오픈 책 준비에 DiI 주입하여 개발 신경 튜브와 Phenotypes의 평가에 miRNA 기반 Plasmids의 비켜 Electroporation에

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

신경 튜브의 유전자 발현은 세포 유형의 특정, 추적 방식으로 downregulated 할 수있는이 방법이 설명되어 있습니다. 우리는 방법을 보여줍니다

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Commissural dI1 뉴런은 광범위하게 개발 1,2 동안 축삭 안내를 근간 메커니즘을 명료하게하다하는 연구되었습니다. 이 뉴런은 등쪽 척추에 위치하고 있으며, 틀에 박힌 궤도를 따라 자신의 axons을 보내 수 있습니다. Commissural axons는 처음으로 다음 floorplate에서 ventrally 프로젝트. 중간 선을 넘어 한 후에는 다음과 axons은 길이 방향으로 뇌에 대한 날카로운 뱃 부리 장식이있는 회전과 프로젝트를합니다. 다음 단계에 각각 매력적이고 혐오스러운지도 단서의 조율 된 활동에 의해 조절된다. 이러한 신호의 올바른 해석은 demarcated 경로를 따라 axons의지도에 매우 중요합니다. 따라서, commissural 축삭 안내에 특정 분자의 생리 기여 이상적인 생활 배아의 맥락에서 조사하고 있습니다. 따라서, 생체 내 유전자 최저는 정확하게 신중하게 여러 재생할 수 있습니다 유전자의 축삭 유도 활동을 구분하기 위해 통제되어야합니다개발하는 동안 역할.

여기, 우리는 셀 타입 별, 추적 방식으로 닭 신경 튜브의 분해 유전자 발현하는 방법을 설명합니다. 우리는 3 셀 타입 별 발기인 / 형광 단백질 마커의 표현을 유도 강화를 품고 miR30-RNAi의 성적표 4 (cDNA 인코딩 형광 단백질의 3'-UTR 내에있는 ()에 의해 직접 다음 소설 플라스미드 벡터를 사용하여 그림 1). 개발 신경 튜브에 electroporated 때,이 벡터는 유전자 발현의 효율적인 downregulation을 유도하고 최저 3 체험 세포의 추적 직접 사용 밝은 형광 마커 단백질을 표현한다. electroporation하기 전에 다른 RNAi 벡터를 혼합하면 척추의 독립적 인 지역에서 두 개 이상의 유전자의 동시 분해 할 수 있습니다. 이 빠른 방식, S에서 개발되는 동안 검사되는 복잡한 세포와​​ 분자 상호 작용을 허용, imple 정확하고 저렴. 오픈 도서 준비 5 commissural 축삭의 탄도의 DiI 추적과 함께,이 방법은 commissural 축삭의 성장과지도의 세포와 분자 메커니즘의 생체 연구를위한 유용한 도구입니다. 원칙적으로 모든 발기인 / 인핸서는 잠재적으로 개발 6시 유전자 기능의 생체 연구에 대한 기술이 널리 적용하고, 사용할 수 있습니다.

이 동영상을 먼저 처리하는 방법을 보여줍니다 및 창 계란, 신경 튜브에 DNA의 plasmids의 주입과 electroporation 절차. commissural 축삭 안내를 조사하려면, 척추은 오픈 북 준비로 배아에서 제거 고정하고, 축삭 경로를 추적 할 수 있도록 DiI으로 주입된다. 척추 코드는 coverslips 사이에 장착 공 촛점 현미경을 사용하여 시각화합니다.

Protocol

1. 셀 타입 별 유전자 입을에 대한 RNAi 플라스미드 DNA의 작성

Plasmids는 (그림 1)과 같은 이전에 상세 3,4에 설명 된 표준 분자 복제 기술을 사용하여 합성합니다.

벡터에 1.1 복제 : oligonucelotide 디자인

  1. 우리는 같은 보편적 oligonucleotides와 pRFPRNAiC 벡터 4 (아크 - 유전체학)와 함께 제공되는 제품 정보에 설명되어 복제 프로토콜을 사용합니다.
    1. 첫 번째 머리 핀의 자형 사이트에 복제를 들면 :
      5 '프라이머 HP1 :
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 '프라이머 HP1 :
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. : 두 번째 머리 핀의 자형 사이트에 복제에 대한
      5 '프라이머 HP2 :
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 '프라이머 HP2 :
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. : 우리는 유전자 특정 대상 시퀀스를 선택 Genscript의 siRNA 대상 찾기를 사용 https://www.genscript.com/ssl-bin/app/rnai을 .
  3. 첫 번째 머리 핀의 자형 사이트에 복제 유전자 특정 miRNA를위한 프리 머 :

입을 GFP에 대한 예는 다음과 같습니다.
대상 시퀀스 (22nt) : 5'-GGCACAAGCTGGAGTACAACTA
GFP 전달 HP1은 = 59mer
순서 1
GFP 역 HP1은 = 58mer
순서 2
miRNA 측면을 노릴 시퀀스 (닭 특정) 및 일반적인 루프 / 줄기 시퀀스 (인간 miRNA30에서)의 일부를 구성하는 이러한 oligos의 일반적인 시퀀스가​​ 있습니다. 유전자 특정 대상 시퀀스는 밑줄 있습니다. 오전가 있습니다이 위치에 miRNA30의 자연 불일치을 모방하기 위해, (G →이 예에서 A는 굵은 글씨로 표시) 앞으로 가닥의 5 '기지에서 ismatch.

  1. 번째 머리 핀의 자형 사이트에 복제 유전자 특정 miRNA를위한 프리 머 :

입을 LacZ에 대한 예는 다음과 같습니다.
대상 시퀀스 (22nt) : 5'-CGCGCTGTATCGCTGGATCAAA
LacZ 전달 HP2 :
순서 3
LacZ 역 HP2 :
순서 4
다시 앞으로 스트랜드의 대상 시퀀스의 5 '베이스가 변경되었습니다합니다 (굵은 글씨로 표시, C →이 예에서 A) 때문에이 불일치 안티센스 순서를, miRNA30을 흉내 그.

1.2 PCR 반응 및 Subcloning

  1. 유전자 특정 oligos 우리 아르닭과 miRNA30 같은 머리 핀의 자형을 생성 할 수있는 PCR 반응의 보편적 oligos과 함께 에드 측면을 노릴 시퀀스를 miRNA.
첫번째 머리 핀의 자형 사이트에 복제 :
μl 1-10 것이다 GFP 앞으로의 프라이머 HP1
1 μl - 100 NG 5 '프라이머 HP1
1 μl - 100 NG 3 '프라이머 HP1
1 μl dNTPs (10 ㎜)
5 μl 10X PFU 반응 버퍼
1 μl PFU의 DNA 중합 효소 (Promega)
39 μl PCR-등급 물
OR 둘째 머리 핀의 자형 사이트에 복제 :
μl 1-10 것이다 LacZ 앞으로의 프라이머 HP2
1 μl - 100 NG 5 '프라이머 HP2
1 μl - 100 NG 3 '프라이머 HP2
1 μl dNTPs (10 ㎜)
5 μl 10X PFU 반응 버퍼
1 μl PFU의 DNA 중합 효소 (Promega)
39 μl PCR-등급 물

사이클 :

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 분 30 초 30 초 1 분 9 분 보유
30주기
  1. 벡터에 제한 효소와 subclone으로 소화, PCR 제품을 정화 :
    1. 먼저 머리 핀의 자형 사이트 : 사용 NheI 및 MluI
    2. 제 머리 핀의 자형 사이트 : 사용 MluI 및 SphI
  2. 관할 박테리아 세포의 변화에​​ 대한 표준 기술을 따르십시오. 플라스미드 midipreparation (예 : Nucleobond Xtra 미디 키트, Machery-Nagel)에 의해 LB 한천 (암피실린을 포함) 및 수확 DNA에 플레이트 세포.
  3. 집중 플라스미드 DNA를 일시 중지-20 ° C.에서 분광 광도법 및 매장의 멸균 ddH 2 0, 측정 농도의

1.3 시퀀싱의 miRNA의 plasmids

표준 조건에서 시퀀싱 반응은 종종 헤어핀 강한 부차적 인 구조물로 인해 실패합니다. 이 7 개선하는 방법은 다음과 같습니다

  1. 대신 물 0.01 MM EDTA (에틸렌 다이아 민 테트라 초산) (산도 8.0)을 갖춘 10 MM 트리스-CL의 시퀀싱 반응을 수행합니다. 이 순서에 대한 더 많은 의무가 있습니다 ssDNA에 supercoiled DNA의 변환을 증가시킵니다.
  2. 열 변성 단계를 추가합니다 (98 ° C, 5 분) 이전 시퀀싱합니다. 이 ssDNA에 supercoiled DNA 플라스미드를 변환합니다.

2. Electroporation

2.1 달걀 처리

  1. 38.5 ° C와 ~ 45 % 습도에 보육 세트에 계란을 넣습니다.
  2. 배아는 개발의 원하는 단계에 도달 할 때까지 알을 품다. commissural 뉴런의 축삭 안내를 연구하기 위해, 우리는 typicall사람들이 햄버거 & 해밀턴 (HH) 무대 17-18 (부화의 약 3 일 후에) 8에 도달했을 때 y는 배아를 electroporate. 관심 단백질이 축적되기 전에 그러나, 주입 및 electroporation은 최저 효율적 만들기 위해 수행해야합니다.
  3. 보육에서 알을 제거하고 계란의 상부면에 노른자 위의 배아를 변경하기 20 분에 안정적인 수평 위치에 넣어. 이 기간 동안 인큐베이터에 달걀을 반환합니다.

시약 및 장비의 2.2 준비

  1. 생리 (PBS)를 버퍼 인산염을 준비 및 필터 0.2 μm을 autoclaving를 통해 솔루션을 전달하여 소독.
  2. 모세 혈관을 당겨 유리 micropipettes을 (세계 정밀 계측기 1B120F-4, 1.2 / 0.68 OD / ID (mm)) 적절한 당기는 장치 (예 : Narishige PC-10). ~ 5 μm의 팁 직경을 얻기 위해 micropipette의 끝을 깨고과 튜브의 한 부분에 연결적절한 직경.
  3. 0.5 cm의 간 전극 거리와 함께 단단히 휴대용 프레임에 백금 전극을 (0.5 cm 길이) 탑재합니다. 사각 파 펄스 발생기 (BTX ECM 830)에 전극을 연결합니다.
  4. 다음 매개 변수를 사용하여 펄스 발생기를 설정합니다 :
    1. 일방적 electroporation를 들면 : 전압 : 25 V, 펄스의 수 : 5, 펄스의 길이 : 50 밀리 초, interpulse 간격 : 1 초
    2. 전압 : 18 V, 펄스 번호 : 펄스의 5, 길이 : 50 밀리 초, interpulse 간격 : 1 초 양국 electroporation에 대한
  5. 18 G 바늘, 메스, 70 %의 에탄올과 테이프 뿜어 서 냉각 병에 주사기를 준비합니다.
  6. 80 ° C.에서 가열 플레이트에 비커에 파라핀 왁스를 녹여

2.3 윈도우

  1. 70 % 에탄올에 배어 조직을 사용하여 계란을 닦아주십시오.
  2. 계란의 긴 축을 따라 테이프의 스트립을 삽입합니다.
  3. 하나, 메스를 사용하여 달걀 껍질에 두 개의 작은 구멍을 확인창 할 영역의 모서리에있는 계란과 다른의 무딘 끝.
  4. 주사기를 사용하여 약을 제거합니다. 계란의 무딘 끝의 구멍에 45 °의 각도로 바늘을 삽입하여 각 계란의 난백 3 ML. 조심스럽게 노른자를 손상하지 마십시오.
  5. 배아 손상을 방지하기 위해 수평으로 개최 작은 가위를 사용하여 달걀 껍질에 창을 자른다. 필요한 경우, 태아의 위치는 계란의 무딘 끝에 대한 강한 빛을 잡고 확인하고 연필로 표시 할 수 있습니다. 1.5-2 cm 광장의 창은 대부분의 응용 프로그램에 유용합니다.
  6. 브러시로 적용 계란의 무딘 끝 부분에있는 구멍을 녹인 파라핀 왁스와 달걀 껍질에 균열을 밀봉합니다.
  7. 투명 테이프를 (예 : 스카치 매직)를 사용하여 창을 봉쇄 해.
  8. 보육에 계란을 반환합니다.

2.4 Electroporation

  1. 살균 도구를 준비하고 70 % 에탄올로 작업 공간을 닦으십시오.
  2. 내가 준비njection 솔루션입니다. 적절한 DNA 농도는 사용자에 의해 결정되어야하며 표현을 운전하는 데 사용되는 증강 / 발기인에 따라 달라집니다. 가이드로, 우리는 일반적으로 0.2-2.0 μg / μl를 (토론 참조) 사용합니다. 20 μl의 총에서 분사 혼합물이 포함되어야합니다 :
RNAi 플라스미드 DNA (2 0 H에서) X μl
20x PBS 1 μl
0.4 % trypan 블루 2 μl
의 최종 볼륨에 무균 ddH 2 0, 20 μl

microcapillary는 튜브에 부착 된 유리에 DNA 혼합물을로드하는 부드러운 흡입을 사용합니다.

  1. 윈도우 난자에서 테이프를 제거하고 햄버거와 해밀턴 8에 따라 배아를 개최.
  2. 주의 깊게 extrae을 제거 포셉, 봄 가위를 사용하여배의 꼬리 이분의 일에서 mbryonic 멤브레인. 주요 오른쪽과 왼쪽 vitelline의 혈관이 트렁크을 입력 멤브레인은 쉽게 지역에서 배아에서 떨어져 해제 할 수 있습니다. 부드럽게 찢어하거나 잘라서 세포막을하고 꼬리 기수를 당긴다. 필요한 경우, 배아는 Boulland 및 동료 9 시까 지 비디오와 같이 배아 디스크와 달걀 노른자 사이에 인도 잉크 나 빠른 그린의 솔루션을 주입하여 더 나은 시각화 할 수 있습니다.
  3. 그냥 hindlimbs 위, 신경 튜브의 중앙 운하에 DNA 솔루션을 주사. 입으로 주입 볼륨을 제어합니다. 파란색 염료가 개발 뇌의 뇌실에 꼬리의 끝에서 전파해야합니다.
  4. 배의 상단에 멸균 PBS의 몇 방울을 추가합니다.
  5. 배의 앞 - 뒤 축에 평행 전극을 배치합니다. 배아 또는 혈관을 만지지 마십시오.
  6. 전극 사수하라, 그리고 electroporate.
  7. 조심스럽게 전극을 제거하고과 함께 씻어멸균 물은 흰자위의 변성 단백질을 제거합니다.
    1. 양국 electroporation를 들어, 전극의 극성을 전환 배아에 평행 전극의 위치를​​ 조정하고 electroporation를 반복합니다. 멸균 물에 전극을 씻어.
  8. 배에 좀 더 멸균 PBS를 버려라. 테이프로 계란을 봉인하고 원하는 발달 단계에 도달 할 때까지 인큐베이터에 반환합니다. 적절한 밀봉이 배의 탈수를 방지하는 데있어 매우 중요합니다.

3. 척추의 준비

배아 3.1 해부

  1. HH25-26 (부화의 날 5)에서 포셉 또는 작은 스푼을 사용하여 난자에서 배아를 제거합니다. 실리콘 (Sylgard 엘라스토머)와 코팅 배양 접시에있는 PBS에 배치합니다.
  2. extraembryonic 멤브레인을 제거하고 뒷면의 배아를 놓여 있었다. 부드러운 s와 (과), 목 꼬리 (0.20 mm의 곤충 핀을 사용)를 통해 달아하여 접시에 안정tretching.
    1. 전체 배아는 (나중에 sectioning 용) 4 % paraformaldehyde (PFA)와 PBS를 대체​​하고 실온에서 1 시간에 잠복기가 여기 해결할 수 있습니다. 오픈 도서 준비하려면 아래에 설명 된대로 떼어 낸 조직과 프로토콜을 계속합니다.

태아의 척추 코드 3.2 절연

  1. 그들은 해부에 방해가되지 않도록 핀이 떨어져 배아에서 각도로 삽입되도록 사지를 핀. 배아는 조직 밀도는 다음 단계에 인식 될 수 있도록 아래에서 조명되어야한다.
  2. 마음과 봄 가위를 사용하여 내장을 제거하고 부드럽게 집게로 스크랩. 모든 기관이 완전히 제거 된 경우 분할 척추와 척수가 표시됩니다.
  3. 봄 가위 사용하여 목에 척수를 놓인 척추를 통해 얕은 상처를합니다. 배아 180 ° 회전 두 짧은하기꼬리를 향해 목에서 척추의 양쪽에있는 척추를 통해 세로 컷. 떨어져 척추에서와 꼬리에 대한 하나의 스트립에있는 조직 (모든 척추를 포함)의 껍질을 뼈대 플랩을 올려 집게를 사용하십시오.
  4. 부드럽게 꼬리와 팔다리를 통해 배아를 스트레칭하고 다시 핀.
  5. 척수를 놓인 meninges을 떼어 고급 microsurgical 메스 (예 : Grieshaber 68101) 또는 텅스텐 바늘을 사용합니다. 신경 튜브와 등쪽의 루트 신경절 사이에 조직의 어두운, 고밀도 줄을 찾습니다. 필요한 경우, 조명 각도를 조정합니다. 부드럽게 목에서 꼬리까지 척추의 각면에이 라인을 따라 길이 방향으로 잘라. meninges는 고정 된 배의 스트레칭 완만 한으로 인해 척추에서 분리해야합니다.
  6. 날개 꽃 봉오리와 사지 꽃 봉오리에 꼬리 수준에서 척수를 통해 잘라 내고 꼬리 한 부드럽게 뱃 부리 장식이있는에서 배아의 전체 척수를 꺼냅니다 모션, 포셉을 사용합니다. 절연 척추이 단계에서 PBS에 몰두 보관해야합니다. 요리의 한번 들지 마십시오.

오픈 책의 3.3 고정

  1. 주걱에 고립 된 척수를 확산하고 PBS에 4 % paraformaldehyde가 포함 된 새 실리콘 늘어선 페트리 접시에 전송할 수 있습니다.
  2. 주의 (rostrally, medially 및 caudally 각면에, 0.10 mm의 곤충 핀을 사용) 육 위치에서 척수를 달아하여 평면 마운트 준비를 생산하고 있습니다. 우리는 배아를 식별뿐만 아니라 약간의 '플래그'로 각각 준비에 레이블을뿐만 아니라 오픈 도서 준비 앞쪽 끝 나타냅니다.
  3. 30 분에 1 시간 동안 실온에서 알을 품다. 이 DiI 확산 10 효율성을 감소와 배경을 증가와 같은 오픈 책은 오버 해결 될 수 없습니다.
  4. 조심스럽게 4 % PFA를 부어하고 PBS로 교체하십시오. ° C DiI 나 탑재로 삽입 할 준비가 될 때까지 4에 요리를하세요.
commissural 뉴런에 e_step "> 3.4 DiI 주입

  1. 형광 miscroscopy에서 오픈 책을 관찰하고 DiI를 삽입 할 수있는 오픈 책의 적절한 측면을 선택합니다.
  2. 빠른 DiI을 (5 MG / 에탄올에 ML) 준비 및 플라스틱 튜브에 부착 된 유리 micropipette으로 솔루션을 그린다. 매우 작은 직경 팁을 얻기 위해 같은 정교 가능한 micropipette의 끝을 중지. PBS의 그릇에 바늘을 삽입하고 DiI가 바늘에서 누출되지 않습니다 있는지 확인하십시오. DiI 누출되면 바늘 직경이 너무 큽니다. 이 경우, 새로운 바늘을 준비합니다.
  3. 아래에서 오픈 책 준비를 조명. 준비의 측면 가장자리에서 hemibook의 폭의 약 5분의 1에 위치한 조직의 밀도가 세로 스트라이프, 찾아보십시오. 이 지붕 판에 불과 복부 발견 commissural 뉴런의 세포 기관에 해당합니다. 오픈 책의 한쪽 끝에서 시작하여, 그 바늘로 조직에 유리 바늘을 삽입하고s이 (가) 철회, 입 피펫을 사용하여 DiI의 작은 금액을 불다.
  4. 약 0.5 mm의 정기적 인 간격으로 오픈 책의 길이를 따라 몇 가지 주사을 신속하게 작업 할 수 있습니다. 바늘이 막힌되는 경우, 집게로 조심스럽게 선택을 취소합니다. 끝이 너무 큰 (그리고 DiI 누수)되는 경우 바늘을 교체하십시오.
  5. 당신이 각 오픈 책을 완성했을 때, 초과 멀리 최악 삭제 전송 피펫을 사용 DiI가 유출 되었는데요. 이 작업을 수행하지 않으면 높은 배경에서 발생합니다.
  6. 4에 약 3 일간 준비를 남겨 ° C DiI가 axons을 따라 확산 할 수 있도록 할 수 있습니다.

이미징 3.5 장착

  1. X 24mm 유리 coverslip 24 mm의 가장자리 주위에 진공 그리스의 얇은 중단 테두리 (예 : 다우 코닝 # 976V)를 확산하기 위해 18 G 바늘과 주사기를 사용하십시오. 잘에 멸균 PBS의 여러 방울을 추가합니다. N - 프로필 gallate와 글리세롤을 포함하는 설치 매체가 공동으로되지 않을 수 있습니다DiI 11 mpatible. 마찬가지로, 낮은 점도의 진공 기름은 PBS 높은 배경의 결과와 혼합 수 있습니다.
  2. 오픈 책에서 핀을 제거하고 PBS 비말로 전송. 오픈 책을 젖어과 잘의 중간에 위치.
  3. 부드럽게 오픈 책이 열려 있는지 확인하고, 상단에 또 다른 24mm에게 X 24mm의 coverslip를 놓습니다. 필요한 경우, coverslip이 제거하고 오픈이 책은 재배치 할 수 있습니다. 그리스의 전체 도장을 만들 수있는 준비의 가장자리에 부드럽게 누르십시오. 초과 PBS이 단계에서 끊으 려합니다. 공기 거품을 피하십시오.
  4. ° C 형광 현미경에 의한 검사 및 설명서에 대한 준비가 될 때까지 4에 어둠 속에서 준비를하세요. 이것은 준비 아웃 건조하지 않도록 (일주일 이내에) 신속하게 수행해야합니다.

4. 대표 결과

plasmids의 Electroporation와 표현

아래위에서 설명한 조건은 형광 단백질은 항체 라벨에 의한 신호의 추가 증폭 필요없이 해당 셀 유형에 명확하게 감지해야합니다. 형광 단백질은 원하는 세포 유형 / s에 감지해야합니다. 오픈 도서 준비와 다른 plasmids과 electroporated 배아의 크로스 섹션의 대표 예는 그림 2에 표시됩니다.

인공 miRNAs의 효율성

관심 소설 유전자에 대한 인공 miRNAs 먼저 자신의 최저 효과의 효율성과 특이성에 대한 심사해야합니다. 우리는 0.25 μg / μl에 electroporated β-고를업자 중심의 구조는이 3에 적합한 것을 찾을 수 있습니다. 생체 내 분해가 immunohistochemistry 또는 현장 하이브리드 화에서 테스트 할 수 있습니다.

DiI 라벨

적절하게 wildtype 배아에 DiI 주사를 타겟팅그림 3과 같이, 이상적인, archetypal 궤도 3 사출 사이트의 80 % 이상을 얻을해야합니다. 동물의 다양성에 동물이 낮해야합니다.

그림 1
그림 1. miRNA - 표현 플라스미드 벡터의 일반화 된 도식. 다른 RNA 중합 효소 II에의 추구 / 강화의 사용은 세포 유형의 특정 표현을 할 수 있습니다. transfected 세포에 직접 유전자 발현을 치워 하나 또는 두 개의 인공 miRNAs에 (한 성적 증명서 이내) 연결되어 형광 기자의 표현으로도 확인할 수있다. 텍스트에 설명 된대로 굵은 글씨는 LacZ에 대한 인공 miRNA의 의미 스트랜드를 나타냅니다.

그림 2
그림 2. 대표 사례 OF 형광 단백질 표현 패턴은 지정된 플라스미드 벡터의 electroporation에 따라 획득하였습니다. 크로스 섹션 및 열린 책 HH18에 electroporated 된 HH25-26 닭 배아에서입니다. β-고를업자는 유비쿼터스 표현을 유도, Math1 증강은 dI1 뉴런에 표현을 몰고 Hoxa1 증강는 바닥 판에 구체적으로 표현을 유도합니다. CN, commissural 신경, FP, 바닥 판.

그림 3
그림 3. 열린 책 준비에 DiI 주입 사이트의 응용과 분석. DiI는 electroporated 쪽 (형광 단백질의 발현에 의해 식별)에 가까이 열린 책의 옆 여백에, 작은 반점이있는 패턴으로 주입해야합니다. 확산 3 일 후, commissural 축삭의 탄도는 형광 현미경에서 보여 질 수 있습니다. 일반 축삭의 탄도는 층 P으로 성장늦은 바닥 판을 통과 한 후 rostrally를 돌려 성장. 아래 유전자 노크에서 발생하는 이상 phenotypes이 archetypal 궤도에 비교할 수 있습니다. 의 예에서, 일부 axons의 바닥 판에 실 또는 contralateral 측면에 잘못된 켜기 결정을 내릴 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 간단한, 벡터 기반의 인공 miRNA 표현 전략은 닭 신경 튜브에 최저 내생 유전자 발현에 사용할 수 있습니다. 이 기능 도구는 복잡한 발달 경로의 해설을 촉진하기 위해 여러 유전자 입을, 시간적 제어 및 세포 유형 특이성을 제공합니다. plasmids은 commissural 뉴런에 또는 중간 타겟, floorplate 3 최저 별개의 유전자하는 데 사용할 수 있기 때문에 특히, 우리는 commissural 축삭지도에서 이러한 plasmids의 유틸리티를 증명하고있다.

miRNA - 표현의 plasmids (및 따라서, 침묵 세포)에서 생성 된 형광 단백질 표현의 강도와 위치는 다음 매개 변수에 따라 달라집니다 :

  1. 증폭기는 사용 :
    1. β-고를업자는 ubiquitously 활성화
    2. Math1 증강은 dI1 뉴런 12 활성
    3. 13 활성
  2. 플라스미드의 농도.
    플라스미드 농도가 너무 높은 경우 너무 작은 플라스미드는 형광 단백질의 표현을 줄이고 추적되는 것을 electroporated 세포를 방지 할 수 있지만, 증강 활동 및 원치 않는 세포의 후속 표현의 'leakiness'을 일으킬 수 있습니다. RNAi의 plasmids의 높은 농도는 오프 대상 효과를 줄이고 내생 miRNA의 biogenesis 경로의 포화로 인해 발생하는 비 특정 독성의 위험을 최소화하기 위해 피해야한다. 우리는 사용
    1. β-고를업자 : 0.25 μg / μl
    2. Math1 증강 : 0.7 μg / μl
    3. Hoxa1 증강 III : 0.5-1.0 μg / μl
  3. electroporation의 정확성.
    비켜에서 닭 배아를 취급하는 것은 교육을 통해 취득해야 매뉴얼 기술이 필요합니다. 우리와 다른이전에이 절차 14,15의 문제 해결 팁을 발표했다.

적절한 후보가 발견되기 전에 몇 가지 miRNAs는 검사 할 필요가 있습니다. 이 과정은 관찰 된 표현형, 음성 컨트롤 (스크램블 및 / 또는 관련이없는 miRNAs)과 구조 16을 구성을 확인하기 위해 여러 독립 miRNAs의 식별을 포함해야합니다.

오픈 도서 준비가 commissural 뉴런의 axonal 예측의 구조 정보를 시각화하기 위해 적절한 위치로 최적 고정 DiI으로 주입해야합니다. 높은 배경은 오픈 책이나 DiI의 spillage의 오랜 고정로 인해 발생할 수 있습니다. 너무 dorsally에 위치한 셀에 DiI의 주입은 일반적으로 바닥 판에 대한 분류 axonal 계획의 부족을 야기 할 것이다. 너무 ventrally에 위치한 세포는 중간 선에서 많은 ipsilateral와 contralateral 계획을 가지게 될 것이며, 따라서 피해야한다. beginne에 대한RS, 우리는 DiI의 정확한 재현 순위를 보장하기 위해 wildtype 배아에서 촬영 오픈 도서에 연습하는 것이 좋습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

관심 없음 충돌이 선언 없습니다.

Acknowledgements

ES의 연구실에서 작업은 스위스 국립 과학 재단 (National Science Foundation)에서 지원됩니다. 우리는 촬영과 도움 박사 비트 Kunz 감사드립니다.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics