I ovo Electroporation av miRNA-baserte Plasmids i Utvikling Neural Tube og vurdering av fenotyper av Dii Injeksjon i åpen bok Forberedelser

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En metode som genekspresjon i nevralrøret kan være downregulated i en celletype-spesifikk, sporbar måte er beskrevet. Vi viser hvordan

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fugedannende DI1 nevroner har blitt grundig studert for å belyse mekanismene bak axon veiledning under utvikling 1,2. Disse nevronene ligger i dorsal ryggmargen og sender sine axoner langs stereotype baner. Fugedannende axons utgangspunktet projisere ventrally mot og deretter over gulvplaten. Etter å ha krysset midtlinjen, disse axons gjøre en skarp rostral sving og prosjekt lengderetningen mot hjernen. Hvert av disse trinnene er regulert av koordinerte aktiviteter attraktive og frastøtende veiledning signaler. Den riktige tolkningen av disse stikkordene er avgjørende for veiledning av axoner langs deres avgrensede veien. Således er den fysiologiske bidraget av en bestemt molekyl å fugedannende axon veiledning ideell undersøkt i sammenheng med den levende embryo. Følgelig må genet knockdown in vivo kontrolleres nøyaktig for å nøye skille axon veiledning aktiviteter av gener som kan spille flereroller under utvikling.

Her beskriver vi en metode for å knockdown genuttrykk i kylling nevralrøret i en celle type-spesifikke, sporbar måte. Vi bruker romanen plasmidvektorer 3 harboring celletype-spesifikke promotorer / Forsterker som driver ekspresjon av en fluorescerende protein markør, fulgt direkte av en miR30-RNAi transkript 4 (som befinner seg innenfor 3'-UTR av cDNA som koder for den fluorescerende protein) ( Figur 1). Når electroporated i utvikling nevralrøret, disse vektorer lokke fram effektiv nedregulering av genekspresjon og uttrykke lyse fluorescerende markørproteiner å muliggjøre direkte sporing av cellene opplever knockdown 3. Blande ulike RNAi vektorer før electroporation gjør samtidig knockdown av to eller flere gener i selvstendige regioner i ryggmargen. Dette tillater komplekse cellulære og molekylære interaksjoner som skal undersøkes i løpet av utviklingen, på en måte som er rask, sgjennomført, presis og billig. I kombinasjon med Dii tracing av fugedannende axon baner i åpen bok forberedelser 5, er denne metoden et nyttig verktøy for in vivo studier av cellulære og molekylære mekanismer for fugedannende axon vekst og veiledning. I prinsippet kan hvilken som helst promotor / enhancer brukes, potensielt gjør teknikken mer allment anvendelig for in vivo studier av gen-funksjon under utvikling 6.

Denne videoen viser først hvordan å håndtere og vindu egg, kan bruk av DNA plasmider inn nevralrøret og electroporation prosedyren. For å undersøke fugedannende axon veiledning, er ryggmargen fjernes fra embryoet som en åpen bok forberedelse, fast, og injisert med Dii å aktivere axon veier som skal spores. Ryggmargen er montert mellom dekkglass og visualisert ved hjelp konfokalmikroskopi.

Protocol

1. Utarbeidelse av RNAi Plasmid DNA for Cell typespesifikke Gene Slå av lyd

Plasmider (Figur 1) er syntetisert ved hjelp av standard molekylære kloning teknikker, som tidligere beskrevet i detalj 3,4.

1.1 Kloning inn i vektorer: oligonucelotide utforming

  1. Vi bruker de samme universelle oligonukleotider og kloning protokoller som er beskrevet i produktinformasjonen som følger med pRFPRNAiC vektor 4 (ARK-Genomics).
    1. For kloning inn i den første hårnål nettsted:
      5 'primer HP1:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 'primer HP1:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. For kloning inn i andre hårnål nettsted:
      5 'primer HP2:
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 'primer HP2:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. Vi bruker Genscript er siRNA Target Finder til å velge gen-spesifikke mål sekvenser: https://www.genscript.com/ssl-bin/app/rnai .
  3. Primere for å klone et gen-spesifikk miRNA inn i den første hårnål nettstedet:

Et eksempel for Silencing GFP er vist nedenfor.
Targetsekvens (22nt): 5'-GGCACAAGCTGGAGTACAACTA
GFP Forward HP1 = 59mer
Sekvens 1
GFP Reverse HP1 = 58mer
Sekvens 2
Det er vanlige sekvenser i disse oligos som danner en del av miRNA flankerende sekvenser (kylling-spesifikke), og vanlige sløyfe / stem sekvenser (fra menneske miRNA30). De gen-spesifikke målsekvenser er understreket. Merk at det er amismatch på 5 'bunnen av den fremre tråd (vist i fet, G → A i dette eksempel) for å etterligne den naturlige mismatch i miRNA30 i denne posisjonen.

  1. Primere for å klone et gen-spesifikk miRNA i andre hårnål nettstedet:

Et eksempel for Silencing LacZ er vist nedenfor.
Targetsekvens (22nt): 5'-CGCGCTGTATCGCTGGATCAAA
LacZ Forward HP2:
Sekvens 3
LacZ Reverse HP2:
Sekvens 4
Merk at igjen, har den 5 'base av targetsekvensen i forward tråd blitt endret (vist i fet, C → A i dette eksemplet), slik at den mismatches antisens sekvens, mimicking miRNA30.

1,2 PCR Reaction og subkloning

  1. De gen-spesifikke oligos er ossed sammen med de universelle oligos i en PCR reaksjon for å generere miRNA30-lignende hårnål med kylling miRNA flankerende sekvenser.
Kloning i første hårnål nettsted:
1 pl - 10 ng GFP Forward primer HP1
1 pl - 100 ng 5 'primer HP1
1 pl - 100 ng 3 'primer HP1
1 pl dNTPs (10 mM)
5 pl 10x PFU reaksjonsbuffer
1 ul PFU DNA Polymerase (Promega)
39 ul PCR-Grade vann
ELLER Kloning i andre hårnål nettsted:
1 ul - 10 ng LacZ forward primer HP2
1 pl - 100 ng 5 'primer HP2
1 pl - 100 ng 3 'primer HP2
1 pl dNTPs (10 mM)
5 pl 10x PFU reaksjonsbuffer
1 ul PFU DNA Polymerase (Promega)
39 ul PCR-Grade vann

Sykluser:

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 min 30 sek 30 sek 1 min 9 min hold
30 sykluser
  1. Rense PCR produktet, fordøye med restriksjonsenzymer og subklon i vektoren:
    1. Første hårnål nettsted: bruk NheI og MluI
    2. Second hårnål nettsted: bruk MluI og SphI
  2. Følge standard teknikker for transformasjon av kompetente bakterieceller. Plate celler på LB agar (som inneholder ampicillin) og høste DNA ved plasmid midipreparation (f.eks Nucleobond Xtra Midi kit, Machery-Nagel).
  3. Suspendere konsentrert plasmid DNAi sterile DDH 2 0, måle konsentrasjonen av spektrofotometri og oppbevar ved -20 ° C.

1.3 Sekvensering miRNA plasmider

Under standardbetingelser sekvensering reaksjonen svikter ofte på grunn av sterk sekundærstrukturen av hårnåler. Å forbedre dette 7:

  1. Utfør sekvensering reaksjon i 10 mM Tris-Cl med 0,01 mM EDTA (pH 8,0) i stedet for vann. Dette øker konvertering av supercoil DNA til ssDNA, som er mer mottagelig for sekvensering.
  2. Legg til en varme denaturering trinn (98 ° C, 5 min) før sekvensering. Dette konverterer supercoil plasmid DNA til ssDNA.

2. Electroporation

2.1 Egg håndtering

  1. Ha eggene i en inkubator satt til 38,5 ° C og ~ 45% luftfuktighet.
  2. Inkuber egg før embryoene har nådd ønsket stadium av utviklingen. Å studere axon veiledning av fugedannende nevroner, typicall viy electroporate embryo når de har nådd Hamburger & Hamilton (HH) stadium 17-18 (etter ca 3 dagers inkubasjon) 8. Men, injeksjon og electroporation må gjøres før protein av interesse har samlet, for å gjøre knockdown effektiv.
  3. Fjern eggene fra inkubatoren og sette dem i en stabil horisontal stilling i 20 min, for å reposisjonere embryoet oppå eggeplomme på oversiden av egget. Returner eggene i inkubatoren i denne perioden.

2.2 Forberedelse av reagenser og utstyr

  1. Forbered fosfatbuffret saltløsning (PBS) og sterilisere ved autoklavering eller passerer oppløsningen gjennom et 0,2 mikrometer filter.
  2. Gjøre glass mikropipetter ved å trekke kapillærer (World Precision Instruments 1B120F-4, 1.2 / 0,68 OD / ID (mm)) i et egnet trekke enheten (f.eks Narishige PC-10). Bryt av spissen av en mikropipette for å oppnå en spiss diameter på ~ 5 mikrometer og koble den til et stykke slange medriktig diameter.
  3. Monter platina elektroder (0,5 cm lang) fast i en håndholdt ramme, med en inter-elektrode avstand på 0,5 cm. Kobler elektrodene til en firkantet bølge puls generator (BTX ECM 830).
  4. Still pulsgeneratoren med følgende parametere:
    1. For ensidig electroporation: spenning: 25 V, antall pulser: 5, lengde puls: 50 msek, interpulse intervall: 1 sek
    2. For bilateral electroporation: spenning: 18 V, antall pulser: 5, lengde puls: 50 msek, interpulse intervall: 1 sek
  5. Forbered en sprøyte med 18 G nål, en skalpell, en Spritz flaske 70% etanol og tape.
  6. Smelt paraffinvoks i et begerglass på en varmeplate ved 80 ° C.

2,3 mediefasering

  1. Tørk eggene ved hjelp av en vev fuktet i 70% etanol.
  2. Plasser en stripe av tape langs den lange aksen av egget.
  3. Lag to små hull i eggeskallet ved hjelp av en skalpell, en påden butte enden av egget og den andre på hjørnet av området som skal windowed.
  4. Ved hjelp av en sprøyte, fjerne ca. 3 ml albumen fra hvert egg ved å sette nålen med en vinkel på 45 ° inn i hullet i den butte enden av egget. Nøye unngå å skade eggeplomme.
  5. Skjær et vindu inn i eggeskallet med liten saks, holdt horisontalt for å unngå å skade fosteret. Hvis nødvendig, kan posisjonen av embryoet verifiseres og merket med en blyant ved å holde et sterkt lys mot den butte ende av egget. Et vindu på 1,5 til 2 cm kvadrat er nyttig for de fleste bruksområder.
  6. Forsegle hullet den butte enden av egget og eventuelle sprekker i eggeskallet med smeltet parafinvoks, påføres med pensel.
  7. Forsegle vinduet med gjennomsiktig tape (f.eks Scotch Magic).
  8. Returner egg i inkubatoren.

2,4 Electroporation

  1. Forbered sterile verktøy og tørk arbeidsområdet med 70% etanol.
  2. Klargjør jegnjection løsning. Den passende DNA-konsentrasjon må bestemmes av brukeren, og vil variere i henhold til enhancer / promoter som brukes til å drive ekspresjon. Som en guide, vi vanligvis bruker 0,2 til 2,0 mikrogram / ul (se diskusjon). I totalt 20 pl, skal injeksjonen blandingen inneholde:
RNAi plasmid DNA (i H 2 0) X ul
20x PBS 1 ul
0,4% trypan blå 2 ul
steril DDH 0 2, til et endelig volum på 20 pl

Bruk lett sug å laste DNA blandingen i glasset microcapillary festet til slangen.

  1. Fjern tapen fra windowed egg og iscenesette fosteret ifølge Hamburger og Hamilton 8.
  2. Bruk pinsett og våren saks til å nøye fjerne extraembryonic membraner fra caudal halvparten av embryo. Membraner kan enkelt løftes vekk fra fosteret i regionen der de store høyre og venstre vitelline årer inn i bagasjerommet. Forsiktig rive eller klippe membraner og trekk dem mot halen. Ved behov kan embryoet bli visualisert bedre ved å injisere en løsning av India blekk eller Fast grønt mellom embryonale plate og eggeplomme som vist i en video av Boulland og kolleger 9.
  3. Injiser DNA-løsningen inn i den sentrale kanalen av nevralrøret, like over bakbena. Styr injeksjonsvolum gjennom munnen. Den blå fargestoff bør spre fra spissen av halen inntil ventrikkelen av utviklingen av hjernen.
  4. Tilsett noen dråper steril PBS på toppen av embryo.
  5. Plasser elektrodene parallelt med anterior-posterior aksen av embryo. Unngå å berøre embryo eller blodkar.
  6. Hold elektrodene stødig, og electroporate.
  7. Fjern forsiktig elektroder og skyll dem medsterilt vann for å fjerne denaturert protein fra eggehvite.
    1. For bilateral electroporation, bytte polariteten på elektrodene, reposisjonere elektrodene skal plasseres parallelt embryoet og gjenta electroporation. Skyll elektrodene i sterilt vann.
  8. Slippe litt mer sterilt PBS på embryo. Tett egg med tape og returnere det til inkubatoren til ønsket utviklingsstadiet er nådd. Riktig selfangst er avgjørende for å unngå dehydrering av embryo.

3. Ryggmargen Forberedelser

3.1 Disseksjon av embryoer

  1. På HH25-26 (dag 5 av inkubasjon), fjerne fosteret fra egg ved hjelp av tang eller en liten skje. Plasser den i PBS i en petriskål belagt med silikon (Sylgard elastomer).
  2. Fjern de extraembryonic membraner og legge embryo på ryggen. Stabilisere den på plate ved å feste det gjennom halsen og halen (med 0,20 mm insekt pins), med milde stretching.
    1. Hele embryoer (for snitting senere) kan festes her, ved å erstatte de PBS med 4% paraformaldehyd (PFA) og inkubering i 1 time ved romtemperatur. For å gjøre åpen bok forberedelser, fortsetter protokollen med unfixed vev som beskrevet nedenfor.

3.2 Isolasjon av ryggmargen fra embryo

  1. Pin beina, at pinnene er satt inn ved en vinkel bort fra embryoet slik at de ikke kommer i konflikt med disseksjon. Embryoet bør belyses nedenfra slik at vevstetthet å bli oppfattet i de neste trinnene.
  2. Fjern hjertet og indre organer ved hjelp av Spring saks og forsiktig skraping med tang. Det segmenterte ryggvirvler og ryggmargen skal være synlig hvis alle organene er fjernet helt.
  3. Bruke våren saks, gjør et grunt kutt gjennom ryggvirvlene overliggende ryggmargen i nakken. Roter embryo 180 ° og lage to kortlangsgående kutt gjennom ryggvirvlene på hver side av ryggmargen, fra halsen mot halen. Bruk pinsett å løfte klaffen av vertebrae unna fra ryggmargen og skrelle vevet (inneholdende alle ryggvirvlene) i en enkelt stripe mot halen.
  4. Forsiktig strekke og re-pin embryoet gjennom halen og lemmene.
  5. Bruk en fin mikrokirurgisk skalpell (f.eks Grieshaber 68101) eller en tungsten nål for å skjære bort hjernehinnene overliggende ryggmargen. Se etter en mørk, tett linje av vev mellom nevralrøret og røttene i ryggmargen. Juster belysning vinkel, om nødvendig. Forsiktig kuttet lengderetningen langs denne linje på hver side av ryggmargen, fra nakken til halen. Hjernehinnene bør skille fra ryggmargen grunnet mild strekking av den låste embryo.
  6. Skjærer gjennom ryggmargen på nivået av vingen knoppen og kaudale til legemsdelen knopp, og løfte hele ryggmargen ut av embryoet i en jevn rostral til caudal bevegelse, ved hjelp av pinsett. Den isolerte ryggmarg bør holdes nedsenket i PBS i dette trinnet. Ikke løft den ut av parabolen.

3.3 Festing av åpne-bøker

  1. Spre den isolerte ryggmargen på en slikkepott og overføre den til en ny silikon-lined petriskål inneholder 4% paraformaldehyd i PBS.
  2. Produsere en flat-mount forberedelse ved forsiktig feste ryggmargen i seks stillinger (rostrally, medialt og caudally på hver side, med 0,10 mm insekt pins). Vi merke hver forberedelse av en liten "flagg" som ikke bare identifiserer embryo, men også indikerer fremre enden av åpen bok forberedelse.
  3. Inkuber ved romtemperatur i 30 min til 1 time. Åpne-bøker bør ikke over-fast som dette reduserer effektiviteten av Dii diffusjon 10 og øker bakgrunn.
  4. Hell forsiktig av 4% PFA og erstatte den med PBS. Hold rettene ved 4 ° C til den er klar til å injisere med Dii eller mount.
e_step "> 3,4 Dii injeksjon i fugedannende nevroner

  1. Observere åpen-bøker under fluorescens miscroscopy og velg riktig side av åpen bok å injisere med Dii.
  2. Forbered Rask Dii (5 mg / ml i etanol) og trekker oppløsningen i et glass mikropipette tilknyttet plastslanger. Bryt av slutten av mikropipette så fint som mulig å oppnå en meget liten diameter spiss. Stikk nålen inn et fat med PBS og sjekk at DII ikke lekke fra nålen. Hvis Dii lekkasjer, er nålen diameteren er for stor. I så fall forberede en ny nål.
  3. Belyse åpen bok preparater nedenfra. Se etter en tettere langsgående stripe av vev, ligger omtrent 1/5 av bredden av et hemibook fra den laterale kanten av blandingen. Dette tilsvarer cellen organer av fugedannende nevroner, som er funnet bare ventral til taket plate. Fra den ene enden av den åpne-bok, setter glasset nålen i vevet og som nålen is trukket, puff i en liten mengde av Dii hjelp en munn pipette.
  4. Arbeide raskt, noe som gjør flere innsprøytninger langs lengden av den åpne-bok jevne intervaller på omtrent 0,5 mm. Hvis nålen blir tilstoppet, nøye klart det med tang. Hvis tuppen blir for stor (og Dii lekkasjer), bytt nålen.
  5. Når du har fullført hvert åpen bok, bruke en overføringspipetten å suge bort og kast overflødig, lekket Dii. Unnlatelse av å gjøre dette vil resultere i høy bakgrunn.
  6. La forberedelsene til ca tre dager ved 4 ° C for å aktivere DII å spre langs axons.

3.5 Montering for bildebehandling

  1. Bruk en sprøyte med en 18 G kanyle til å spre et tynt, uavbrutt grensen av vakuum fett (f.eks Dow Corning # 976V) rundt kantene på en 24 mm x 24 mm dekkglass. Legg flere dråper sterilt PBS til brønnen. Merk at montering medium inneholdende glyserol med n-propylgallat ikke kan gis samtidigmpatible med Dii 11. Tilsvarende kan vakuum fett av lav viskositet blandes med PBS og resultere i høy bakgrunn.
  2. Fjern pinnene fra den åpne boken og overføre den til PBS dråpe. Dypp åpen bok, og plassere den i midten av brønnen.
  3. Forsiktig plassere en annen 24 mm x 24 mm dekkglass på toppen, noe som gjør at den åpne-bok forblir åpen. Om nødvendig, kan dekkglasset fjernes, og den åpne-bok reposisjonert. Trykke forsiktig rundt kantene av preparatet for å opprette en fullstendig forsegling av fett. Overflødig PBS vil bli presset ut i dette trinnet. Unngå luftbobler.
  4. Hold forberedelsene i mørke ved 4 ° C til alt er klart for inspeksjon og dokumentasjon av fluorescerende mikroskopi. Dette bør gjøres raskt (innen en uke), for å sikre at preparatene ikke tørker ut.

4. Representant Resultater

Electroporation og uttrykk av plasmider

Underbetingelser som er beskrevet ovenfor, bør fluorescerende protein være tydelig synlig i riktig celletype uten behov for ytterligere forsterkning av signalet ved antistoff merking. Den fluorescerende protein bør bare være synlig i ønsket celle type / s. Representative eksempler på åpen bok preparater og tverrsnitt av embryo electroporated med de forskjellige plasmider er vist i figur 2.

Effektivitet av kunstige miRNAs

Kunstige miRNAs mot en roman gen av interesse må først undersøkes for effektivitet og spesifisitet av deres knockdown effekter. Vi finner at β-actin promotor-drevet konstruksjoner, electroporated til 0,25 mikrogram / ​​ul, er passende for denne 3. Knockdown in vivo kan testes ved hjelp av immunhistokjemi eller in situ hybridisering.

Dii merking

Riktig målrettet Dii injeksjoner i wildtype embryoerbør gi mer enn 80% av injeksjonssteder med ideelle, arketypiske baner 3, som vist i figur 3.. Dyr til dyr variasjon bør være lav.

Figur 1
Figur 1. Generalisert skjematisk av miRNA-uttrykker plasmidvektorer. Bruken av forskjellige RNA polymerase II promotorer / Forsterker muliggjør celletype-spesifikk ekspresjon. De transfekterte celler er kjennetegnet ved ekspresjon av en fluorescerende reporter som er direkte koblet (innenfor en enkelt transkript) til en eller to kunstige miRNAs som slå ned genekspresjon. Fet tekst angir den forstand tråden av en kunstig miRNA mot LacZ, som beskrevet i teksten.

Figur 2
Figur 2. Representative eksempler of fluorescerende protein expression mønstre oppnådd etter elektroporering av de indikerte plasmidvektorer. Tverrsnitt og åpne bøker er fra HH25-26 kyllingembryoer som ble electroporated på HH18. β-actin promotor driver allestedsnærværende uttrykk, driver Math1 enhancer uttrykk i DI1 nevroner og Hoxa1 enhancer driver uttrykk spesielt i bunnplaten. CN, fugedannende neuron, FP, gulvplate.

Figur 3
Figur 3. Søknad og analyse av Dii injeksjonssteder i åpen bok forberedelser. Dii skal injiseres i en punctate mønster, i nærheten av den laterale margin av den åpne boken, på electroporated side (identifisert av fluorescerende protein uttrykk). Etter 3 dager med diffusjon, bør fugedannende axon baner kunne bli visualisert under fluorescerende mikroskopi. Normal axon baner vil vokse mot gulvet psent, gå over gulvet plate og deretter snu og vokse rostrally. Unormale fenotyper som følge av genet knock down kan sammenlignes med denne arketypiske bane. I eksemplet, noen axons stall i gulvet plate eller gjøre feilaktige snu beslutninger på motsatt side.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne enkle, vektorbasert kunstig miRNA uttrykk strategien kan brukes til knockdown endogene genekspresjon i kylling nevralrøret. Disse funksjonelle verktøy tilbyr flere genet stanse, temporal kontroll og celle-type spesifisitet, for å lette klarlegging av komplekse utviklingsforstyrrelser veier. Spesielt har vi demonstrert nytten av disse plasmider i fugedannende axon veiledning, siden plasmidene kan brukes til å knockdown distinkte gener i fugedannende neuroner eller i deres mellomliggende mål, gulvplaten 3.

Intensiteten og plassering av fluorescerende protein ekspresjon genereres fra miRNA-uttrykkende plasmider (og dermed de dempede celler) vil avhenge av de følgende parametere:

  1. Enhancer brukt:
    1. β-actin promotor er overalt aktiv
    2. Math1 enhancer er bare aktiv i DI1 nevroner 12
    3. 13
  2. Konsentrasjon av plasmid.
    Hvis plasmid konsentrasjonen er for høy, kan det føre til 'leakiness' av forsterkeren aktivitet og påfølgende ekspresjon i uønskede celler, mens for lite plasmid kan redusere ekspresjonen av fluorescerende protein og hindre electroporated cellene fra å være sporbare. Høye konsentrasjoner av RNAi plasmider bør også unngås for å redusere av-target effekter og redusere risikoen for ikke-spesifikk toksisitet oppstår metning av endogene miRNA biogenese pathway. Vi bruker:
    1. β-actin promotor: 0,25 ug / ul
    2. Math1 enhancer: 0,7 mikrogram / ul
    3. Hoxa1 enhancer III: 0.5 til 1.0 mg / ul
  3. Nøyaktighet av electroporation.
    Håndtering kyllingembryoer i ovo krever manuelle ferdigheter som må tilegnes gjennom trening. Vi og andrehar tidligere utgitt feilsøkingstips for denne prosedyren 14,15.

Flere miRNAs kan trenge å bli testet før en passende kandidat er funnet. Denne prosessen bør innlemme identifisering av flere uavhengige miRNAs å bekrefte en observert fenotype, negative kontroller (kryptert og / eller urelaterte miRNAs) og redning konstruerer 16.

Åpen bok preparater må festes optimalt og injisert med Dii i riktig posisjon for å kunne visualisere strukturelle detaljer om aksonal projeksjoner av fugedannende nerveceller. Høy bakgrunn kan være forårsaket av langvarig fiksering av åpen-bøker eller søl av DII. Injeksjon av Dii inn celler lokalisert for dorsally vil vanligvis resultere i en mangel på merket aksonal anslag mot gulvet plate. Celler lokalisert altfor ventrally vil ha mange ipsilaterale og kontralateral fremspringene til midtlinjen, og bør derfor unngås. For beginners, anbefaler vi å trene på åpen-bøker tatt fra wildtype embryoer for å sikre nøyaktig, reproduserbar posisjonering av DII.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter erklært.

Acknowledgements

Arbeid i laboratoriet av ES er støttet av den sveitsiske National Science Foundation. Vi ønsker å takke dr. Beat Kunz for å få hjelp med filming.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics