High-throughput Functionele Screening met behulp van een zelfgemaakte Dual-gloed Luciferase Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

We presenteren een snelle en goedkope screening methode voor het identificeren van transcriptiefactoren met behulp van high-throughput robotachtige transfecties en een zelfgemaakte dual-gloed luciferasetest. Dit protocol snel genereert direct naast elkaar functionele data voor duizenden genen en is gemakkelijk aanpasbaar aan een gen van belang te richten.

Cite this Article

Copy Citation | Download Citations

Baker, J. M., Boyce, F. M. High-throughput Functional Screening using a Homemade Dual-glow Luciferase Assay. J. Vis. Exp. (88), e50282, doi:10.3791/50282 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

We presenteren een snelle en goedkope high-throughput screening protocol transcriptionele regulatoren van alfa-synucleïne, een gen geassocieerd met de ziekte van Parkinson te identificeren. 293T cellen transient getransfecteerd met plasmiden uit een array ORF expressiebibliotheek, samen met luciferase reporter plasmiden in een gen-per-well microplate format. Vuurvlieg luciferase activiteit bepaald na 48 uur om de effecten van elke bibliotheek gen op alfa-synucleine transcriptie, genormaliseerd op de expressie van een interne controle construct (een hCMV promoter Renilla luciferase) bepalen. Dit protocol wordt vergemakkelijkt door een tafelmodel robot ingesloten in een bio kast, die aseptisch vloeistofverwerking in 96-well formaat uitvoert. Onze geautomatiseerde transfectie protocol gemakkelijk aanpasbaar voor hoge-doorvoer lentivirale bibliotheek productie of andere functionele screening protocollen ter drievoudige transfecties van grote aantallen unieke bibliotheek plasmiden conjuncties met een gemeenschappelijke set van helper plasmiden. Presenteren we ook een goedkoop en gevalideerd alternatief voor in de handel verkrijgbare, dual luciferase reagentia die PTC124, EDTA, en pyrofosfaat te vuurvliegluciferase activiteit onderdrukken voorafgaand aan de meting van Renilla luciferase telt. Met behulp van deze methoden, gescreend we 7670 menselijke genen en geïdentificeerd 68 regulatoren van alfa-synucleïne. Dit protocol is gemakkelijk aanpasbaar aan andere genen van belang te richten.

Introduction

De mogelijkheid om belangrijke genetische regulerende elementen en de factoren die inwerken op hen te identificeren is fundamenteel voor de exploratie van talrijke biologische processen. Echter, het identificeren van factoren die de expressie van genen reguleren in zeldzame soorten cellen, zoals specifieke neuronale populaties, kan een uitdaging zijn. Hier presenteren we een protocol voor het identificeren van nieuwe transcriptionele regulatoren van alfa-synucleïne (SNCA), een gen geassocieerd met de ziekte van Parkinson en uitgedrukt in dopaminerge neuronen in de substantianigra pars compacta regio van de middenhersenen. We doen dit met behulp van een high-throughput, dual-luciferase, in vitro reporter scherm om alfa-synucleïne expressie deconstrueren in 293T-cellen. De alfa-synucleïne promoter wordt eerst gekloneerd in een reporter plasmide dat het vuurvlieg luciferase gen. Een commercieel verkrijgbaar plasmide dat het Renilla luciferase onder controle van een constitutief actieve promoter fungeert als een interne controle. These reporter constructen worden co-getransfecteerd in 293T-cellen in microtiterplaten met plasmiden uit een DNA-expressie-bibliotheek, zodat elk putje getransfecteerd met een plasmide bibliotheek. Na 48 uur werd luciferaseactiviteit voor elke reporter achtereenvolgens gemeten met een dual-glans assay. De relatieve expressie van alfa-synucleïne voor iedere bibliotheek gen wordt afgeleid door de verhouding van vuurvlieg: Renilla luciferaseactiviteit in elk putje (F: R verhouding) na plaat gebaseerde normalisatie.

Dit protocol geeft de mogelijkheid om een ​​groot aantal genen (~ 2500 per week) screenen op hun vermogen om een ​​reportergen transactiveren met minimale mankracht (1-2 personen) en minimale kosten (ongeveer $ 3 reagens kosten per microtiterplaat test). Transcriptiefactoren van neuronale genen (bijvoorbeeld alfa-synucleïne), die moeilijk te bestuderen in gekweekte neuronen vuurvaste genetische manipulatie kan worden vergeleken side-by-side in deze directe functionele test. We nemen in onzeprotocol een gedetailleerde methode voor het klonen en de groei van plasmiden die de alfa-synucleïne promotor, omdat we vonden dat plasmiden die deze regio zijn instabiel wanneer ze groeien met conventionele procedures (zie Discussie). We gebruiken ook een goedkoop alternatief voor handel verkrijgbare dubbele luciferase reagentia voor high-throughput assays. Dit protocol kan gemakkelijk worden aangepast aan andere regelelementen van belang richten, of voor een werkwijze die een hoge-doorvoer transiënte transfecties.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Voor een experimentele overzicht, zie figuur 1.

1. Bereid Reporter plasmiden die de Alpha-Synuclein Promoter

Regelelementen van het alfa-synucleine gen (Figuur 2) omvatten ongeveer 10 kb, van de stroomopwaartse NACP (niet-A beta component van amyloïde peptide) dinucleotide herhalingssequentie 1,2 tot intron 2 3. We nemen een deel van deze regio onze reporter construct. Wij vonden dat de plasmiden die intron 2 vereist speciale procedures voor de groei, zoals hieronder beschreven. De luciferase plasmiden, pGL4.10 en pGL4.75 (figuur 3), zijn commercieel verkrijgbaar van Promega en kan worden vermeerderd met behulp van conventionele moleculaire biologie protocollen.

  1. Versterken de 2 componenten van het alfa-synucleïne promotor in afzonderlijke PCR's met het recept in tabel 1 en de primers in Tabel 2.
  2. Verify PCR-producten op een agarose gel en schoon met de Qiaquick PCR Purification Kit (Qiagen), en geëlueerd in 50 pl TE (Tris-EDTA). Bewaar de geëlueerde 0,9 kb fragment bij -20 ° C voor toekomstig gebruik.
  3. Digest het gehele volume van het 3,4 kb PCR-fragment, en 5 ug pGL4.10 met SacI en XhoI. Behandel de vector met Kalf Darm alkalisch fosfatase (Roche) en gel te zuiveren met behulp van de PureLink Quick Gel Extraction Kit (Invitrogen).
  4. Ligeren fragment en de vector met T4 DNA ligase (NEB). Reinig de voltooide reactie met behulp van de PCR PureLink Micro kit (Invitrogen), eluting in 10 pi TE-buffer.
  5. Transformatie 2 pi van de gereinigde, ligatiereactie in 20 ui ElectroMAX Stbl4 competente cellen (Invitrogen) en elektroporatie volgens de instructies van de fabrikant. Schud in een 30 ° C incubator bij 225 rpm gedurende 90 minuten. Spread 2 volumes op LB-platen bevattende 100 mg / ml ampicilline en incubeer bij 30 ° C gedurende 2 dagen.
  6. Met behulp van een tandenstoker, selecteer 4-6 kleine kolonies voor enting in 2 ml van TB (Terrific Broth). Groeien deze miniprep culturen in een 30 ° C shaker O / N.
  7. Zuiver plasmide-DNA van 1,5 ml van elk miniprep cultuur met behulp van de PureLink HiPure Plasmid Miniprep kit (Invitrogen).
  8. Digest de minipreps met BamHI en Electrophorèse op een agarosegel. De correcte kloon moet fragmenten van 2,8 kb en 4,9 kb produceren.
  9. Restreak de resterende miniprep cultuur van de juiste kloon op een verse LB (Luria Broth) plaat en groeien bij 30 ° C gedurende 2 dagen.
  10. Selecteer een kleine kolonie en te enten een 1,5 ml TB zuursel. Schud O / N bij 30 ° C. Laat de starter cultuur groeien tot verzadiging.
  11. Verdun de gehele starter cultuur in 150 ml voorverwarmd TB en schudden bij 30 ° C gedurende 2 dagen. Alvorens over te gaan naar de volgende stap, gebruik 1,5 ml van deze cultuur voor een extra miniprep en de spijsvertering te bevestigen dat de kloon niet muteren tijdens replicati op.
  12. Zuiver plasmide DNA van de resterende cultuur met behulp van de PureLink HiPure Plasmid Maxiprep kit (Invitrogen). Verwachte opbrengsten van deze intermediaire plasmide zijn 50-150 mg per 150 ml van de cultuur.
  13. Ontdooi de 0,9 kb fragment in stap 1.2 bevroren. Herhaal stap 1.3 tot 1.12 de 0,9 kb fragment te kloneren in de intermediaire plasmide digestie plaats met Kpnl en Sacl. Ligeer, transformeren, selecteren en kweken voor maxipreps als hierboven. Digestie met BamHI moet fragmenten van 5,8 kb en 2,8 kb opleveren. Dit is het plasmide dat wordt gebruikt voor het scherm.

2. Bereid 293T cellen, reporterplasmiden en Bibliotheek DNA voor Screening

293T cellen worden geënt in 96-well uitgeplaat en de volgende dag. Reporter plasmiden en DNA bibliotheek worden verdund in 96-wells platen. We verkregen platen van transfectie-grade bibliotheek DNA uit het DNA Kern van het Massachusetts General Hospital (krijgen = "_blank"> dnacore.mgh.harvard.edu). Dit protocol transfects een bibliotheek plaat in 2 identieke platen van 293T-cellen (Figuur 1), zou dus 2 platen van cellen gezaaid voor elke bibliotheek plaat worden gescreend.

Opmerking: Kweek cellen in medium zonder fenol rood of antibiotica, zoals deze functies de luciferase assays en verhogen toxiciteit tijdens transfectie, respectievelijk.

  1. Voor elke plaat bibliotheek te screenen, resuspendeer getrypsiniseerd 293T cellen tot een concentratie van 1,5 x 10 5 cellen / ml in DMEM met 14% FBS. Giet in een steriele reservoir (Axygen).
  2. Plaats het reservoir 2 heldere bodem en 96 putjes (Corning), en een doos filter pipetpunten (Agilent) op de robot dek. Pipetteer 100 ul cellen in elk putje van twee platen, een dichtheid van 1,5 x 10 4 cellen per putje.
  3. Centrifugeer de cellen platen bij 50 xg gedurende 2 minuten, met lage helling snelheden van waarborgenceldichtheid gedurende elk putje. Incubeer bij 37 ° C en 10% CO2 O / N.
  4. Verdun de vuurvlieg en Renilla reporterplasmiden tot 5 ng / ul in serumvrij medium. Combineer de verdunningen in een verhouding van 05:03 tot vuurvlieg Renilla plasmide (in volume) in een 15 ml conische buis.
  5. Pipet de gecombineerde plasmiden in elk putje van een 96-well plaat, doseren 17 ul per bibliotheek plaat, plus 2-10 ul overtollige, in elk putje.
  6. Verkrijgen transfectie-grade DNA-bibliotheek platen zoals hierboven en verdun tot 13,3 ng / ul met endotoxine-vrij water. Het minimale volume per putje moet 28 pl.

3. Voer Transfecties

Op dag 2 van het scherm, worden reporterplasmiden en bibliotheek DNA getransfecteerd in 293T-cellen.

  1. Voor elke bibliotheek plaat, meng 107.5 pl RT Optifect (Invitrogen) met 4,3 ml serumvrij medium (1:40 verdunning) in een polystyreen buis. Incubeer gedurende 5 minuten bij kamertemperatuur, enn afzien 44 pi (per bibliotheek plaat) in elk putje van een 96-well, polystyreen V-bodem plaat (Greiner).
  2. Plaats de plaat van verdunde Optifect, reporterplasmiden (Stap 2.5), bibliotheek DNA's (Stap 2.6), en een doos met pipet tips over de robot dek.
  3. Aspireren 17 ul van reporterplasmiden, 43 pl verdund Optifect, en 26 ul van DNA-bibliotheek, het invoegen van een 5 pl luchtspleet tussen elke aspiratie. De bibliotheek DNA moet als laatste worden opgezogen om kruisbesmetting te voorkomen. Doseer de inhoud van de tips in een nieuwe polystyreen met V-vormige plaat, mengen, deksel, en zet opzij voor 20 min om lipide / DNA-complexen te vormen. Als transfecteren meerdere bibliotheek platen, vervang dan de pipet tips en bibliotheek plaat, en herhaal.
  4. Ontdek de Optifect / DNA mengsel bord en plaats het op de robot dek met 2 pitten van 293T-cellen. Met behulp van een enkele doos van pipet tips, aspireren 80 ul van de Optifect: DNA mengsel en langzaam afzien 40 pi op elke plaat van cellen. Als transonverminderd meerdere bibliotheek platen, herhaal voor alle Optifect: DNA platen. Bedek cellen.
  5. Centrifugeer de cellen platen bij 1200 xg gedurende 30 minuten. Bedek en ga terug naar de incubator.
  6. Incubeer de cellen gedurende 4-6 uur. Tijdens deze incubatie bereid vers medium door het mengen van 12 ml DMEM met 10% FBS en 10 ug / ml ciprofloxacine (Cellgro) voor elke bibliotheek getransfecteerde plaat. Giet verse media in een steriele reservoir.
  7. Plaats 2 dozen van robot tips, een enkele plaat van cellen, het reservoir met vers medium, en een verspilling reservoir op de robot dek. Aspireren 100 ul van de media uit de cellen en afzien in het afval reservoir gedeeltelijk gevuld met 70% ethanol. Met verse tips, aspireren 100 ul vers medium en langzaam afgeven op de cellen. Herhaal dit voor alle platen van cellen.
  8. Terug platen in de incubator gedurende 48 uur.

4. Voer Dual-luciferasetests

Op dag 4 van het scherm, devuurvlieg en Renilla luciferasetests worden uitgevoerd.

Opmerking: de dual-luciferase assay vereist de sequentiële toevoeging van 2 assay buffers, 3X vuurvlieg testbuffer en 3x Renilla testbuffer, zoals beschreven in Tabel 3 Firefly en Renilla luciferasen niet uitgescheiden, waardoor cellen worden gelyseerd voor het meten van luciferase-activiteit. . Firefly assay buffer lyseert cellen en zorgt substraat voor de vuurvliegluciferase; Renilla proefbuffer lest de vuurvlieg signaal en voorziet substraat voor de Renilla luciferase.

  1. Voor elke bibliotheek plaat, bereiden 8 ml 3X vuurvlieg proefbuffer uit voorraad oplossingen zoals beschreven in Tabel 3, en afzien van 82 ul in elk putje van een 96-well-V-vormige plaat.
  2. Voor elke bibliotheek plaat, ook bereid 12 ml 3X Renilla testbuffer en verdeel 122 pl in elk putje van een 96-well V-vormige plaat. Gereserveerd zowel devuurvlieg en Renilla assay buffers.
  3. Plaats een doos met pipet tips, een afvalreservoir, en 2 pitten van cellen (getransfecteerd van dezelfde bibliotheek plaat) op de robot dek.
  4. Aspireren 60 ul van de media van elke plaat en gooi het afval reservoir gedeeltelijk gevuld met 70% ethanol. Afdekplaten en zet apart. Als transfecteren meerdere bibliotheek platen, herhaal voor alle sets van platen.
  5. Plaats 2 dozen van pipet tips, de plaat van 3X vuurvlieg assay buffer, en een set van platen staan ​​op de robot dek.
  6. Aspireren 40 pl 3X vuurvlieg assay buffer en voeg deze toe aan de eerste plaat van cellen, grondig mengen. Omschakelen naar een nieuwe pipet tips, herhaal voor de tweede cel plaat. Plaats cellen bij kamertemperatuur gedurende 10 minuten tot lysis te voltooien. Als transfecteren meerdere bibliotheek platen, vervang dan de dozen van tips en celplaten, en herhaal.
  7. Record luminescentie uit elk putje van elke cel plaat op een lichtmeter, opname voor 1 sec per well. Terug platen de robotdek.
  8. Plaats 2 dozen van pipet tips, de plaat van 3X Renilla assay buffer, en een set van platen staan ​​op de robot dek.
  9. Aspireren 60 ul van 3X Renilla assay buffer, en voeg deze toe aan de eerste plaat van cellen, grondig mengen. Overschakelen naar een nieuwe doos van pipet tips, herhaal voor de tweede cel plaat. Als transfecteren meerdere bibliotheek platen, herhaal voor alle sets van celplaten.
  10. Record luminescentie van alle platen op een lichtmeter, het opnemen van elk goed voor 1 sec als hierboven. Gooi platen.

5. Data Analysis

  1. Bereken de vuurvlieg: Renilla luminescentie ratio ("F: R-verhouding") voor elk putje door het verdelen van de graven van vuurvlieg signaal door de graven van Renilla signaal.
  2. Bereken de inductie waarde door deling van het F: R verhouding van elk putje van de gemiddelde F: R verhouding van de plaat, de hoogste en laagste 25% van de putjes.
  3. Het gemiddelde van de inductie waarden over replicavoor een enkele getransfecteerde bibliotheek plaat. Genen induceren of onderdrukken van alfa-synucleïne meer dan drie plooien worden beschouwd als "hits" in dit scherm en zijn onderhevig aan verdere validatie en secundaire beeldschermen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Typische luciferase waarden F: R verhoudingen en inductie waarden voor een halve plaat worden getoond in figuur 4 Merk de hit in goed H2, een 32-voudige inductor.. Genen veroorzaken overmatige toxiciteit (bijvoorbeeld goed E3), of putten die slecht werden getransfecteerd, zullen lage waarden voor zowel de vuurvlieg en Renilla luciferases produceren, maar een gemiddelde inductie waarde. Genen waardoor niet-specifieke inductie van luciferaseactiviteit, bijvoorbeeld via interactie met de pGL4 ruggengraat zullen vuurvlieg en Renilla luciferasen induceren even, resulterend in een gemiddelde waarde inductie. Grote verschillen in inductie waarden tussen herhalingen moet vermoeden voor de uitvoering fouten opleveren. Het is belangrijk om te controleren of het scherm wordt uitgevoerd binnen het lineaire bereik van de reporter assays zodat klonen die verhoogde expressie veroorzaakt wordt gemeten als verhoogde luciferaseactiviteit. We getransfecteerde toenemende hoeveelheid van elk reporter gen de lineariteit validerenvan de reporter assay onder onze experimentele omstandigheden (Figuur 5). Het is ook belangrijk om de testen snel uitgevoerd na de incubatiestap niet-lineariteit voorkomen door substraat depletie. Wij namen significant vuurvlieg luciferase activiteit tot 1 uur na toevoeging van reagentia (figuur 6).

Figuur 1
Figuur 1. Experimentele overzicht. Elk enkele plaat van de bibliotheek DNA wordt gecombineerd met 2 reporterconstructen en gebruikt om dubbele platen van cellen transfecteren. Na 48 uur wordt de activiteit van elke luciferase reporter achtereenvolgens gemeten. De specifieke inductie van de SNCA promotor plasmide door elke bibliotheek plasmide wordt berekend door de verhouding van vuurvlieg om Renilla luciferase na-plaat gebaseerde normalization.

Figuur 2
Figuur 2. Schematische van het 5'-gebied van alfa-synucleïne (SNCA), gelegen op chromosoom 4, in de vuurvlieg reporterplasmide. Primer komen overeen met sequenties in tabel 2. Hatch markeringen geven een ongeveer 8 kb segment geëlimineerd uit de figuur anders op schaal. Het ATG startcodon voor SNCA ligt in exon 3.

Figuur 3
Figuur 3. Luciferase reporter plasmiden die in dit onderzoeksprotocol. SNCA zijn de genomische gebieden gekloneerd in de meervoudige kloneringsplaats van pGL4.10 onmiddellijk stroomopwaarts van de vuurvliegluciferase. Een plasmide met de hCMV-IE1 (humaan cytomegalovirus directe vroege 1) promoter expressie van Renilla luciferase werd gebruikt als een interne controle. Beide plasmiden zijn commercieel verkrijgbaar van Promega.

Figuur 4
Figuur 4. Representatieve resultaten voor de helft van een 96-well plaat. A. Ruwe vuurvlieg luciferase tellingen B. ruwe Renilla luciferase telt C. F:.. R verhoudingen berekend door de waarde in A te delen door de waarde B. D. Inductie waarden voor elk putje, berekend door elke F: R verhouding Door de gemiddelde F:. R verhouding van de plaat, zonder de bovenste en onderste 25% van de putjes E. Grafische weergave inductie waarden een enkele plaat, met goed H2, een positieve hit, gemarkeerd. Hit H2 is een neuronale transcriptiefactor niet eerder verbonden aan SNCA expressie. Klik hier om een grotere afbeelding te bekijken .

Figuur 5
Figuur 5. Lineariteit assays. Cellen werden met toenemende hoeveelheden vuurvlieg en Renilla luciferase plasmiden onder de controle van de hCMV-IE1 sterke promotor en onderzocht het protocol hierboven. (Totale hoeveelheid getransfecteerd DNA werd constant gehouden door toepassing van een neutrale balancer plasmide). A. Firefly lineariteit assay. Merk op dat vuurvlieg activiteit blijft lineair via een breed scala van waarden. B. Renilla lineariteit test. Let op de afvlakking van de curve boven 15 ng / putje.

ntent "fo: keep-together.within-page =" altijd "> Figuur 6
.. Figuur 6 Tijdsverloop van verval signaal vuurvlieg luciferase assay Luciferase reagentia werden toegevoegd aan een enkele plaat getransfecteerd met CMV-luciferase construct op tijdstip 0; seriële metingen werden uitgevoerd zonder toevoeging van andere reagentia.

Bestanddeel Volume Eindconcentratie
BAC 2002-D6 bij 5 ng / ul 4 pl -
5X Phusion GC Buffer 20 gl 1X
DMSO 6 pl 6%
dNTPs (10 mm) 2 pi 200 uM
Forward Primer (100 uM) 1 pi 10 uM
REverse Primer (100 uM) 1 pi 10 uM
DDH 2 O 65 pl -
Phusion DNA Polymerase 1 pi -
Er werden 100 gl

Tabel 1. PCR set-up voor het versterken van de alfa-synucleïne promoter.

Naam Sequentie Beperking Site
SNCA7 5'-GTC ggtacc tgaagttaacctcccctcaatacc-3 ' Kpnl
SNCA8 5'-TGC aagaagacagccatctgcaagcc GAGCTC-3 ' Sacl
SNCA1 5'-tct tctgagcatttccctaggtg GAGCTC-3 ' Sacl
SNCA2 5'-tag CTCGAG ggctaatgaattcctttaca-3 ' Xhol

.. Tabel 2 Primers voor het versterken van de alfa-synucleïne promotor De NACP Repeat amplicon moet een 0,9 kb fragment te produceren; de andere amplicon lengte is 3,4 kb. Voor primer locaties, zie figuur 2.

A: 3X Firefly Assaybuffer
Stock Solutions (bewaar bij -80 ° C) Volume per 100 ml 3X Firefly Testbuffer Eindconcentratie (3X)
500 mM DTT 3,0 ml 15 mM
10 mM coenzym A 6,0 ml 0,6 mM
100 mM ATP 0,45 ml 0,45 mM
80 mg / mlluciferin 0.525 ml </ Td> 4,2 mg / ml
Triton lysisbuffer 90,025 ml -
B. Triton Lysis Buffer
Component (winkel bij RT) Volume per 100 ml Triton Lyseerbuffer Eindconcentratie
Tris-HCl poeder 1.705 g 0,1082 M
Tris-base poeder 0.508 g 0,0419 M
5 M NaCl 1.50 ml 75 mM
1 M MgCl2 0,30 ml 3 mM
Triton X-100 zuivere vloeistof 0.75 ml 0.25%
Water 100 ml totaal volume -
C. 3X Renilla Testbuffer
Volume per ~ 100 ml 3X Renilla Testbuffer Eindconcentratie (3X)
10 mM PTC124 in DMSO 0,6 ml 0.06 mM
2 mM h-CTZ in ethanol 0,5 ml 0.01 mM
Renilla Zouten 100 ml -
D. Renilla Zouten
Component (winkel bij RT) Volume per 100 ml Renilla Zouten Eindconcentratie
0,5 M Na2EDTA 9.0 ml 45 mM
Na Pyrophosphate 1,34 g 30 mM
NaCl 8,33 g 1.425 M
Water 100 ml totaal volume -

Tabel 3. Stock oplossingen en test buffers voor de vuurvlieg en Renilla luciferasetests. A. 3X vuurvlieg proefbuffer recept. DTT, dithiotreïtol. Tenzij anders vermeld, alle componenten zijn oplosbaar in water. B. Triton lysisbuffer recept. C. 3X Renilla testbuffer recept. h-CTZ, h-coelenterazine. Voeg 2 mM h-CTZ door 10 mg h-CTZ 12,2 ml 100% EtOH en 120 pi geconcentreerd HCl. PTC124 is oplosbaar in DMSO. D. Renilla zouten recept. Triton lysisbuffer en Renilla zouten zijn stabiel gedurende verscheidene weken bij 4 ° C en kamertemperatuur, respectievelijk. 3X vuurvlieg testbuffer en 3x Renilla testbuffer worden gemengd binnen 3-4 uur uitvoeren van de luciferase assay.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Alpha-synucleïne is betrokken bij de ziekte van Parkinson (PD) als component van Lewy lichamen 4, intracellulaire inclusies beschouwd pathognomonische voor de ziekte. Tal van genoom-brede associatie studies hebben single nucleotide polymorfismen gekoppeld aan alfa-synucleïne met een verhoogd risico voor sporadische PD 5,6,7. Hoewel minder algemeen dan sporadische PD, kan familiale PD ook worden veroorzaakt door mutaties in alfa-synucleine 8, en dubbel en triplicatie van de alfa-synucleïne locus 9,10,11, een fenomeen ook gezien bij sporadische PD 12. Tezamen bieden deze studies versterken de centrale rol van alfa-synucleïne bij de pathogenese van PD. Het doel van dit onderzoek was om genen die alfa-synucleine worden vereenvoudigd en daardoor een rol spelen bij de pathogenese van de ziekte van Parkinson. Met behulp van dit protocol, gescreend we 7670 menselijke genen en geïdentificeerd 154 voorlopige resultaten (minstens 3 maal inductoren), wat neerkomt op 140unieke genen. Deze hits werden onderworpen aan secundaire analyses met behulp van nieuwe DNA-preparaten om hit reproduceerbaarheid te bepalen. Hits in de 3-voudig bereik opgenomen in 28% latere luciferase assays. Reproduceerbaarheid verhoogd tot 59%, 69% en 78% in 4 -, 5 - en 5-voudige inductoren, respectievelijk. Klappen met inducties dan 7-voudig gereproduceerd 100% van de tijd. We uiteindelijk geïdentificeerd 68 nieuwe regulatoren van alfa-synucleïne transcriptie.

Verschillende feiten suggereren dat de 68 klappen kregen we zijn echte regulatoren van alfa-synucleïne. Onze lijst van geïdentificeerde treffers omvat GATA3, een lid van de familie van GATA transcriptiefactoren eerder is aangetoond dat SNCA expressie 3 reguleren. Scoren een van de weinige bekende SNCA toezichthouders geeft veel vertrouwen in de betrouwbaarheid van ons scherm. Daarnaast hebben we onafhankelijk gescoord met schiet verschillende leden van dezelfde familie van neuronale transcriptiefactoren, wat suggereert dat het scherm niet reproduceerbaar en identificatie van genenwillekeurig. Belangrijker nog, in extra follow-up testen, het vermogen van onze top raakt aan endogene SNCA expressie in neuronale cellen werd gevalideerd in overexpressie en knock-down assays reguleren. We overexpressie een paar van de top raakt behulp BacMamvectors 3 in SY5Y dopaminerge cellen en waren in staat om endogene SNCA verhogen 2-8 vouwen, terwijl shRNA knockdown van deze hits geresulteerd in een afname SNCA mRNA niveaus. Deze studies onomstotelijk aantonen dat onze top hits zijn regulatoren van endogene SNCA niveaus en zijn niet alleen voorwerpen van het gedeconstrueerd luciferase systeem. Extra follow-up studies voor andere treffers nodig zal zijn om de ware vals-positieve en fout-negatieve uitslagen voor de volledige lijst met hits in ons scherm te bepalen. Een volledige beschrijving van de treffers en hun relatie met de ziekte van Parkinson in bereiding 14.

Het is belangrijk om de beperkingen van onze screening methode te bepalen. Het moet worden obvschuldbekentenissen dat het scherm eventuele toezichthouder niet zou identificeren niet in de screening bibliotheek. Terwijl onze screening bibliotheek was aanzienlijk, met ongeveer een vierde van het menselijk genoom, het was niet volledig. Gezien de eenvoud van onze test, kunnen extra bibliotheken worden gescreend met gemak. We verhoogden het aantal genen gescreend op een gerichte manier door het opnemen paralogen hits, indien beschikbaar, in onze secundaire analyses. Wij zouden ook niet scoren bij elke treffer die buiten die welke zijn opgenomen in onze reporter construct gebonden aan genomische regio. Om de kans inclusief de juiste regio maximaliseren onze reporter bevatte de onmiddellijke flankerende sequenties voor de meerdere transcriptiestartplaatsen in de SNCA promoter. Het is waarschijnlijk dat andere factoren binden aan gebieden ver buiten de directe promotorgebied om SNCA expressie reguleren. Deze kunnen worden gedetecteerd door het uitvoeren schermen met bijkomende stroomopwaartse en stroomafwaartse gebieden, indien gewenst, hoewel slechts ~ 10 kb tegelijk kan eenssessed op deze wijze door beperkingen op efficiënte kloneren in plasmide vectoren en de stabiliteit van het hoog kopieaantal pGL4 vectoren. Als alternatief zou het luciferase construct worden ingebouwd in BAC DNA's die de SNCA locus. Een nadeel van deze benadering is dat transfectie van BAC zelfs onder ideale omstandigheden is> 100-voudig minder efficiënt dan plasmiden 15. Een andere benadering zou zijn om "knock-in" de luciferase reporter in de endogene locus SNCA, een methode die veel omslachtiger dan onze werkwijze. We zouden ook niet scoren elke treffer die reeds expressie op niveaus verzadigen zodat overexpressie niet leidt tot verhoogde luciferaseactiviteit. Daarom kozen we niet-neuronale 293T cellen, die wellicht niet neuronale factoren die de SNCA, en inderdaad hebben we scoren een aantal neuronale transcriptionele factoren gebruiken. Een potentieel nadeel van 293T-cellen is echter dat wij elk gen misschien scoor een treffer indien nodig eenbijkom neuronale factoren om goed te functioneren. Dus, net als alle schermen, onze studie kunnen een aantal potentiële SNCA toezichthouders missen. Echter, in de praktijk, de 68 klappen kregen we toename van het aantal bekende regulatoren van SNCA met meer dan 10-voudige en vergt jaren werk op te volgen, zodat overige treffers misschien niet nodig in ons geval.

Het is ook belangrijk om de mogelijke artefacten die kunnen voorkomen met deze methode te realiseren. In chemische schermen, luciferase is berucht voor artifactually scoren verbindingen door stabilisatie van de luciferase-eiwit in plaats van door inductie van transcriptie. Om uit te sluiten eiwitstabilisatie artefacten, gescreend we treffers in vergelijking met een aantal andere promotor-luciferase constructen en leverde geen treffers die kennelijk post-transcriptioneel handelen door het opvoeren van de expressie van constitutieve promotors vinden. Een andere mogelijke artefact kan een transactiverende factor die bindt aan de pGL4 vector backbone dan welde SNCA promotor. We gebruikten de pGL4 vector die is uitgebreid gemutageni om transcriptiefactorbindingsplaatsen om dit probleem te vermijden verwijderen. Om te beoordelen of een van onze treffers nodig de vector backbone voor inductie, gebruikten we PCR om de SNCA-luciferase vector regio zonder enige ruggengraat versterken en gebruikt deze lineaire fragment als verslaggever voor secundaire analyses. We vonden geen significant verschil in inductie waarden tussen onze volledige plasmide verslaggever en de lineaire-backbone gratis construct met een uitzondering. GATA2 toonde ~ 15-voudige inductie met het reporter plasmide, maar ~ 2,7 maal de lineaire reporter, suggereert dat sommige GATA2 inductie kan worden door binding aan backbone componenten.

Een aantal andere methoden om transcriptiefactoren te identificeren zijn beschreven. Bijna 30 jaar geleden, het in kaart brengen van cis-werkende transcriptionele controle elementen in sterke virale promotors via getransfecteerd reporter genexpressie werd established 16. Deze methode, soms aangeduid als "promotor bashing," is uit de gratie geraakt voor het in kaart brengen van de cel-type-specifieke promotors want het is moeilijk te verkrijgen en transfecteren geschikte primaire cellijnen, en dergelijke lijnen kunnen niet nauwkeurig hun weefsel van oorsprong vertegenwoordigen. De gist een-hybride systeem 17 omzeilt dit probleem door middel van een gedeconstrueerd reporter systeem om interacties tussen een bibliotheek van fusie-genen en een specifieke cis-werkende element te detecteren. Onze aanpak lijkt op de gist een-hybride systeem in zijn werkgelegenheidsbescherming ontwerp, maar ons systeem we gebruiken normale expressie klonen plaats genfusies we gebruik zoogdiercellen in plaats van gist en we robotica die zij-aan-zij kwantitatief kan dienst functionele uitlezingen voor elke test gen. Een veelbelovende methode genoemd proteomics van geïsoleerde chromatine segmenten (PICH) waarmee identificatie van eiwitten gebonden aan genoom-regio is 18 beschreven, maar is nog nietsucces toegepast op losse-menselijke genen. Genoom-brede chromatine immunoprecipitatie (ChIP-seq en chip-chip) studies zijn gebruikt om cis-werkende regio's te identificeren op een grote schaal 19. Deze methode is potentieel krachtig, maar, zoals Pich kan minder nuttig voor celtypes zoals specifieke neuronale populaties die niet gemakkelijk worden verkregen homogene cultuur. Bovendien, wanneer we ChIP databases hebben ingecheckt voor onze gevalideerde hits, ze hebben geen binding van deze hits aan de SNCA promotor getoond. De reden hiervoor is niet duidelijk, omdat we in staat de binding van deze factoren om SNCA promoter door gebruikelijke ChIP 14 aantonen zijn; maar het kan door het ontbreken van de gehele SNCA promotorgebied worden toegepast bij studies met microarray chip uitlezingen (ChIP-chip). Pich, ChIP-seq, en andere proteoomanalyses kunnen daarom vooral handig wanneer gekoppeld aan de directe functionele uitlezingen dat onze methode genereert.

Dual-luciferasebepalingen waarbij vuurvlieg en Renilla luciferases bieden een gevoelige methode voor het bestuderen van vele intracellulaire processen in high-throughput formaat 20. De fusie van een doel promotor vuurvlieg luciferase is gebruikt om de transcriptionele regulatie en promotor structuur van talrijke doelen in vitro, waaronder alfa-synucleïne 1,2 bestuderen. We ontwikkelden een goedkoop alternatief voor handel verkrijgbare dubbele luciferase reagentia die stabiel signaal ontvangen en was lineair in het bereik van onze assay (figuur 6). Onze methode wordt aangepast van een protocol genereus geleverd door Ron Johnson bij NIH en eerder beschreven niet-commerciële dual-luciferase assay 21. De vuurvlieg assay buffer lyseert cellen en zorgt voor ATP en luciferin, de substraten van vuurvliegluciferase. Deze test levert een gloed reactie met een halfwaardetijd van ongeveer 1 uur (Figuur 7). De Renilla proefbuffer lest de fireflY-signaal en zorgt voor de juiste ondergrond (coelenterazine). Merk op dat de Renilla testbuffer zelf geen cellen lyseren en moet gebruikt worden in combinatie met ofwel Triton lysisbuffer of vuurvlieg assaybuffer. We vonden dat eerder beschreven Renilla assay buffers gemakkelijk neergeslagen bij kamertemperatuur, waardoor we geëlimineerd natriumsulfaat en verminderde de hoeveelheid natrium pyrofosfaat met 60%. De assay omvat ook PTC124, een krachtige remmer van vuurvlieg luciferase 22 dat aanvullende afschrikken bijdraagt ​​in de assay. Afschrikken activiteit ook door EDTA, NaCl, en pyrofosfaat in de Renilla buffer. Met deze nieuwe formuleringen, wordt ongeveer 99,5% van vuurvlieg activiteit geblust door Renilla buffer. De intensiteit en de reproduceerbaarheid van zowel vuurvlieg en Renilla luciferase signalen enigszins verbeterd door mengen na de toevoeging van de buffers (Stappen 4.6 en 4.10).

In onze ervaring, de complete eenlpha-synucleïne promoter in pGL4.10 uniek moeilijk te versterken en te klonen, misschien als gevolg van GC-rijke regio's en complexe secundaire structuur in intron 2. We waren het meest succesvol met STBL4 competente cellen, die zijn geoptimaliseerd voor het klonen van instabiele inserts. Zelfs na deze voorzorgsmaatregelen, we regelmatig hersteld van een mutant waarin E. coli genoom DNA werd in het 3 'uiteinde van het construct. Deze mutant ontstaat banden van ongeveer 5,8 kb en 4 kb wanneer gedigereerd met BamHI (versus 5,8 kb en 2,8 kb in de juiste kloon) en weergegeven als grotere kolonies op selectieve platen. Zorgvuldige groei van competente cellen bij 30 ° C en het voorkomen culturen bereiken verzadiging afneemt, maar niet elimineren, de waarschijnlijkheid van het winnen van het mutant. Wij raden het controleren van de zuiverheid van alle DNA-preparaten door restrictiedigest en gel-elektroforese voor transfectie.

Het onderzoeksprotocol wordt gemakkelijk aangepast aan andere promotoren, eend dienovereenkomstig worden geoptimaliseerd, met positieve en negatieve controles genen bekend bij de doelgroep promotor reguleren. Verschillende overwegingen gelden voor de klonering en transfectie van reporter plasmiden. Het klonen van het doel promoter in het vuurvlieg luciferase reporter plasmide, moet de startplaats van de luciferase de translationele startplaats in het doelgen benaderen. Dual-luciferase schermen plaatsen typisch de Renilla plasmide onder controle van een minimale promotor, zoals de HSV-tk promotor, de effecten van de plasmide ruggengraat minimaliseren. Toch vonden we dat een van onze positieve controles veroorzaakte deze promotor, dus hebben we gekozen voor de CMV-promoter. De relatieve hoeveelheid van elke reporter plasmide moet empirisch worden bepaald en wordt beïnvloed door de constitutieve activiteit van elke promoter. Ideaal basislijn (getransfecteerd, maar niet geïnduceerde) luciferase tellingen moet ten minste vijf tot tien keer over achtergrond van getransfecteerde cellen, om detectie van librar toestaany genen die onderdrukken of dat teweegbrengt, wat zal resulteren in een lagere signaal. Voorafgaand aan de screening, controleer dan verwacht luciferase tellingen binnen het lineaire bereik van elke assay vallen, dat kan verschillen per luminometers. (Merk op dat onze Renilla telt meestal vallen in het boveneinde van het lineaire gebied in onze assay.) We vonden dat het verhogen van de verhouding van bibliotheek DNA vuurvlieg reporterplasmide tot hogere inducties, dus gebruikten we de minimale hoeveelheid van de reporter.

Het transfectie protocol moet ook worden geoptimaliseerd. We kozen 293T cellen voor hun relatieve gemak van transfectie, waarvan de efficiëntie verhoogd 50-voudig met de toevoeging van een centrifugatie stap (stap 3.5). De dopaminerge lijn SY5Y dan 100-voudig minder transfecteren in onze handen, en, zoals hierboven besproken, niet optimaal voor het uitvoeren overexpressie screening. Onze optimale assay tijd werd empirisch bepaald om 48 uur zijn, dus onze cellen werden met een lage initiële dichtheid, In het gebruik van Optifect, die is ontworpen om cellen te transfecteren bij 10-70% confluentie. Andere cellijnen kunnen verschillende uitgangspunten dichtheden en verschillende transfectiereagentia vereisen. We kozen ervoor om de cel media veranderen na transfectie tegen antibiotica (waarbij toxiciteit kunnen veroorzaken indien aanwezig tijdens transfectie) toe te voegen. Hoewel dit vermindert de kans op bacteriële besmetting, het verhoogt de kosten van materialen (vooral robot pipetpunten), waardoor de noodzaak van deze stap moet worden beoordeeld bij de aanpassing van dit protocol andere systemen. De luciferase tests kunnen worden gebruikt met minimale optimalisatie, maar voordat deze test in high-throughput met een ander celtype, controleert cellen adequaat worden gelyseerd door Triton lysisbuffer. Merk op dat Triton X-100 veroorzaakt coelenterazine autofluorescentie. De Renilla signaal in onze test was sterk genoeg hiertoe trivialize, maar bij het ​​optimaliseren van deze assay voor andere celtypen, beperken Triton X-100 volumes de minimal bedrag dat nodig is voor cellysis.

We hebben een snelle en relatief goedkope screeningswerkwijze gepresenteerd voor het identificeren van nieuwe transcriptionele regulatoren van alfa-synucleïne in cuvetten voorbijgaand getransfecteerd met een dual-luciferase reporter systeem. Dit protocol is gemakkelijk aanpasbaar aan andere genen van belang richten en kan worden aangepast voor elke toepassing die hoge doorvoer transfecties zoals lentivirus productie 23.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Dit werk werd ondersteund door de royalty's verkregen door vergunningverlenende BacMamreagents (Amerikaans octrooi 5.731.182).

Acknowledgements

Wij danken John Darga van de MGH DNA Core voor de bereiding van de DNA-screening bibliotheek. Christopher Chigas van Perkin Elmer voorzien onschatbare steun voor onze Wallac 1420 lichtmeter. Steven Ciacco en Martin Thomae van Agilent steun verleend voor de Bravo robot. Wij danken Ron Johnson en Steve Titus bij de NIH voor royaal verstrekken van hun dual-gloed luciferasetest protocol.

Materials

Name Company Catalog Number Comments
Material
QIAQuick PCR Purification Kit Qiagen 28106
PureLink Quick Gel Extraction Kit Invitrogen K2100-12
PureLink PCR Micro Kit Invitrogen K310250
PureLinkHiPure Plasmid Miniprep Kit Invitrogen K2100-03
PureLinkHiPure Plasmid Maxiprep Kit Invitrogen K2100-07
Bravo Robot Agilent -
Robot Pipet Tips with Filter Agilent 19477-022
Robot Pipet Tips without Filter Agilent 19477-002
Clear-bottomed 96-well Plates Corning 3610
Reservoirs Axygen RES-SW96-HP-SI
Polystyrene V-bottomed 96-well Plate Greiner 651101
Polypropylene V-bottomed 96-well Plate Greiner 651201
Adhesive Plate Covers CryoStuff #FS100
Reagent
Phusion DNA Polymerase New England Biolabs M0530L
BAC 2002-D6 Invitrogen 2002-D6
Calf Intestine Alkaline Phosphatase Roche 10713023001
T4 DNA Ligase New England Biolabs M0202L
pGL4.10 Promega E6651
pGL4.74 Promega E6931
ElectroMAX Stbl4 Competent Cells Invitrogen 11635-018
Subcloning Efficiency DH5α Competent Cells Invitrogen 18265-017
DMEM without Phenol Red Invitrogen 31053-028
Optifect Invitrogen 12579017
Ciprofloxacin CellGro 61-277-RF
Tris-Hydrochloride Powder Sigma 93287
Tris-Base Powder Sigma 93286
Triton X-100 Pure Liquid Fisher BP151-100
DTT Invitrogen 15508-013
C–nzyme A Nanolight 309
ATP Sigma A6419
Luciferin Invitrogen L2912
h-CTZ Nanolight 301
PTC124 SelleckBiochemicals S6003

DOWNLOAD MATERIALS LIST

References

  1. Chiba-Falek, O., Nussbaum, R. L. Effect of allelic variation at the NACP-Rep1 repeat upstream of the α-synuclein gene (SNCA) on transcription in a cell culture luciferase reporter system. Hum. Mol. Genet. 10, (26), 3101-3109 (2001).
  2. Chiba-Falek, O., Touchman, J. W., Nussbaum, R. L. Functional analysis of intra-allelic variation at NACP-Rep1 in the alpha-synuclein gene. 113, (5), 426-431 (2003).
  3. Scherzer, C. R., et al. GATA transcription factors directly regulate the Parkinson's disease-linked gene α-synuclein. Proc. Natl. Acad. Sci. USA. 105, (31), 10907-10912 (2008).
  4. Spillantini, M. G., Schmidt, M. L., Lee, V. M. Y., Trojanowski, J. Q., Jakes, R., Goedert, M. α-Synuclein in Lewy Bodies. Nature. 388, (6645), 839-840 (1997).
  5. Pankratz, N., et al. Meta-analysis of Parkinson's disease: identification of a novel locus, RIT2. Ann. Neurol. 71, (3), 370-384 (2012).
  6. Satake, W., et al. Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson's disease. Nat. Genet. 41, (12), 1303-1307 (2009).
  7. Simón-Sánchez, J., et al. Genome-wide association study reveals genetic risk underlying Parkinson's disease. Nat. Genet. 41, (12), 1308-1312 (2009).
  8. Polymeropoulos, M. H., et al. Mutation in the alpha-synuclein gene identified in families with Parkinson's disease. Science. 276, (5321), 2045-2047 (1997).
  9. Ibáñez, P., et al. Causal relationship between a-synuclein gene duplication and familial Parkinson's disease. Lancet. 364, (9440), 1169-1171 (2004).
  10. Chartier-Harlin, M. -C., et al. a-Synuclein locus duplication as a cause of familial Parkinson's disease. Lancet. 364, (9440), 1167-1169 (2004).
  11. Singleton, A. B., et al. a-Synuclein locus triplication causes Parkinson's disease. Science. 302, (5646), 841 (2003).
  12. Ahn, T. -B., et al. a-Synuclein gene duplication is present in sporadic Parkinson disease. Neurology. 70, (1), 43-49 (2008).
  13. Boyce, F. M., Bucher, N. L. Baculovirus-mediated gene transfer into mammalian cells. Proc. Nat. Acad. USA. 93, (6), 2348-2352 (1996).
  14. Montigny, W. J., et al. Parameters influencing high-efficiency transfection of bacterial artificial chromosomes into cultured mammalian cells. Biotechniques. 35, 796-807 (2003).
  15. Gorman, C. M., Moffat, L. F., Howard, B. H. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, (9), 1044-1051 (1982).
  16. Li, J. J., Herskowitz, I. Isolation of ORC6, a Component of the Yeast Origin Recognition Complex by a One-Hybrid System. Science. 262, 1870-1874 (1993).
  17. Dejardin, J., Kingston, R. E. Purification of Proteins Associated with Specific Genomic Loci. Cell. 136, 175-186 (2009).
  18. Shen, Y., et al. A map of the cis-regulatory sequences in the mouseGenome. Nature. 488, 116-120 (2012).
  19. Fan, F., Wood, K. Bioluminescent assays for high-throughput screening. Assay Drug Dev. Technol. 5, (1), 127-136 (2007).
  20. Hampf, M., Gossen, M. A protocol for combined Photinus and Renilla luciferase quantification compatible with protein assays. Anal. Biochem. 356, (1), 94-99 (2006).
  21. Auld, D. S., Thorne, N., Maguire, W. F., Inglese, J. Mechanism of PTC124 activity in cell-based luciferase assays of nonsense codon suppression. Proc. Natl. Acad. Sci. USA. 106, (9), 3585-3590 (2009).
  22. Pearlberg, J., et al. Screens using RNAi and cDNA expression as surrogates for genetics in mammalian tissue culture cells. Cold Spring Harb.Symp. Quant. Biol. 70, 449-459 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics