Open-kitap Hazırlıklarında Dii Enjeksiyon tarafından geliştirilmesi Nöral Tüp ve fenotipleri Değerlendirilmesinde miRNA tabanlı Plazmidler arasında ovo Elektroporasyon yılında

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nöral tüp içinde gen ekspresyonunu bir hücre tipine özgü, izlenebilir bir şekilde aşağı regüle olabilen göre bir yöntem tarif edilmektedir. Biz nasıl gösterilmektedir

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Commissural DI1 nöronlar yoğun gelişim 1,2 sırasında akson rehberliği altında yatan mekanizmaları aydınlatmak çalışılmıştır. Bu nöronlar dorsal omurilikte bulunan ve basmakalıp yörüngeleri boyunca aksonları gönderebilirsiniz. Commissural akson başlangıçta yönünde ve daha sonra zemin plakası üzerinde ventral proje. Midline geçtikten sonra, bu aksonlar uzunlamasına beyin doğru keskin bir dönüş rostral ve proje yapmak. Bu adımların her biri çekici ve itici rehberlik ipuçlarının koordineli faaliyetler düzenlenir. Bu ipuçlarının doğru yorumlanmasını kendi sınırları çizilmiş yol boyunca akson rehberlik için çok önemlidir. Böylece, kılavuz commissural akson için belirli bir molekülün fizyolojik katkı ideal olarak canlı embriyo bağlamında incelenmiştir. Buna göre, in vivo gen demonte hassas dikkatle birden oynayabilir genlerin akson rehberlik faaliyetleri ayırt etmek için kontrol edilmelidirgelişimi sırasında rolleri.

Burada, bir hücre tipine özgü, izlenebilir bir şekilde tavuk nöral tüp knockdown gen ekspresyonu için bir yöntem açıklanmaktadır. Biz 3 hücre tipine özgü yararlanıcı / Bir floresan protein marker ekspresyonu sürücü arttırıcılar, barındıran bir miR30-RNAi transkript 4 (cDNA floresan protein 3'-UTR içinde bulunan) (tarafından doğrudan takip roman plazmid vektörler kullanın Şekil 1). Gelişmekte olan nöral tüp içine electroporated, bu vektörlerin gen ifadesinin verimli baskılanması ortaya çıkarmak ve demonte 3 karşılaştığınız hücrelerin izleme doğrudan etkinleştirmek için parlak floresan işaretleyici proteinleri ifade. Elektroporasyon önce farklı RNAi vektörler Karıştırma omurilik bağımsız bölgelerinde iki ya da daha fazla genin eşzamanlı devirme izin verir. Bu hızlı bir şekilde, s, geliştirme aşamasında ele alınacak kompleks hücresel ve moleküler etkileşimler izin, uygu hassas ve ucuz. Açık kitap hazırlıkları 5 commissural akson yörünge Dii izleme ile birlikte, bu yöntem commissural akson büyüme ve rehberlik hücresel ve moleküler mekanizmalar in vivo çalışmalar için yararlı bir araçtır. Ilke olarak, herhangi bir hızlandıncı / kuvvetlendirici potansiyel olarak geliştirme 6 sırasında gen fonksiyonu in vivo çalışmaları için yöntem daha geniş çapta uygulanabilir hale kullanılabilir.

Bu video ilk nasıl işleneceğini gösterir ve pencere yumurta, nöral tüp içine DNA plazmid enjeksiyon ve elektroporasyon prosedürü. Commissural akson rehberlik araştırmak için, spinal kord, açık-kitap hazırlanması gibi embriyo kaldırılır sabit ve akson yollar izlenebilir sağlamak için Dii ile enjekte edilir. Omurilik lamelleri arasına monte ve konfokal mikroskopi kullanılarak canlandırılmaya çalışılır.

Protocol

1. Hücre tipine özgü gen susturma için RNAi Plazmit DNA'nın hazırlanması

Plazmidler (Şekil 1), daha önce ayrıntılı olarak açıklandığı 3,4 standart moleküler klonlama teknikleri kullanılarak sentez edilir.

Vektörlere 1.1 Klon: oligonucelotide tasarım

  1. Aynı evrensel oligonükleotidler ve pRFPRNAiC vektör 4 (ARK-Genomik) ile sağlanan ürün bilgileri de tarif edilmiştir klonlama protokoller kullanılır.
    1. İlk firkete siteye klonlama için:
      5 'astar HP1:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 'astar HP1:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. : İkinci firkete site içine klonlama için
      5 'astar HP2:
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 'astar HP2:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. : Biz gen-spesifik hedef dizileri seçmek için Genscript en siRNA Hedef Bulucu kullanabilirsiniz https://www.genscript.com/ssl-bin/app/rnai .
  3. İlk firkete siteye klonlama bir gen-spesifik miRNA için Astarlar:

Susturulması GFP için bir örnek aşağıda gösterilmiştir.
Hedef sekansı (22nt): 5'-GGCACAAGCTGGAGTACAACTA
GFP İleri HP1 = 59mer
Sıra 1
GFP Ters HP1 = 58mer
Sıra 2
MiRNA sınırdaş dizileri (tavuk-özel), ve ortak döngü / kök dizileri (insan miRNA30 itibaren) bir parçası olduğunu bu Oligolar ortak dizileri vardır. Gene özel hedef sekansları altı çizilmiştir. Am olduğunu unutmayınbu konumda miRNA30 içinde doğal uyumsuzluk taklit etmek için, (A → Bu örnekte, bir kalın olarak gösterilmiştir) ileri şeridinin 5 'tabanda IsMatch.

  1. İkinci firkete siteye klonlama bir gen-spesifik miRNA için Astarlar:

Susturulması lacZ için bir örnek aşağıda gösterilmiştir.
Hedef sekansı (22nt): 5'-CGCGCTGTATCGCTGGATCAAA
LacZ İleri HP2:
Sırası 3
LacZ Ters HP2:
Sırası 4
Yine ileri iplikçiktekilerin hedef sekansın 5 'üssü değişti unutmayın (kalın olarak gösterilen; C → Bu örnekte A) böylece uyumsuzlukları antisens dizisi, miRNA30 taklit olduğunu.

1.2 PCR reaksiyonu ve alt klonlanması

  1. Bu gen özel olarak Oligolar bizetavuk ile miRNA30 gibi saç tokası oluşturmak için bir PCR reaksiyonunda evrensel Oligolar ile birlikte komşu sekansları miRNA ed.
İlk firkete site içine Klonlama:
Ul 1 - 10 ng GFP İleri astar HP1
1 ul - 100 ng 5 'astar HP1
1 ul - 100 ng 3 'astar HP1
1 ul dNTP (10 mM)
5 ul reaksiyon tamponu 10x Pfu
1 ul Pfu DNA polimeraz (Promega)
39 ul PCR-Grade su
VEYA İkinci firkete site içine Klonlama:
Ul 1 - 10 ng lacZ İleri astar HP2
1 ul - 100 ng 5 'astar HP2
1 ul - 100 ng 3 'astar HP2
1 ul dNTP (10 mM)
5 ul reaksiyon tamponu 10x Pfu
1 ul Pfu DNA polimeraz (Promega)
39 ul PCR-Grade su

Döngüler:

94 ° C 94 ° C 55 ° C 72 ° C 72 ° C 4 ° C
1 dakika 30 sn 30 sn 1 dakika 9 dk tutmak
30 devir
  1. Vektör içine kısıtlama enzimleri ile sindirilmesi ve subclone, PCR ürünü arındırmak:
    1. İlk firkete sitesi: kullanım Nhel ve Mlul
    2. İkinci firkete sitesi: kullanım Mlul ve SpI
  2. Yetkili bakteri hücrelerinin dönüşümü için standart teknikler izleyin. Plazmid midipreparation (örn. Nucleobond Xtra Midi kiti, machery-Nagel) tarafından LB agar (ampisilin içeren) ve hasat DNA Plaka hücreleri.
  3. Konsantre plazmid DNA Askıya-20 ° C'de spektrofotometri ve mağaza tarafından steril GKD 2 0, ölçü konsantrasyon

1.3 Dizileme miRNA plazmidler

Standart koşullar altında sıralanması reaksiyon genellikle saç tokaları güçlü ikincil yapısı nedeniyle başarısız olur. Bu 7 artırmak için:

  1. Su yerine, 0.01 mM EDTA (pH 8.0) içeren 10 mM Tris-Cl, sıralama reaksiyonu gerçekleştirin. Bu sıralama için daha müsait ssDNA, için, süper DNA dönüştürme arttırır.
  2. Bir ısı denatürasyonu adım ekle (98 ° C, 5 dk) önce sıralanması için. Bu ssDNA için, süper plazmid DNA dönüştürür.

2. Elektroporasyon

2.1 Yumurta taşıma

  1. 38.5 ° C ve ~% 45 nem kuluçka seti içine yumurta yerleştirin.
  2. Embriyo gelişimi istenen aşamada ulaşana kadar yumurta inkübe edin. Commissural nöronların akson rehberlik incelemek için, typicallOnlar Hamburger & Hamilton (HH) evre 17-18 (kuluçka yaklaşık 3 gün sonra) 8 ulaştığınızda y embriyolar elektroporasyonu. İlgili proteini birikmiş önce Ancak, enjeksiyon ve elektroporasyon devirme etkili hale getirmek için, yapılması gerekir.
  3. Inkübatörden yumurta çıkarın ve yumurtanın üst tarafında yumurta sarısı üst embriyo konumlandırmak için, 20 dakika boyunca sabit bir yatay pozisyon, koyun. Bu dönemde kuluçka için yumurta dönün.

Reaktifler ve cihazlar 2.2 hazırlanması

  1. Tuzlu su (PBS) ile fosfat tamponlu hazırlayın ve filtre ardından 0.2 um bir otoklav veya aracılığıyla çözelti geçen sterilize edilir.
  2. Kılcal çekerek cam mikropipetler olun (Dünya Hassas Aletler 1B120F-4; 1.2 / 0.68 OD / ID (mm)) uygun bir çekme cihazında (örn. Narishige PC-10). ~ 5 mikron bir uç çapı elde etmek için bir mikropipet ucu koparak ile boru parçası bağlayınUygun çap.
  3. 0,5 cm arası bir elektrot mesafesi ile, sıkıca bir el çerçeve içinde platin elektrot (0.5 cm uzunluğunda) monte edin. Bir kare dalga sinyal jeneratörü (BTX ECM 830) için elektrotlar bağlayın.
  4. Aşağıdaki parametreler ile puls üreteci ayarlayın:
    1. Unilateral elektroporasyon için: gerilim: 25 V, darbe sayısı: 5, darbe uzunluğu: 50 msn, strok arası aralığı: 1 saniye
    2. Gerilim: 18 V, darbe sayısı: nabız 5, uzunluğu: 50 msn, strok arası aralığı: 1 saniye ikili elektroporasyon için
  5. 18 G iğne, bir neşter,% 70 etanol ve bant bir spritz şişe ile bir şırınga hazırlayın.
  6. 80 ° C'de bir ısıtma plakası üzerinde bir deney şişesi içinde parafin balmumu eritilir

2.3 Pencereleme

  1. % 70 etanol ile ıslatılmış kağıt mendil kullanarak yumurta silin.
  2. Yumurta uzun ekseni boyunca bir bant şerit yerleştirin.
  3. Az birinin, bir neşter kullanılarak yumurta kabuğu içinde iki küçük delik Yappencereli edilecek alanın köşesinde yumurta ve diğer ucu sivri.
  4. Bir şırınga kullanarak, yaklaşık kaldırın. Yumurta ve kör uç yarığa doğru 45 ° 'lik bir açıyla iğne sokarak her bir yumurta akı dan 3 ml. Dikkatlice sarısı zarar görmemesi.
  5. Embriyonun zarar vermemek için yatay düzenlenen küçük makas kullanarak yumurta kabuğu içine bir pencere kesin. Gerekirse, embriyonun konumu yumurtanın künt uç karşı güçlü bir ışık tutarak doğrulanmış ve bir kalem ile işaretlenebilir. 1.5 ila 2 cm kare bir pencere çoğu uygulamalar için kullanışlıdır.
  6. Bir fırça ile uygulanır yumurta künt sonunda delik ve erimiş parafin ile yumurta kabuğu herhangi bir çatlak, mühürleyin.
  7. Şeffaf bant (örn. Scotch Magic) kullanarak pencereyi kapatın.
  8. Kuluçka için yumurta dönün.

2.4 Elektroporasyon

  1. Steril araçları hazırlayın ve% 70 etanol ile çalışma alanı silin.
  2. I hazırlayınnjection çözüm. Uygun DNA konsantrasyonu kullanıcı tarafından belirlenmelidir ve ifade sürmek için kullanılan arttırıcı / organizatörü göre değişecektir. Bir kılavuz olarak, biz genellikle 0,2-2,0 mcg / ul (Tartışma bakın) kullanın. 20 ul toplam olarak, enjeksiyon karışım içermektedir:
RNAi plazmid DNA (2 0 H) X ul
20x PBS 1 ul
% 0.4 tripan mavisi 2 ul
son hacim için steril GKD 2 0, 20 ul

Microcapillary tüp takılı cam içine DNA karışımı yüklemek için nazik vakum kullanın.

  1. Pencereli yumurta bandı çıkarın ve Hamburger ve Hamilton 8'e göre embriyo sahneleyecek.
  2. Dikkatle extrae kaldırmak için forseps ve makas makas kullanınEmbriyonun kaudal yarısından itibaren mbryonic membranlar. Büyük sağ ve sol vitellin damarlar gövde gireceğiniz membranlar Bölgede kolayca embriyo uzak kaldırılabilir. Yavaşça gözyaşı veya kesmek membranlar ve kuyruk doğru onları çekin. Gerekirse, embriyo Boulland ve meslektaşları 9 tarafından bir video gösterildiği gibi embriyonik diskin ve yumurta sarısı arasında Hindistan'da mürekkep veya Fast Green bir solüsyon enjekte iyi incelenebilir.
  3. Sadece arka ayakların üzerinde, nöral tüpün merkezi kanal içine DNA çözelti enjekte edilir. Ağız yoluyla enjeksiyon hacmi kontrol edin. Mavi boya kadar gelişmekte olan beynin ventriküle kuyruğunun ucundan yaymak gerekir.
  4. Embriyo üstüne steril PBS birkaç damla ekleyin.
  5. Embriyonun ön-arka eksenine paralel elektrotlar yerleştirin. Embriyo veya kan damarları dokunmaktan kaçının.
  6. Elektrotlar sabit tutun ve elektroporasyonu.
  7. Dikkatlice elektrotları temizleyin ve yıkayınsteril su yumurta beyazı denatüre proteinlerin kaldırmak için.
    1. Ikili elektroporasyon için, elektrotlar polarite geçiş embriyo paralel elektrotlar konumlandırmak ve elektroporasyon tekrarlayın. Steril su içinde elektrotlar durulayın.
  8. Embriyo üzerine biraz daha steril PBS bırakın. Bant ile yumurta sızdırmazlığını yeniden ve istenilen gelişme aşamasına ulaşana kadar inkübatör iade. Uygun sızdırmazlık embriyonun dehidratasyonu önlemek için çok önemlidir.

3. Omurilik Hazırlıklar

Embriyoların 3.1 Diseksiyon

  1. HH25-26 (inkübasyon günü 5) At, forseps ya da küçük bir kaşık kullanarak yumurta gelen embriyo çıkarın. Silikon (Sylgard elastomer) ile kaplı bir Petri kabındaki PBS yerleştirin.
  2. Extraembryonic membranlar çıkarın ve arka embriyo yatıyordu. Nazik s ile, boyun ve kuyruk (0.20 mm böcek pimleri kullanarak) aracılığıyla iğneleyerek plaka üzerinde stabilizetretching.
    1. Insan embriyosu (daha sonra kesme işlemi için)% 4 paraformaldehit (PFA) ile yerine PBS ile oda sıcaklığında 1 saat süre ile inkübe ederek, burada tespit edilebilir. Açık kitap hazırlıkları yapmak için, aşağıda açıklandığı gibi sabitlenmemiş dokusu ile protokolü devam ediyor.

Embriyolardan spinal kord 3.2 İzolasyon

  1. Onlar diseksiyon ile karışmaz, böylece işaretçilerine uzak embriyodan bir açıyla yerleştirildiğinden emin sağlanması, bacaklarda Pin. Embriyo doku yoğunluğu aşağıdaki adımları algılanmasını sağlamak için aşağıdan yanmalıdır.
  2. Kalp ve yay makas kullanılarak iç organlar çıkarın ve yavaşça forseps ile kazıma. Tüm organları tamamen kaldırılmıştır varsa parçalı omurga ve omurilik görünür olmalıdır.
  3. Yay makas kullanarak, boyun omuriliği örten omurga boyunca sığ bir kesim yapmak. Embriyo 180 ° döndürün ve iki kısasıkuyruk doğru boyun omuriliği iki tarafındaki omurlar ile uzunlamasına keser. Uzaklıkta omurilik ve kuyruk doğru tek şerit doku (tüm omurga içeren) soyma vertebra flep kaldırmak için forseps kullanın.
  4. Yavaşça kuyruk ve bacaklarda yoluyla embriyo germek ve re-pin.
  5. Omurilik örten zarları kesip ince bir mikrocerrahi neşter (örn. Grieshaber 68101) veya bir tungsten iğne kullanın. Nöral tüp ve dorsal kök gangliyon arasında doku koyu, yoğun satıra bakın. Gerekirse, aydınlatma açısını ayarlayın. Yavaşça boynundan kuyruk, omuriliğin her iki tarafında bu hat boyunca uzunlamasına kesilir. Meninksler tutturulmuş embriyonun germe nazik nedeniyle omurilikten ayırmak gerekir.
  6. Kanat tomurcuk ve bacak tomurcuk kaudal seviyesinde omurilik yoluyla kesin ve kaudal bir pürüzsüz rostral içinde embriyonun bütün omurilik dışarı çıkarın hareket, forseps kullanarak. İzole omurilik bu adım sırasında PBS içinde dalmış halde muhafaza edilmelidir. Çanak dışarı kaldırmayın.

Açık-kitap 3.3 Fiksasyon

  1. Bir spatula üzerine izole spinal kord duyurun ve PBS içinde% 4 paraformaldehid içeren yeni bir silikon askı Petri aktarın.
  2. Dikkatlice (rostrally, medial ve kaudal her tarafta, 0.10 mm böcek pimleri kullanarak) altı pozisyonlarda omurilik iğneleyerek düz montaj hazırlığı üretin. Biz embriyo tanımlayan sadece küçük bir 'bayrak' tarafından her hazırlık etiketlemek değil, aynı zamanda açık-kitap hazırlama ön sonunu gösterir.
  3. 30 dk, 1 saat boyunca oda sıcaklığında inkübe edin. Bu DII difüzyon 10 verimini düşürür ve arka plan arttıkça Open-kitaplar üzerinde-sabit olmamalı.
  4. Dikkatle% 4 PFA kapalı dökün ve PBS ile değiştirin. ° C DII veya bağlama ile enjekte hazır olana kadar 4 de yemekleri tutun.
commissural nöronlara geri e_step "> 3.4 uçucu, enjeksiyon

  1. Floresans miscroscopy altında açık-kitap gözlemleyin ve Dii ile enjekte açık kitabın uygun tarafı seçin.
  2. Hızlı DII (5 mg / ml etanol içinde) hazırlayın ve plastik boru eklenmiş bir cam mikropipet çözelti içine çekmek. Çok küçük çaplı uç elde etmek için mümkün olduğu kadar ince mikropipet ucundan bölün. PBS bir çanak içine iğne takın ve Dii iğne sızıntısı olup olmadığını kontrol edin. DII sızıntı yaparsa, iğne çapı çok büyük. Bu durumda, yeni bir iğne hazırlar.
  3. Aşağıdan açık kitap hazırlıkları aydınlatın. Preparat yanal kenarından bir hemibook ve genişliğinin yaklaşık 1/5 'yer alan bir doku yoğun uzunlamasına şerit için, bak. Bu durum, çatı levhası için sadece ventral bulunan commissural nöronlar, hücre gövdeleri karşılık gelir. Açık kitap bir ucunda başlayan bir iğne gibi, doku içine cam iğne eklemek ves geri, bir ağız pipet kullanarak Dii küçük bir miktarda puf.
  4. Yaklaşık 0.5 mm düzenli aralıklarla açık kitabın uzunluğu boyunca çeşitli enjeksiyonlar yaparak, hızlı bir şekilde çalışın. Iğne tıkanmış hale gelirse, forseps ile dikkatlice temizleyin. Ucu çok büyük (ve DII sızıntı) hale gelirse, iğneyi değiştirin.
  5. Her açık kitap tamamlandığında, herhangi bir aşırı uzak emmek ve atmak için bir transfer pipet kullanın Dii sızdırılmış. Bunu yapmak için hata yüksek arka plan neden olur.
  6. 4 yaklaşık üç gün için hazırlıklar bırakın ° C Dii aksonları yayılabilir sağlamaktır.

Görüntüleme için 3,5 Montaj

  1. X 24 mm cam lamel 24 mm kenarlarında vakum gres ince, kesintisiz sınırı (örneğin Dow Corning # 976V) yaymak için bir 18 G iğne ile bir şırınga kullanın. Iyi için steril PBS içinde birkaç damla ekleyin. N-propil gallat ile gliserol ihtiva eden montaj orta eş olabilir dikkat edinizDII 11 mpatible. Benzer şekilde, düşük viskozite vakum gres PBS ve yüksek arka planda sonuç ile karışımı olabilir.
  2. Açık kitap işaretçilerine çıkarın ve PBS damlacık içine aktarın. Açık kitap daldırın ve kuyunun ortasına yerleştirin.
  3. Hafifçe açık kitap açık kalır emin, üstüne başka bir 24 mm x 24 mm lamel yerleştirin. Gerekirse, lamel kaldırılır ve açık kitap yeniden yerleştirilebilir. Gres tam bir mühür oluşturmak için hazırlık kenarlarında hafifçe bastırın. Aşırı PBS bu adımı sırasında sıkılmış olacak. Hava kabarcıkları kaçının.
  4. ° C floresan mikroskop ile muayene ve belgelendirme için hazır olana kadar 4 karanlıkta hazırlıkları tutun. Bu hazırlıklar kurumasına yok emin olmak için, (bir hafta içinde) süratle yapılmalıdır.

4. Temsilcisi Sonuçlar

Plazmidlerin Elektroporasyon ve ifadesi

AltındaYukarıda açıklanan koşullar, floresan protein antikor etiketleme ile sinyalinin ilave amplifikasyon için gerek kalmadan uygun hücre tipi açıkça tespit edilebilir olması gerekir. Floresan protein, sadece arzu edilen hücre tipi / s olarak tespit edilebilir olmalıdır. Açık kitap preparatlar ve farklı plazmitler ile electroporated embriyoların en kesit temsili örnekler, Şekil 2 'de gösterilmiştir.

Yapay miRNA'lar Verimlilik

Ilgi yeni bir gen karşı Yapay miRNA'lar önce kendi knockdown etkilerinin verimlilik ve özgüllük için ekranlı olmalıdır. Biz 0.25 mikrogram / ​​ul az electroporated β-aktin organizatörü güdümlü yapıları, bu 3 için uygun olduğunu bulmak. In vivo Nakavt immünohistokimya veya in situ hibridizasyon test edilebilir.

DII etiketleme

Uygun yabani-tip embriyolar içine Dii enjeksiyonları hedefŞekil 3'te gösterildiği gibi, ideal arketip yörüngeleri 3 ile enjeksiyon yeri fazla% 80 verim gerekir. Hayvan değişkenlik Hayvan düşük olmalıdır.

Şekil 1
Şekil 1. MiRNA ifade plazmit vektörlerinin Genelleştirilmiş şematik. Farklı RNA polimeraz II arttırıcılar / artırıcı kullanımı hücre tipine özgü ifade sağlar. Transfekte hücreler doğrudan gen ekspresyon yıkmak bir veya iki yapay miRNA'lar için (tek bir transkript içinde) bağlı bir flüoresan raportör ifade tanınabilir. Yazıda tarif edildiği gibi Kalın metin, lacZ karşı bir yapay miRNA anlamında iplikçik gösterir.

Şekil 2,
Şekil 2. Temsil eden örnekler; of floresan protein ekspresyonu Belirtilen plazmid vektörler elektroporasyon takiben elde. Kesitler ve açık kitaplar HH18 az electroporated edildi HH25-26 tavuk embriyoları vardır. β-aktin organizatörü her yerde ifade sürücüler, Math1 artırıcı DI1 nöronlarda ifade sürücüler ve Hoxa1 arttırıcı zemin plaka özellikle ifade sürücüler. CN, commissural nöron; FP, zemin plakası.

Şekil 3
Şekil 3. Açık kitabın hazırlıkları Dii enjeksiyon bölgelerine uygulanması ve analizi. DII electroporated tarafı (floresan protein ifadesi ile tanımlanır) üzerine, yakın açık kitap lateral marjı, bir noktasal desen enjekte edilmelidir. Difüzyon 3 gün sonra, commissural akson yörüngeleri floresan mikroskop altında görüntülenebilir olması gerekir. Normal akson yörüngeleri kat p doğru büyüyecekGeç, zemin plaka çapraz ve sonra rostrally açın ve büyümek. Aşağı gen vuruntu kaynaklanan anormal fenotip bu arketipsel yörünge mukayese edilebilir. Örneğin, bazı aksonlar zemin plaka durak veya karşı tarafta hatalı dönüm kararlar.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu basit, vektör tabanlı bir yapay stratejinin miRNA ifade tavuk nöral tüp içinde devirme endojen gen ekspresyonu için kullanılabilir. Bu fonksiyonel araçlar karmaşık bir gelişimsel yolların aydınlatılmasında kolaylaştırmak için, birden fazla gen susturulması, zamansal kontrolü ve hücre tipi özgüllük sunuyoruz. Plazmitler commissural nöronlar ya da kendi ara hedef, zemin plakası 3 devirme gen için kullanılır dolayısıyla ayrıntılı olarak,, commissural akson yönlendirme, bu plazmid yarar göstermiştir.

MiRNA anlatımla plazmidler (ve dolayısıyla, susturulmuş hücreleri) üretilen floresan protein ifade yoğunluğu ve konumu aşağıdaki parametrelere bağlıdır:

  1. Artırıcı kullanılır:
    1. β-aktin organizatörü ubiquitously aktif
    2. Math1 artırıcı sadece DI1 nöronların 12 aktif
    3. 13 aktif
  2. Plazmid konsantrasyonu.
    Plazmid konsantrasyonu çok yüksek ise çok az plazmid floresan protein ekspresyonu azaltmak ve izlenebilir olmaktan electroporated hücreleri önleyebilir iken, bu, etkinlik arttırıcı ve istenmeyen hücreleri içinde daha sonraki ifade 'leakiness' yol açabilir. RNAi plazmidler Yüksek konsantrasyonları da off-hedef etkilerini azaltmak ve endojen miRNA biyogenezi yolunun doygunluk kaynaklanan non-spesifik toksisite olasılığını en aza indirmek için kaçınılmalıdır. Biz kullanın:
    1. β-aktin organizatörü: 0.25 mg / ul
    2. Math1 arttırıcı: 0.7 mikrogram / ul
    3. Hoxa1 artırıcı III: 0.5-1.0 mg / ul
  3. Elektroporasyon Doğruluk.
    Ovo tavuk embriyoları Handling eğitim yoluyla edinilmesi gerekir el becerilerini gerektirir. Biz ve diğerleriDaha önce bu yordamı 14,15 sorun giderme ipuçlarını yayınladı.

Uygun bir aday bulunmadan önce birkaç miRNA'lar test edilmesi gerekebilir. Bu süreç, gözlenen bir fenotip, negatif kontroller (pişmiş ve / veya ilgisiz miRNA'lar) ve kurtarma 16 oluşturur onaylamak için birkaç bağımsız miRNA'lar belirlenmesini içermelidir.

Açık-kitap preparatlar commissural nöronların aksonal projeksiyonlar yapısal detayları görselleştirmek için uygun konuma optimal sabit ve DII ile enjekte edilmelidir. Yüksek arka açık-kitap veya Dii dökülme uzamış fiksasyon neden olabilir. Çok dorsal bulunan hücrelere Dii Enjeksiyon genellikle zemin plaka doğru etiketli aksonal projeksiyonlar eksikliği neden olur. Çok ventral bulunan hücreler orta hatta birçok ipsilateral ve kontralateral projeksiyonlar olacak ve böylece kaçınılmalıdır. Beginne içinrs, biz DII doğru, tekrarlanabilir konumlandırma sağlamak için yabani-tip embriyolar alınan açık kitap pratik öneririz.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgements

ES laboratuarında Çalışma İsviçre Ulusal Bilim Vakfı tarafından destekleniyor. Biz filme yardım için Dr bitirin Kunz teşekkür etmek istiyorum.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics