Lysrör

Immunology and Infection
 

Summary

Bland de tre mygga släkten, nämligen

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fluorescerande in situ-hybridisering (FISH) är en teknik som rutinmässigt används av många laboratorier för att bestämma den kromosomala positionen för DNA-och RNA-prober. En viktig tillämpning av denna metod är att utveckla högkvalitativa fysiska kartor användbara för att förbättra genomet församlingar för olika organismer. Den naturliga banding mönstret av polytena och mitotisk kromosomer ger vägledning för exakt beställning och orientering genomiska supercontigs. Bland de tre mygga släkten, nämligen Anopheles, Aedes och Culex, en väletablerad kromosom-baserade kartläggning teknik har utvecklats enbart för Anopheles, vars medlemmar besitter läsbara polytena kromosomer 1. Som ett resultat av arbetet genomet kartläggning, 88% av An. gambiae genomet har placerats till exakta kromosom positionerna 2,3. Två andra mygga släkten, Aedes och Culex, har dåligt polytenized kromosomer Because betydande överrepresentation av transposabla element i deras genomen 4, 5, 6. Endast 31 och 9% av de genomiska supercontings har tilldelats utan order eller orientering till kromosomer Ae. aegypti 7 och Cx. quinquefasciatus 8, respektive. Mitotisk kromosom förberedelse för dessa två arter hade tidigare varit begränsad till hjärnan ganglier och cellinjer. Men kromosom bilder framställda från hjärnan ganglierna av myggor brukar innehålla låga antalet metafas plåtar 9. Dessutom, även om en FISH teknik har utvecklats för mitotiska kromosomer från en cellinje av Ae. aegypti 10 gör ackumulering av flera kromosomala omflyttningar i kromosomer cellinje 11 dem värdelösa för genomet kartläggning. Här beskriver vi en enkel, robust teknik för att erhålla högkvalitativa preparat mitotiska kromosom från imaginal skivor (ID) av 4: e instar larver som cen kan användas för alla tre släkten av myggor. En standard FISK protokoll 12 är optimerad för att använda BAC kloner av genomisk DNA som en sond på mitotiska kromosomer Ae. aegypti och Cx. quinquefasciatus, samt för att använda en intergen distansorgan (IGS) regionen av ribosomala DNA (rDNA) som en prob på en. gambiae kromosomer. Utöver den fysiska kartläggning kan den utvecklade tekniken tillämpas på befolkningen cytogenetik och kromosom taxonomi / systematik myggor och andra grupper insekter.

Protocol

1. Kromosomberedning

Mygglarver har fötts upp med hjälp av ett standardprotokoll som beskrivs i Methods in Anopheles Research finns på webbplatsen för Malaria Forskning och referensreagens Resource Center (MR4) 13. De temperaturer mygga uppfödning ändrades för att ge det högsta antalet kromosomer i imaginal skivor och lägsta dödlighet av larverna. Stegen i mygglarver utveckling fastställdes baserat på storleken på deras huvud kapslar 13.

  1. Hatch mygga ägg vid 28 ° C, och efter 2-3 dagar, överföring 2: a eller 3: e instar larver till 16 ° C för Ae. aegypti och Cx. quinquefasciatus och till 22 ° C under en. gambiae.
  2. Placera 4: e instar larver på is i flera minuter för immobilisering.
  3. Överför larv till en bild med en droppe kall hypoton lösning (0,5% såmedium citrat eller 0,075 M kaliumklorid), och placera den under stereomikroskop.
  4. Välj larv med ovala ID (Figur 1B) för ytterligare dissektion.
  5. Halshugga larv, och skär nagelbanden från den ventrala sidan av larver bröstkorgen med dissekera sax (Figur 2A). Göra ytterligare sänkning andra eller tredje buken segment att dissekera tarmen från larv. Riktningarna för skårorna visas med pilar.
  6. Öppna nagelband och ta bort tarmen och fett kroppen från larv. Ta bort hypoton lösning från bilden med filterpapper, och lägga till en ny droppe hypoton lösning direkt till ID (Figur 2B). Förvara larv i hypoton lösning under 10 min vid RT.
  7. Avlägsna hypoton lösning med filterpapper, och applicera Carnoys lösning (etanol / ättiksyra i förhållandet 3:1). När du har lagt fixeringslösning, IDS vända omedelbart vitt och blir väl synliga under mikroskop (Figur 2C
  8. Med hjälp av dissekera nålar, ta bort ID från larv (Figur 2D), och överföra dem till en minskning med 50% propionsyra. Ta bort alla andra vävnader, såsom tarmen och fett kropp, från sliden. Täck ID med unsiliconized 22x22 täckglas, och hålla i 10 minuter vid RT.
  9. Täck bilden med filterpapper, och squash vävnaden genom att knacka på radergummit på en penna på omkretsen av täckglas.
  10. Kortfattat analysera kvaliteten på bilden med hjälp av faskontrastmikroskop i 100x eller 200x förstoring (Figur 3). Preparat med> 50 kromosom sprider kan anses lämpliga för FISH.
  11. Doppa och håll bilden i flytande kväve tills det tar stopp bubblande. Avlägsna täckremsan från sliden med hjälp av ett rakblad, och överföra bilden omedelbart till en container med 70% etanol kyld vid -20 ° C. Lagra vid 4 ° C under minst 1 timme för bästa resultat uttorkning (om nödvändigt, kan diabilder lagras vid thans steg från flera minuter till flera dagar).
  12. Dehydratisera objektglasen i en serie av etanol (70%, 80%, 100%) vid 4 ° C under 5 minuter vardera, och lufttorka vid RT.
  13. Förvaras torrt bilder vid -20 ° C innan utnyttja dem för FISH.

2. Extraktion av repetitivt DNA Fraktioner

Utföra Fisk av BAC-klon DNA-prob på kromosomer från Ae. aegypti och Cx. quinquefasciatus innebär användning omärkta repetitiva DNA fraktioner för att blockera ospecifik hybridisering av DNA upprepas till kromosomerna. Den reassociation av enkelsträngat DNA fragmenteras i bitar av flera hundra bp följer en C 0 t kurva där C 0 är den initiala koncentrationen av enkelsträngat DNA och t är den tid återparning. DNA fraktioner med C0t värden lika med 10 -4 -10 -1 eller 10 ° -10 2 anses som mycket och måttligt repetitiva, respektive.

  1. Utdrag 400-500 ng av genomiskt DNA från hela vuxen mygga med Qiagen Blod och Cell Culture Maxikit, och förbereda 100-1000 ng / pl DNA-lösning i 1,2 x SSC.
  2. Denaturera DNA genom att placera en säker lås rör med genomiskt DNA i ett värmeblock förvärmts till 120 ° C under 2 minuter. Hög temperatur hjälper till att sträcka DNA i 200-500 bp fragment.
  3. Beroende på DNA-koncentrationen, associera DNA genom att placera röret vid 60 ° C under 15-150 minuter för att erhålla C 0 t DNA-fraktioner upp till C 0 t3 (Tabell 1).
  4. Placera röret med DNA på is under 2 minuter.
  5. Överför DNA till 42 ° C, tillsätt förvärmt 10x S1 nukleas-buffert och S1-nukleas till en slutkoncentration av 100 E per 1 mg DNA, och inkubera under 1 timme.
  6. Fällning-DNA genom att tillsätta 0,1 volym av 3 M natriumacetat och 1 volym isopropanol vid RT.
  7. Centrifugera vid 14.000 rpm i 20 minuter vid 4 ° C.
  8. Tvätta DNA i 70% etanol, och centrifugera igen vid 14.000 rpm under 10 minutervid 4 ° C.
  9. Lufttorra och lös DNA pelleten i TE-buffert.
  10. Mät DNA-koncentrationen, och visualisera genom gelelektrofores. Vanligtvis den slutliga mängden av repetitiva DNA-fraktioner representerar 35-50% av den ursprungliga DNA beloppet.

3. DNA-sond Märkning

Två olika protokoll har använts för märkning BAC-klon DNA-prob och IGS rDNA sond.

3,1 BAC-klon märkning med nick-translation

  1. Utdrag BAC-klon DNA från BAC-biblioteket med Qiagen Stor Construct Kit.
  2. Bered reaktionsblandningen för nick-translation märkning på is med slutlig volym av 50 ul: 1 pg isolerat BAC-klon-DNA, 0,05 mM vardera av omärkt dATP, dCTP och dGTP och 0,015 mM dTTP, 1 | il av Cy3-dUTP (eller annan fluorokrom), 0,05 mg / ml BSA, 5 pl 10x nick-translationsbuffert, 20 U av DNA-polymeras I, och 0,0012 U DNas.
  3. Inkubera vid 15 ° C under 20,5 tim.
  4. Stoppa reaktionen genom att tillsätta 1 pl 0,5 M EDTA.
  5. Förvara sond vid -20 ° C i mörker.

3,2 IGS rDNA märkning med användning av PCR

  1. Bered reaktionsblandningen på is med slutlig volym av 50 | il: 200 ng genomiskt DNA, 0,05 mM vardera av omärkt dATP, dCTP och dGTP, 0,015 mM dTTP, 1 | il av Cy3-dUTP (eller annan fluorokrom), 5 pl 10x PCR-buffert, 50 pmol framåt, FN (GTGTGCCCCTTCCTCGATGT) och omvänt, GA (CTGGTTTGGTCGGCACGTTT) primrar för amplifiering försäkringsgarantisystem, och 10 U Taq DNA-polymeras 14.
  2. Utför PCR-reaktion med användning av standard-PCR parametrar för försäkringsgarantisystem amplifiering: 95 ° C / 5 min x 1 cykel, (95 ° C / 30 sek, 50 ° C / 30 sek, 72 ° C / 30 sek) x 30 cykler, 72 ° C / 5 min x 1 cykel, och 4 ° C håll 14.
  3. Förvara sond vid -20 ° C i mörker.

4. Fluorescent in situ hybridisering

och Cx. quinquefasciatus och den andra för att använda IGS rDNA på mitotiska kromosomer från An. gambiae. Om du använder BAC klon DNA-sonder, steg hoppa RNas behandling 4,3, 4,4, och samtidig bild / sond denatureringssteg 4,19. Om du använder IGS rDNA sond, förbereda hybridiseringsblandning utan C 0 t-DNA fraktioner, och hoppa separat bild / sond denaturering steg 4,10, 4,11, 4,16 och 4,17.

  1. Inkubera objektglasen i 2x SSC under 30 minuter vid 37 ° C.
  2. Torka objektglasen i serien av 70%, 80% och 100% etanol i 5 minuter vardera vid RT, och lufttorka. Om du utför fisk med BAC-klon-DNA, fortsätt direkt till steg 4,5.
  3. Inkubera kromosom beredning i 0,1 mg / ml RNas lösning under parafilm under 30 min vid 37 ° C.
  4. Tvätta två gånger i 2 x SSC under 5 min vardera vid 37 ° C.
  5. Sätt bilder iNa burk med 0,01% pepsin och 0,037% HCl-lösning, och inkubera under 5 min vid 37 ° C.
  6. Tvätta objektglasen i 1 x PBS under 5 min vid RT.
  7. Fix kromosom beredning i en burk med 1% formalin i 1 x PBS framställdes från 10% neutral buffrad formalin under 10 minuter vid RT.
  8. Tvätta objektglasen i 1 x PBS under 5 min vid RT.
  9. Torka objektglasen i serien av 70%, 80% och 100% etanol i 5 minuter vardera vid RT, och lufttorka förberedelser vid 37 ° C. Om du utför fisk med IGS, gå direkt till steg 4,12
  10. Denaturera bilder i en burk med förvärmd 70% formamid under 2 minuter vid 72 ° C.
  11. Dehydratisera objektglasen i serie kall (-20 ° C) 70%, 80%, och 100% etanol under 5 minuter vardera, och lufttorka vid 37 ° C.
  12. Förbered hybridiseringsblandning:. 5 pl märkt sond DNA från steg 3, 10 ^ C 0 t-DNA från steg 2 med slutlig koncentration av 0,5 ng / l, och 5 pl 1 ng / l sonikerat laxsperma-DNA för fisk med IGS rDNA, förberedahybridiseringsblandning utan C 0 t DNA-fraktioner.
  13. Fällning-DNA genom att tillsätta 0,1 volym av 3 M natriumacetat och 2 volymer etanol. Håll vid -20 ° C under 1-3 timmar.
  14. Centrifugera vid 14.000 rpm vid 4 ° C under 20 minuter, avlägsna etanolen, och lufttorka pelleten vid RT.
  15. Grundligt lös pelleten i 10 pl hybridiseringsbuffert:. 50% formamid, 20% dextransulfat, 2x SSC Om du utför fisk med IGS, gå direkt till steg 4,18
  16. Denaturera hybridisering blandning under 7 minuter vid 97 ° C, och omedelbart på is under 1 minut.
  17. Prehybridize blandningen vid 37 ° C under 30 minuter för att förhindra ospecifik hybridisering av repetitivt DNA till kromosomer.
  18. Placera 10 ul av hybridiseringsblandningen på bilden, och täck med en 22x22 täckglas. Förhindra blåsbildning - luftbubblor tas bort med lätt tryck på täckglaset Om du utför fisk med BAC-klon-DNA, fortsätt direkt till steg 4,20 <./ Em>
  19. Denaturera prob och kromosom-DNA samtidigt med ett värmeblock vid 75 ° C under 5 minuter.
  20. Lim täckglas runt omkretsen med gummi cement.
  21. Utför natten hybridisering i en fuktig kammare vid 37 ° C.
  22. Ta gummi cement och skyddsremsan från bilden.
  23. Tvätta bild 2 min i förvärmd lösning 1 (0,4 x SSC, 0,3% Nonidet-P40) vid 73 ° C.
  24. Tvätta objektglasen i lösning 2 (2 x SSC, 0,1% Nonidet-P40) under 5 min vid RT.
  25. Motfärga objektglaset med 0,001 mM YOYO-1 i 1 x PBS under 10 min i fuktkammare vid RT.
  26. Montera i en liten mängd av reagens Prolong Guld antifad med ett täckglas.
  27. Analysera förberedelser under ett fluorescerande mikroskop med lämpliga filter uppsättningar vid 1.000 x förstoring (Figur 4).

5. Representativa resultat

Insect ID är placerade i varje segment av larven. Beroende på läget, they förvandlas till olika vävnader i vuxen skede av insekten. De ID, som används för kromosom beredning i detta protokoll, utvecklas till ben i den vuxna skede av mygga. Dessa ID: n finns på den ventrala sidan av larver bröstkorgen och är klart synliga genom ytterhud under mikroskop (figur 1). Vid början 4: e instar larvstadiet, ID har en rund form (figur 1A). Flest mitos, är ~ 175 i ett ID 9 ackumulerade senare "oval" stadium (Figur 1B), vilket måste anses vara den optimala scenen för preparatet. Vid denna tidpunkt delar den mellanliggande ID i två: en förvandlas till ett ben och en annan en förvandlas till en vinge. Vi föredrar att använda de stora ben-ID på "ovala" scenen för kromosom preparatet. Figur 1C visar ID på den senaste fasen av 4: e instar larver utveckling. Vid detta skede,ID: n redan utvecklats till ben och vingar, och innehåller en betydande mängd av differentierade vävnader och ett lågt antal mitos. Detta stadium av ID utveckling bör undvikas för kromosom preparatet. Vi rekommenderar också uppfödning mygglarver vid låga temperaturer:. 16 ° C för Aedes och Culex och 22 ° C för Anopheles Detta bidrar till att öka mängden mitos i ID 9.

Figur 2 visar ID-dissektion från bröstkorgen av 4: e instar larv. Eftersom nagelbanden av en levande insekt är svårt att dissekera, rekommenderar vi att du använder dissekera sax istället för nålar som vanligtvis används för larv beredning. Det mest avgörande förfarandet för erhållande av hög kvalitet kromosom preparat är hypoton lösning behandling. För bästa resultat, tar vi bort tarmen och fett kroppen från larver bröstkorgen innan denna behandling. Svullnad av ID-cellerna under detta förfarande bidrar till att sprida kromosoms på en slid (figur 3A). Lämplig kvalitet hos den hypotona lösningen behandlingen kan lätt igen av den runda formen av celler i preparaten (figur 3A, B). Celler med en oval form indikerar otillräcklig hypoton lösning behandling (figur 3C). Väljas för fisk, kromosom förberedelse innehålla minst 50 högkvalitativa kromosom uppslag. Normalt ~ 90% av bilderna framställda med användning av detta protokoll har tillräcklig kvalitet för FISH 9.

Vi presenterar två lite olika fiskar protokoll: en avancerad protokoll för FISH med genomisk BAC-klon DNA-prob på mitotiska kromosomer Aedes och Culex och en enkel FISH protokoll för IGS rDNA sond på mitotiska kromosomer Anopheles. Genomen hos Aedes och Culex är mycket repetitiva grund av överrepresentation av överförbara element 7,8. Således utför fisk, som utilizes genomiskt BAC-klon-DNA som en sond, kräver tillsats omärkta repetitiva DNA-fraktioner till proben för att blockera ospecifik hybridisering av DNA upprepas till kromosomer. För utvinning av de repetitiva DNA-fraktioner, är genomiskt DNA denaturerades vid 120 ° C under 2 minuter. Kokande DNA vid en hög temperatur bidrar också till att erhålla DNA i fragment av 200-500 bp. DNA tillåts att associera efter denna behandling. Den mycket repetitiva DNA-fragmenten tenderar att hitta sin partner för återförening snabbare än DNA med unika sekvenser gör. Som ett resultat följer att återförening av DNA en C 0 X t kurva där C 0 är den initiala koncentrationen av enkelsträngat DNA, och t är tiden återparning. DNA fraktioner med C 0 t-värden lika med 10-4 - 10-1 eller 100-102 anses mycket och måttligt repetitiva, respektive. Tiden för återförening för olika C 0 t-DNA fraktioner kan beräknas med ee formel t = C 0 t X × 4,98 / C 0, där t - inkubationstid, C 0 t X - C 0 t fraktion (C0t 1 = 1, C 0 t 2 = 2, osv) och C 0 - initiala DNA-koncentrationen i pg / il 15 (tabell 1). Efter reassociering, den enkelsträngade DNA digererades med S1-nukleas. Vi föredrar att använda alla C 0 t DNA-fraktioner upp till C 0 t 3 tillsammans i stället för den vanliga C 0 t 1 DNA-fraktionen. Dessa C 0 t fraktioner finns några av de måttligt repetitiva DNA-sekvenser och tillsammans normalt innebär 35-50% av den ursprungliga mängden av DNA i Ae. aegypti. Den korrekta proportionen mellan märkt DNA-sond och omärkt C 0 t DNA-fraktion beror på den repetitiva DNA-komponenten i varje särskilt BAC-klon. I genomsnitt använder vi 1:20 prob till C 0 tonDNA-fraktion andel för att få ett godtagbart signaler / bakgrund förhållandet FISH resultatet. Förhybridisering av DNA-proben med C 0 t DNA-fraktioner i ett rör för 30 minuter innan den faktiska hybridiseringen på objektglaset bidrar också till att minska bakgrunden. Märkning, hybridisering själv, och tvätta i detta protokoll utförs med standardförhållanden 12.

Fisken Resultaten av två olika märkta BAC klon DNA-prober för mitotiska kromosomer AE. aegypti och Cx. quinquefasciatus visas i figurerna 4A och B, respektive. BAC klon DNA-prober ger starka signaler i en enda position på kromosomerna. Kromosomer visas i figur 1 är motfärgades med YOYO-1 jodid. Detta färgämne ger de bästa bandmönster på Ae. aegypti kromosomerna 9. Alternativt, kan andra fluorescerande färgämnen, såsom DAPI eller propidiumjodid, utnyttjas för the kromosom motfärgning. För att undertrycka fotoblekning av bilderna använder vi förlänga guld antifad monteringsmedium. Denna reagens har god förmåga signal bevarande och även lätt kan avlägsnas från objektglaset genom sköljning i 1 x PBS, om det är nödvändigt att använda samma objektglas för flera hybridiseringar.

En enkel version av FISH-protokollet är utformat för hybridisering av IGS rDNA sond på mitotiska kromosomer Anopheles. Ribosomala gener i Anopheles representeras som en polymorf kluster av gener belägna på könskromosomerna 16. En DNA-sond i detta protokoll märks med standard PCR-reaktion genom att lägga fluorescensmärkta Cy3 eller Cy5 dNTP. Eftersom blockering ospecifik hybridisering av repetitiva DNA i eukromatin inte behövs, är alla steg i samband med användning av C 0 t-DNA fraktioner utelämnas. Istället kromosom preparat förbehandlas med RNas för att förhindra hybridisering av IGS rDNA sonden tillde kärnsystemet. Kromosomer och DNA-sonden denatureras samtidigt genom upphettning sliden tillsammans med en prob i en hybridiserings-system vid 75 ° C under 5 minuter. Hybridisering och tvätt i detta protokoll utförs också användning av standardbetingelser för FISH 12. Resultatet av FISH visas i figur 4C: polymorfismen av IGS rDNA hybridisering mellan två X-kromosomer syns tydligt.

0 t 3
DNA-koncentrationen ug / ul Återparning tid, min
C 0 t 2 0,1 100
0,3 33
0,5 20
0,7 14
0,9 11
1 10
0,1 150
0,3 50
0,5 30
0,7 21
0,9 17
1 15

Tabell 1. DNA-koncentration och återparning tider för beredning av C 0 T2 och C 0 t3 fraktioner.

Figur 1
Figur 1 Steg för ID-utvecklingen i 4: e instar larv: A) en tidig "rund form" stadium, B) en mellanliggande "oval form" scenen - optimal för Kromosomberedning, C) ett sent skede - olämpligt för kromosom preparat. . Positionerna för ID indikeras med pilar på den ventrala sidan av larver bröstkorgen.

Figur 2
Figur 2 Steg av ID dissektion: A) avhuggna larv (riktning nedskärningar anges med pilar), b) larver med dissekerade tarmen i hypoton lösning behandling (ID svälla och bli nästan osynlig), c) larv efter Carnoys lösning ansökan (. ID blir vit och klart synlig), d) dissekeras ID i Carnoys lösning. Positioner för ID i larv anges med asterisker.

Figur 3
Figur 3 olika kvaliteter av kromosomen smörfettsprodukter: A) en perfekt kromosom spridning - rund form av cellerna demonstrerar tillräcklig behandling av ID i hypoton lösning, b) en perfekt hypoton behandling - kromosomer är något undersquashed, c) en dålig kromosom spridning. - resultatet avotillräcklig hypoton behandling indikeras av oval form av cellerna.

Figur 4
Figur 4. Exempel på fisk med BAC-kloner (A, B) och IGS rDNA (C) i kromosomer Ae. aegypti (A), Cx. quinquefasciatus (B), och An. gambiae (C). 1, 2 och 3 - är antalet kromosomer, X - kvinnligt kön kromosom i en. gambiae.

Discussion

Icke-fluorescerande in situ hybridisering på mitotiska kromosomer av myggor utfördes för första gången 1990 av A. Kumar och K. Rai 17. I denna studie, 18S och 28S ribosomala gener DNA, klonades tillsammans i en plasmid, placerades på kromosomer av 20 arter av myggor. DNA-sonden märktes radioaktivt och hybridiserades till kromosomerna från hjärna ganglier. Bland tre mygga släkten, har en FISH-teknik utvecklats endast för mitotiska kromosomer från cellinjen av Ae. aegypti 10,18,19 och har aldrig utförts på mitotiska kromosomer från levande myggor. Nyligen har vi utvecklat en enkel, robust teknik för att erhålla högkvalitativa kromosom preparat från ID för 4: e instar larver 9. Denna metod medger ett stort antal kromosomer som kan erhållas i en bild och kan användas universellt för alla arter av myggor. Nödvändigheten av att använda enbart larver, inte pupal eller vuxen staGES av myggor, för preparatet är förmodligen den enda begränsningen av metoden. Standarden FISH metoden 12 var optimerad för användning genomisk BAC-klon och IGS rDNA som prober för de mitotiska kromosomer av Aedes, Culex, och Anopheles.

Utöver dessa specifika tillämpningar kan FISH protokoll som beskrivs här också användas för andra ändamål. Den avancerade FISH protokoll, som använder C 0 t-DNA fraktioner för att blockera ospecifik hybridisering kan också användas för hybridisering av BAC-kloner eller andra stora DNA-fragment i heterochromatic regioner Anopheles. Heterochromatic regioner berikad med överförbara element och andra upprepar, och sonder från dessa regioner normalt producerar stark bakgrund på kromosomerna 3. Använda omärkta C 0 t-DNA fraktioner kommer att bidra till att minska ospecifik hybridisering av sonden till kromosomerna. Den enkla versionen av FISH protocol kan användas för något rDNA eller repetitiva DNA-prober för mitotiska kromosomer av myggor och andra insekter. Dessutom, även det kan användas för hybridisering av BAC-klon DNA i arter med låg repetitivt DNA-innehåll i euchromatic regioner såsom Anopheles eller Drosophila. Protokollet föreslås här kommer att bidra till att få högt färdiga kromosom-baserade genomet församlingar för myggor och kan i stort sett användas för olika cytogenetiska applikationer i andra grupper av insekter.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

Vi tackar Sergei Demin och Tatyana Karamysheva för deras hjälp med kromosom förberedelse och fisk på Anopheles. Vi tackar också David Severson för att ge oss Aedes och Culex genomisk DNA BAC-kloner och Melissa Wade för redigering av texten. Detta arbete stöddes av två anslag från National Institutes of Health: 1R21 AI88035-01 till Maria V. Sharakhova och 1R21 AI094289-01 till Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics