere utilizzato per qualsiasi rDNA o sonde di DNA ripetute sui cromosomi mitotici di zanzare e altri insetti. Inoltre, può anche essere applicato per la ibridazione di DNA clone BAC in specie con basso contenuto di DNA ripetitivo in regioni eucromatiche come Anopheles o Drosophila. Il protocollo qui proposto contribuirà ad ottenere altamente cromosoma finiti a base di gruppi di genoma per le zanzare e può essere ampiamente utilizzato per applicazioni diverse citogenetici in altri gruppi di insetti.

Disclosures

Nessun conflitto di interessi dichiarati.

Acknowledgments

Ringraziamo Sergei Demin e Tatyana Karamysheva per il loro aiuto nella preparazione dei cromosomi e FISH su Anopheles. Ringraziamo anche David Severson per averci fornito Aedes e Culex DNA genomico cloni BAC e Melissa Wade per la modifica del testo. Questo lavoro è stato sostenuto da due sovvenzioni dal National Institutes of Health: 1R21 AI88035-01 a Maria V. Sharakhova e 1R21 AI094289-01 a Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics