I ovo Elektroporation af miRNA-baserede plasmider i udviklingslandene neuralrøret og vurdering af fænotyper ved Dil Injection i Open-bog Forberedelser

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En fremgangsmåde, hvorved genekspression i neuralrøret kan være nedreguleret i en celletype-specifik, sporbar måde beskrives. Vi viser, hvordan

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Kommissurale DI1 neuroner er blevet grundigt undersøgt for at belyse de mekanismer, der ligger til grund Axon vejledning under udvikling 1,2. Disse neuroner er beliggende i den dorsale rygmarv og sende deres axoner langs stereotype baner. Kommissurale axoner i første omgang rage ventralt mod og derefter på tværs af gulvpladen. Efter at have krydset midterlinjen gør disse axoner en skarp rostral sving og projekt på langs mod hjernen. Hvert af disse trin er reguleret af koordinerede aktiviteter tiltrækkende og frastødende vejledning cues. Den korrekte fortolkning af disse signaler er afgørende for vejledning af axoner langs deres afgrænsede bane. Således er den fysiologiske bidrag et givet molekyle til kommissurale axon vejledning ideelt undersøgt i forbindelse med levende embryo. Derfor skal gen knockdown in vivo styres præcist med henblik på at skelne omhyggeligt axon vejledningsaktiviteter af gener, der kan spille flereroller under udvikling.

Her beskriver vi en fremgangsmåde til knockdown genekspression i kyllingen neuralrøret i en celletype-specifik, sporbar måde. Vi anvender hidtil ukendte plasmidvektorer 3 huser celletype-specifikke promotorer / enhancere der driver ekspressionen af en fluorescerende protein-markør, efterfulgt direkte af en miR30-RNAi transcript 4 (placeret i 3'-UTR af det cDNA, der koder for det fluorescerende protein) ( figur 1). Når elektroporeret i det udviklende neuralrør, disse vektorer fremkalde effektive nedregulering af genekspression og udtrykke stærkt fluorescerende markørproteiner at muliggøre direkte sporing af cellerne oplever knockdown 3. Blande forskellige RNAi vektorer før elektroporering tillader samtidig knockdown af to eller flere gener i uafhængige regioner af rygmarven. Dette tillader komplekse cellulære og molekylære vekselvirkninger, der skal undersøges under udviklingen, på en måde, der er hurtig, sgen, præcis og billig. I kombination med Dil opsporing af kommissurale axon baner i open-book præparater 5, er denne metode et nyttigt værktøj for in vivo studier af de cellulære og molekylære mekanismer af kommissurale Axon vækst og vejledning. I princippet kan enhver promotor / enhancer kan anvendes, potentielt gør teknikken mere bredt anvendelig til in vivo-undersøgelser af genfunktion under udvikling 6.

Denne video først viser, hvordan man håndterer og vinduer æg, injektion af DNA plasmider i neuralrøret og elektroporation procedure. At undersøge kommissurale Axon vejledning, er rygmarven fjernet fra embryoet som en åben-book præparat, fikseret, og injiceret med Dil så axon veje kan spores. Rygmarven er monteret mellem dækglas og visualiseret ved hjælp af konfokal mikroskopi.

Protocol

1. Fremstilling af RNAi Plasmid-DNA til Celletype-specifik gene silencing

Plasmider (figur 1) syntetiseres under anvendelse af standard molekylære kloningsteknikker, som tidligere beskrevet i detaljer 3,4.

1,1 kloning i vektorer: oligonucelotide design

  1. Vi bruger de samme universelle oligonukleotider og kloning protokoller, der er beskrevet i produktinformationen, der følger med pRFPRNAiC vektor 4 (ARK-Genomics).
    1. Til kloning ind i den første hårnål site:
      5'-primer HP1:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 'primer HP1:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. Til kloning ind i den anden hårnål site:
      5'-primer HP2:
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 'primer HP2:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. Vi bruger Genscript s siRNA Target Finder til at vælge genspecifikke målsekvenser: https://www.genscript.com/ssl-bin/app/rnai .
  3. Primere til kloning af et gen-specifik miRNA ind i den første hårnål site:

Et eksempel på inaktivering GFP er vist nedenfor.
Målsekvens (22nt): 5'-GGCACAAGCTGGAGTACAACTA
GFP Forward HP1 = 59mer
Sekvens 1
GFP Reverse HP1 = 58mer
Sekvens 2
Der er fælles sekvenser i disse oligoer, som udgør en del af miRNA flankerende sekvenser (kylling-specifik), og fælles loop / stamceller sekvenser (fra humant miRNA30). De genspecifikke målsekvenser er understreget. Bemærk, at der amismatch ved 5'bunden af ​​den forreste del (vist med fed skrift, G → A i dette eksempel) for at efterligne den naturlige mismatch i miRNA30 i denne position.

  1. Primere til kloning af et gen-specifik miRNA ind i den anden hårnål site:

Et eksempel på inaktivering LacZ er vist nedenfor.
Målsekvens (22nt): 5'-CGCGCTGTATCGCTGGATCAAA
LacZ Forward HP2:
Sekvens 3
LacZ Reverse HP2:
Sekvens 4
Bemærk, at en gang har den 5'bunden af ​​målsekvensen i den forreste del er ændret (vist med fed skrift, C → A i dette eksempel), således at den fejlparringer antisense-sekvensen, der efterligner miRNA30.

1,2 PCR-reaktion og Subkloning

  1. De genspecifikke oligoer er osed sammen med de universelle oligoer i en PCR-reaktion til dannelse af miRNA30-lignende hårnål med kylling miRNA flankerende sekvenser.
Kloning i første hårnål site:
1 pi - 10 ng GFP Forward primer HP1
1 pi - 100 ng 5'-primer HP1
1 pi - 100 ng 3 'primer HP1
1 pi dNTPs (10 mM)
5 pi 10 x Pfu reaktionspuffer
1 pi Pfu DNA-polymerase (Promega)
39 ul PCR-Grade vand
OR Kloning i sekunder hårnål site:
1 pi - 10 ng LacZ Forward primer HP2
1 pi - 100 ng 5'-primer HP2
1 pi - 100 ng 3 'primer HP2
1 pi dNTPs (10 mM)
5 pi 10 x Pfu reaktionspuffer
1 pi Pfu DNA-polymerase (Promega)
39 ul PCR-Grade vand

Cykler:

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 min 30 sek 30 sek 1 min 9 min hold
30 cycles
  1. Oprense PCR-produktet, fordøje med restriktionsenzymer og subklone i vektoren:
    1. Første hårnål site: brug NheI og MluI
    2. Anden hårnål site: brug MluI og SphI
  2. Følg standardteknikker for transformation af kompetente bakterieceller. Plade celler på LB-agar (indeholdende ampicillin) og høst DNA med plasmid midipreparation (f.eks Nucleobond Xtra Midi kit, Machery-Nagel).
  3. Suspendere koncentreret plasmid-DNAi sterilt ddH 2 0, foranstaltning koncentration ved spektrofotometri og opbevares ved -20 ° C.

1,3 Sekventering miRNA plasmider

Under standardbetingelser den sekventeringsreaktion ofte ikke på grund af stærk sekundær struktur af hårnåle. For at forbedre dette 7:

  1. Udfør sekventeringsreaktion i 10 mM Tris-CI med 0,01 mM EDTA (pH 8,0) i stedet for vand. Dette øger konvertering af supersnoet DNA til ssDNA, der er mere egnet til sekventering.
  2. Tilføj en varme denatureringstrin (98 ° C, 5 min) før sekventering. Dette omdanner supersnoet plasmid-DNA til ssDNA.

2. Elektroporation

2,1 Egg håndtering

  1. Anbringe æggene i en inkubator indstillet til 38,5 ° C og ~ 45% fugtighed.
  2. Inkuber æggene, indtil embryonerne har nået den ønskede udviklingsstadium. At studere Axon styring af kommissurale neuroner, vi typically elektroporere embryoner når de har nået Hamburger & Hamilton (HH) stadium 17-18 (efter cirka 3 dages inkubation) 8. Imidlertid injektion og elektroporation skal gøres før proteinet af interesse er akkumuleret, at knockdown effektivt.
  3. Fjerne æggene fra inkubatoren og sætte dem i en stabil vandret stilling i 20 minutter, for at flytte embryonet på toppen af ​​blommen ved oversiden af ​​ægget. Retur æggene til inkubatoren i løbet af denne periode.

2,2 Fremstilling af reagenser og udstyr

  1. Forbered phosphatbufret saltvand (PBS) og steriliseres ved autoklavering eller passage af opløsningen gennem et 0,2 um filter.
  2. Gøre glas mikropipetter ved at trække kapillærer (World Precision Instruments 1B120F-4, 1,2 / 0,68 OD / ID (mm)) i et egnet trækindretningen (f.eks Narishige PC-10). Bræk spidsen af ​​en mikropipette for at opnå en spids diameter ~ 5 um og slutte den til et stykke slange medDen passende diameter.
  3. Montere platinelektroder (0,5 cm lang) fast i en håndholdt ramme, med en inter-elektrode afstand på 0,5 cm. Elektroderne tilsluttes en firkantbølge pulsgenerator (BTX ECM 830).
  4. Indstil impulsgeneratoren med følgende egenskaber:
    1. For ensidig elektroporation: spænding: 25 V, antallet af pulser: 5, længde af puls: 50 msek, interpulse interval: 1 sec
    2. For bilateral elektroporation: spænding: 18 V, antallet af pulser: 5, længde af puls: 50 msek, interpulse interval: 1 sec
  5. Der fremstilles en sprøjte med 18 G kanyle, en skalpel, en spritz flaske 70% ethanol og tape.
  6. Smelt paraffin i et bæger på en varmeplade ved 80 ° C.

2,3 Windowing

  1. Tør æggene ved hjælp af et væv, dyppet i 70% ethanol.
  2. Placere en strimmel af tape langs den lange akse af ægget.
  3. Lav to små huller i æggeskallen ved hjælp af en skalpel, en vedden stumpe ende af ægget og den anden på hjørnet af området, som skal windowed.
  4. Anvendelse af en sprøjte, fjernes ca. 3 ml æggehvide fra hvert æg ved at indsætte kanylen i en vinkel på 45 ° ind i hullet i den stumpe ende af ægget. Forsigtigt at beskadige æggeblomme.
  5. Skær et vindue ind i æggeskallen ved hjælp af en lille saks, som blev afholdt vandret for at undgå at beskadige embryoet. Om nødvendigt kan positionen af ​​embryon kontrolleres og markeret med en blyant ved at holde en stærkt lys mod den stumpe ende af ægget. Et vindue fra 1,5 til 2 cm square er nyttigt til de fleste anvendelser.
  6. Tætne hullet ved den stumpe ende af ægget og eventuelle revner i æggeskallen med smeltet paraffin, påføres med en pensel.
  7. Forsegl vinduet med den gennemsigtige tape (f.eks Scotch Magic).
  8. Retur ægget til inkubatoren.

2,4 Elektroporation

  1. Forbered sterile redskaber og tør arbejdsområdet med 70% ethanol.
  2. Forbered injection opløsning. Den passende DNA-koncentration bestemmes af brugeren, og vil variere alt efter enhanceren /-promotoren anvendes til at drive ekspression. Som en guide, typisk bruger vi 0,2-2,0 pg / pl (se Diskussion). I alt 20 ul, bør injektionen blandingen indeholder:
RNAi plasmid DNA (i H 2 0) X pi
20x PBS 1 pi
0,4% trypanblåt 2 ul
sterilt ddH 2 0, til et slutvolumen på 20 pi

Anvende mild sugning at indlæse DNA blandingen i glasset mikrokapillær fastgjort til slangen.

  1. Fjern tapen fra det vinduesbehandlede æg og iscenesætte embryoet ifølge Hamburger og Hamilton 8.
  2. Brug pincet og foråret saks til forsigtigt at fjerne den extraembryonic membraner fra den kaudale halvdel af embryoet. Membranerne kan let løftes væk fra embryonet i regionen, hvor de store højre og venstre vitelline vener ind i stammen. Forsigtigt rive eller skære membranerne og trække dem mod halen. Hvis det er nødvendigt, kan fosteret visualiseres bedre ved at indsprøjte en opløsning af tusch eller Fast Green mellem embryonale skive og æggeblomme, som vist i en video ved Boulland og kolleger 9.
  3. Injicere DNA-opløsningen ind i den centrale kanal af neuralrøret, lige over baglemmer. Styr injektionsvolumen gennem munden. Det blå farvestof skal spredes fra spidsen af ​​halen frem til ventrikel udviklende hjerne.
  4. Der tilsættes nogle få dråber sterilt PBS oven på embryoet.
  5. Anbring elektroderne parallelt med den anteriore-posteriore akse af embryoet. Undgå at røre ved embryo eller blodkar.
  6. Hold elektroderne støt, og elektroporere.
  7. Fjern forsigtigt elektroderne og skyl dem medsterilt vand til fjernelse af denaturerede proteiner fra æggehvide.
    1. For bilateral elektroporering skifte polariteten af ​​elektroderne, flytte elektroderne parallelt med embryo og gentag elektroporation. Skyl elektroderne i sterilt vand.
  8. Drop nogle mere steril PBS på embryoet. Genforsegle ægget med tape og returneres til inkubatoren indtil den ønskede udviklingstrin er nået. Korrekt tætning er afgørende at undgå dehydrering af embryoet.

3. Spinal Cord Forberedelser

3,1 Dissektion af embryoner

  1. Ved HH25-26 (dag 5 af inkubation), fjern embryo fra ægget ved hjælp af pincet eller en lille ske. Det anbringes i PBS i en petriskål coatet med silikone (Sylgard elastomer).
  2. Fjern de extraembryonic membraner og lægge fostret på ryggen. Stabilisere den på pladen ved at fastgøre det gennem halsen og halen (med 0,20 mm insekt pins), med blid stretching.
    1. Hele embryoner (til sektionering senere) kan fastgøres her ved at erstatte PBS med 4% paraformaldehyd (PFA) og inkubering i 1 time ved stuetemperatur. For at gøre open-book forberedelse fortsat protokollen med ufikserede væv som beskrevet nedenfor.

3,2 Isolering af rygmarv fra fostre

  1. Pin lemmerne, sikrer, at benene er indsat i en vinkel væk fra embryonet, så de ikke interfererer med dissektion. Embryonet bør belyses nedefra for at aktivere vævstæthed at blive opfattet i de følgende trin.
  2. Tag hjertet og indre organer ved hjælp af foråret saks og forsigtigt at skrabe med en pincet. Den segmenterede ryghvirvler og rygmarv skal være synlig, hvis alle organer er fjernet fuldstændigt.
  3. Ved hjælp af fjeder saks, en flad udskæring gør gennem ryghvirvler ligger over rygmarven ved halsen. Drej embryo 180 ° og lave to kortelangsgående snit gennem rygsøjlen på begge sider af rygmarven, fra halsen mod halen. Anvende pincet til at løfte flappen af ​​hvirvlerne fra rygmarven og skræl væv (der indeholder alle de ryghvirvler) i en enkelt strimmel mod halen.
  4. Forsigtigt strække og re-pin kimen gennem halen og lemmer.
  5. Brug en fin microsurgical skalpel (f.eks Grieshaber 68.101) eller en wolfram nål til at skrælle meninges overliggende rygmarven. Kigge efter en mørk, tyk linje væv mellem neuralrøret og den dorsale rodganglier. Justere indfaldsvinklen, om nødvendigt. Forsigtigt skåret på langs langs denne linie på hver side af rygmarven, fra halsen til halen. Meninges bør adskille fra rygmarven på grund af den blide strækning af fastgjorte embryo.
  6. Skære gennem rygmarven på niveauet for vingen knop og caudalt til lem-knop, og løfte hele rygmarven ud af embryoet i en enkelt jævn rostral til kaudal bevægelse, ved hjælp af pincet. Det isolerede rygmarv bør holdes nedsænket i PBS i dette trin. Må ikke løfte den ud af skålen.

3,3 Fiksering af åbne-bøger

  1. Spred den isolerede rygmarv på en spatel og overføre det til en ny silicone-foret petriskål indeholdende 4% paraformaldehyd i PBS.
  2. Fremstil en flad-mount forberedelse ved omhyggeligt pinning rygmarven i seks positioner (rostrally, medialt og caudalt på hver side, ved hjælp af 0,10 mm insekt ben). Vi mærke hvert præparat ved en lille 'flag', der ikke kun identificerer embryonet, men angiver også den forreste ende af den åbne bog forberedelse.
  3. Inkuber ved stuetemperatur i 30 minutter til 1 time. Open-bøger bør ikke over-fastsættes som dette reducerer effektiviteten af Dil diffusion 10 og øger baggrund.
  4. Hæld forsigtigt fra 4% PFA og erstatte det med PBS. Hold retter ved 4 ° C, indtil klar til at injicere med Dil eller mount.
e_step "> 3.4 Dil injektion i kommissurale neuroner

  1. Overhold de åbne bøger under fluorescens miscroscopy og vælge den relevante side af den åbne bog at injicere med Dil.
  2. Forbered Fast Dil (5 mg / ml i ethanol) og træk opløsning i et glas mikropipette fastgjort til plastrør. Afbryde udgangen af ​​mikropipetten så fint som muligt for at opnå en meget lille diameter tip. Sæt nålen ind i en skål af PBS og kontroller, at Dil ikke lække fra nålen. Hvis DII lækager, er nålen diameter for stort. I så fald udarbejde en ny nål.
  3. Oplys den åbne bog præparater nedefra. Kigge efter en tættere langsgående stribe af væv, der ligger ca 1/5 af bredden af ​​en hemibook fra den laterale kant af præparatet. Dette svarer til cellelegemer i de kommissurale neuroner, som findes lige ventral til tag pladen. Begyndende ved den ene ende af den åbne bog, glasset nålen indsættes i vævet, og som nålen is trukket tilbage, puff i en lille mængde Dil med en mund pipette.
  4. Arbejd hurtigt, hvilket gør flere indsprøjtninger langs den åbne bog med regelmæssige intervaller på ca 0,5 mm. Hvis nålen bliver tilstoppet, forsigtigt fjerne det med en pincet. Hvis spidsen bliver for stor (og DII lækager), udskift nålen.
  5. Når du er færdig med hver åben-bog, skal du bruge en overførsel pipette til at suge væk og kassér eventuelt overskydende lækket Dil. Hvis dette ikke gøres, vil resultere i høj baggrund.
  6. Efterlad forberedelserne til omkring tre dage ved 4 ° C, for at Dil at spredes langs axonerne.

3,5 Montering til billedhåndtering

  1. Brug en sprøjte med en 18 G nål til at sprede en tynd, ubrudt grænse af vakuum fedt (f.eks Dow Corning # 976V) rundt i kanten af en 24 mm x 24 mm dækglas. Tilsættes nogle dråber sterilt PBS til brønden. Bemærk, at monterings medium indeholdende glycerol med n-propylgallat ikke kan compatible med Dil 11. Tilsvarende kan vakuum fedt med lav viskositet blandes med PBS og resultere i høj baggrund.
  2. Fjern benene fra den åbne bog og overføre den til PBS dråbe. Nedsænke den åbne bog, og placere det i midten af ​​boringen.
  3. Anbring forsigtigt en anden 24 mm x 24 mm dækglas på toppen, og sørg for den åbne bog forbliver åben. Om nødvendigt kan dækglasset fjernes, og den åbne bog flyttes. Trykke forsigtigt omkring kanterne af præparatet for at skabe en fuldstændig forsegling af fedt. Overskydende PBS vil blive presset ud under dette trin. Undgå luftbobler.
  4. Hold forberedelserne i mørke ved 4 ° C, indtil klar til inspektion og dokumentation af fluorescerende mikroskopi. Dette bør ske hurtigt (inden for en uge) for at sikre, at præparaterne ikke tørrer ud.

4. Repræsentative resultater

Elektroporering og ekspression af plasmider

Underovenfor beskrevne betingelser, skal fluorescerende protein være klart påviselig i den relevante celletype uden behov for yderligere forstærkning af signalet fra antistof-mærkning. Det fluorescerende protein bør kun kunne påvises i den ønskede celletype / sek. Repræsentative eksempler på åben bog præparater og tværsnit af embryoner elektroporeret med de forskellige plasmider er vist i figur 2.

Effektivitet af kunstige miRNA

Kunstige miRNA mod en hidtil ukendt gen af ​​interesse skal først screenes for effektiviteten og specificiteten af ​​deres knockdown effekter. Vi finder, at β-actin-promotor-drevne konstruktioner, elektroporeret ved 0,25 pg / pl, er velegnede til dette 3. Knockdown in vivo kan testes ved immunhistokemi eller in situ hybridisering.

Dil mærkning

Tilstrækkeligt målrettet DII injektioner i vildtype embryonerbør give mere end 80% af injektionssteder med ideelle, arketypiske baner 3, som vist i figur 3. Dyr til dyr variation skulle være lille.

Figur 1
Figur 1. Generelle skematisk af miRNA-udtrykkende plasmidvektorer. Brugen af ​​forskellige RNA-polymerase II-promotorer / enhancere muliggør celletype-specifik ekspression. De transficerede celler er identificerbare ved ekspression af en fluorescerende reporter, som er direkte forbundet med (i et enkelt transkript) til en eller to kunstige miRNA, som vælte genekspression. Fed tekst angiver sense-strengen af ​​en kunstig miRNA mod LacZ som beskrevet i teksten.

Figur 2
Figur 2. Repræsentative eksempler of fluorescerende protein ekspressionsmønstre opnået efter elektroporering af de angivne plasmidvektorer. Tværsnit og åbne bøger er fra HH25-26 kyllingeembryoner der blev elektroporeret ved HH18. β-actin-promotoren driver allestedsnærværende ekspression, Math1 enhancer driver ekspression i DI1 neuroner og Hoxa1 forstærker driver ekspression specifikt i bundpladen. CN, kommissurale neuron; FP, gulvplade.

Figur 3
Figur 3. Anvendelse og analyse af DII injektionssteder i åben bog præparater. Dil skal injiceres i et punktformet mønster, tæt på den laterale margin af den åbne bog på den elektroporerede side (identificeret ved fluorescerende protein-ekspression). Efter 3 dages diffusion, bør kommissurale axon baner kan være visualiseret under fluorescensmikroskopi. Normale axon baner vil vokse mod gulvet psent, krydse gulvet plade og derefter slå og vokse rostrally. Unormale fænotyper som følge af gen knock down kan sammenlignes med dette arketypiske bane. I eksemplet, gøre nogle axoner stall i bundpladen eller fejlagtige dreje beslutninger på den modstående side.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne enkle, vektorbaseret kunstige miRNA ekspression strategi kan anvendes til at knockdown endogen genekspression i kylling neuralrøret. Disse funktionelle værktøjer har multiple gen-nedregulering, tidsmæssig regulering og celletype specificitet, for at lette opklaringen af ​​komplekse udviklingsmæssige forløb. Især har vi demonstreret anvendeligheden af disse plasmider i kommissurale Axon vejledning, eftersom plasmider kan anvendes til at knockdown forskellige gener i kommissurale neuroner eller i deres mellemmål, gulvpladen 3.

Intensiteten og placeringen af ​​fluorescerende protein ekspression genereret fra miRNA-udtrykkende plasmider (og dermed de lyddæmpede celler) vil afhænge af følgende parametre:

  1. Enhancer anvendt:
    1. β-actin-promotoren er ubikvitært aktive
    2. Math1 forstærker er kun aktiv i DI1 neuroner 12
    3. 13
  2. Koncentration af plasmid.
    Hvis plasmid koncentrationen er for høj, kan det forårsage "utæthed" af enhanceraktivitet og efterfølgende ekspression i uønskede celler, mens for lidt plasmid kan reducere ekspressionen af ​​det fluorescerende protein og forhindre de elektroporerede celler fra at være spores. Høje koncentrationer af RNAi plasmider bør også undgås for at reducere ikke-tilsigtede virkninger og minimere risikoen for ikke-specifik toksicitet som følge af mætning af det endogene miRNA biogenese pathway. Vi bruger:
    1. β-actin-promotor: 0,25 pg / pl
    2. Math1 enhancer: 0,7 pg / pl
    3. Hoxa1 enhancer III: 0,5-1,0 pg / pl
  3. Nøjagtighed af elektroporation.
    Håndtering kyllingeembryoner in ovo kræver manuelle færdigheder, der skal erhverves gennem uddannelse. Vi og andrehar tidligere udgivet fejlfindingstip til denne procedure 14,15.

Adskillige miRNA muligvis testes, før en egnet kandidat er fundet. Denne proces bør omfatte identifikation af flere uafhængige miRNA til at bekræfte en observeret fænotype, negative kontroller (krypteret og / eller uafhængige miRNA) og redning konstruerer 16.

Open-bog præparater skal fastsættes optimalt og injiceret med Dil i den passende placering for at visualisere strukturelle detaljer af de axonale fremskrivninger af kommissurale neuroner. Høj baggrund kan være forårsaget af langvarig fiksering af de åbne bøger eller spild af Dil. Injektion af Dil i celler der er for dorsalt vil normalt resultere i en mangel på mærkede axonale projektioner mod bundpladen. Celler, der er for ventralt vil få mange ipsilaterale og kontralaterale projektioner på midterlinjen, og bør derfor undgås. For beginners, anbefaler vi at øve på åben-bøger taget fra vildtype embryoner til at sikre nøjagtig, reproducerbar positionering af Dil.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter erklæret.

Acknowledgements

Arbejdet i laboratoriet af ES er støttet af den schweiziske National Science Foundation. Vi vil gerne takke Dr. beat Kunz for at få hjælp med at filme.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics