הפוך מערכת דו היברידית שמרים לזהות יונקים הגרעיני קולטן שאריות כי אינטראקציה עם ligands ו / או יריבים

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ketoconazole נקשר ולעוינות pregnane X קולטן הפעלה (PXR). מסכי תפוקת שמרים גבוהים של מוטציות PXR להגדיר אזור ייחודי לketoconazole מחייב. שיטה גנטית המבוסס על שמרים זה מגלה אינטראקציות רצפטור הגרעיני רומן עם ligands שמקשר עם אתרי פני השטח מחייבים.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

כרגולטור קריטי של חילוף חומרים בסמים ודלקת, pregnane X קולטן (PXR), ממלא תפקיד חשוב בפתופיזיולוגיה מחלה המקשר את חילוף החומרים ודלקת (למשל steatosis כבד) 1,2. חל התקדמות רבה בזיהוי של ligands אגוניסט לPXR, לעומת זאת, יש תיאורים מוגבלים של יריבים כמו סמים ואתרי הקישור שלהם על PXR 3,4,5. מכשול קריטי היה חוסר היכולת לטהר את יעילות החלבון באורך מלא ללימודים מבניים עם יריבים למרות שPXR שוכפל ומאופיין ב1998. המעבדה שלנו שפותחה על שמרי תפוקה גבוהה רומן מבוסס assay שני ההיברידי להגדיר אנטגוניסט, ketoconazole של, מחייב שאריות על PXR 6. השיטה שלנו כרוכה ביצירת ספריות מוטאציות שתצלנה את ההשפעה של מוטציות בודדות על פני השטח AF-2 של PXR הצפוי לקיים אינטראקציה עם ketoconazole. הצלה או "רווח של הפונקציה" הערוץמוטציות nd יכולים להתבצע כך שמסקנות לגבי האינטראקציה הגנטית של ketoconazole ושאריות המשטח (ים) בPXR הן ריאלי. לכן, פיתחנו תפוקה גבוהה של שני היברידי שמרי מסך של מוטציות PXR אינטראקציה עם coactivator, SRC-1. שימוש בגישה זו, שבה את השמרים שונה כדי להתאים את המחקר של התרופה נגד פטריות, ketoconazole, אנחנו יכולים להפגין מוטציות ספציפיות על PXR מועשרת בשיבוטים מסוגלים להיקשר ketoconazole. לפי היגיון הפוך, אנו מגיעים למסקנה שהשאריות המקוריות הן שאריות אינטראקציה ישירות עם ketoconazole. assay זה מייצג רומן, assay הגנטי הצייתן למסך לאתרי קישור אנטגוניסט על משטחי קולטן גרעיני. assay זה יכול להיות מיושם על כל תרופה ללא קשר לפוטנציאל ציטוטוקסיות שלה לשמרים, כמו גם לחלבון תאי (ים) שלא ניתן ללמוד באמצעות ביולוגיה מבנית סטנדרטית או שיטות proteomic מבוססות. החסרונות פוטנציאליים כוללים פרשנות של נתונים (שיטות משלימות שימושי), רליאהה בשיטה אחת Y2H, מומחיות בטיפול בשמרים או ביצוע מבחני שני היברידי שמרים, וassay אופטימיזציה.

Introduction

Assay השמרים שני ההיברידי (Y2H) נעשה שימוש נרחב כדי לגלות אינטראקציות בין חלבונים ולאחרונה לגילוי של מולקולות קטנות, רומן המשבשות קומפלקסי חלבונים אינטראקציה 7, 8, 9, 10, 11. עם זאת, הגישות קונבנציונליות של assay זה, המשמש לגילוי סמים או "להיטים", אינן מאפשרות זיהוי של שאריות allosteric אינטראקציה של תרכובות כימיקלים בתוך משטחי חלבונים, שכאשר שינו עדיין אינטראקציה ולאפשר לחקירה של השאריות שינו 11 . ואכן, שיטה (ים) כזה, אם אפשרי לפתח, תאפשר מערכת שמרים צייתנית להערכת תפוקה גבוהה של שאריות האינטראקציה allosteric קריטיות לשיבוש אינטראקציה בין חלבונים. בהקשר של גילוי תרופות, הדרך הישירה ביותר להקים אינטראקציה של תרכובות עם חלבונים תהיה כרוכה בקביעה מבנית (למשל התגבשות של קומפלקס חלבון מעכב). שיטות אלה הן בהצטיינותbersome, להשתמש במשאבים משוכללים וזה לא אפשרי מבחינה טכנית לבצע מחקרים מבניים על כל חלבון.

מערכות הקרנת סמים גנטיות צייתניות הוקמו בחיידקים 1, 2 ומערכות מודל אחרות כמו שתי ההיברידי של יונקים. עם זאת, מערכות אלו זקוקות לאופטימיזציה ומערכות חלופיות כמו Y2H עדיין נבדקו ביותר בגילוי תרופות. ישנן מגבלות הכוללות רגישות ואמינות של אינטראקציות בשימוש בשיטות ייחודיות 13 עניים, לעומת זאת, assay Y2H אחד יכול להיות שונה כדי לענות על שאלות ספציפיות בנוגע לשאריות אינטראקציה. בתחום מחקר קולטן גרעיני, Y2H נעשה שימוש כדי להגדיר את חלבוני אינטראקציה 14, לעומת זאת, אינטראקציות חלבון אלה רק לעתים נדירות נעשו שימוש כדי להגדיר את האופי שבו ligands / יריבים אינטראקציה עם מתחמי קולטן חלבונים גרעיניים. לפיכך, המעבדה שלנו התמקדה מאמצים בהגדרת שיטה, במיוחד לחלבוני הקולטן שאינםנוח בקלות לproteomic שיטות מבוססות, שיחשוף ליגנד רומן / אנטגוניסט אינטראקציה שאריות באמצעות פלטפורמת גילוי Y2H מבוססת הפוכה.

בהתבסס על הממצא הקודם שלנו שketoconazole משבש PXR וactivator SRC-1, פיתחנו רומן הפוך מערכת Y2H שיאפשר לנו להגדיר ולחקור את שאריות ketoconazole האינטראקציה בPXR 6. השיטה שלנו מבוססת על המאפיינים של חלבון GAL4 שמרים שמורכבת מתחומים להפרדה אחראים להפעלת ה-DNA מחייבת ותעתיק. חלבון PXR LBD מבוטא היתוך לתחום LexA-DNA מחייב (DNA-BD), תוך שיתוף מפעילי אורך המלא SRC-1 (coactivator קולטן סטרואידים 1) חלבונים באים לידי ביטוי כהתכה לתחום הפעלת GAL4 (AD ). אינטראקציה בין PXR וחלבונים היתוך SRC-1 מובילה להפעלת תעתיק של אתרי GAL4 מחייבים המכילים גן כתב β-Lac Z המשתלב בשמרים genomדואר. Ketoconazole, אנטגוניסט PXR, משבש PXR ואינטראקציה SRC-1 15, 16, 17 ואנחנו יכולים לזהות את האינטראקציה של PXR וSRC-1 בנוכחותו או היעדריו של ketoconazole לאחר צביעת מושבות במסננים לפעילות X-gal. עיקרון Y2H מודגם באיור 1 והליך הניסוי מסוכם באיור 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. בניית PXR וSRC-1 Fusions בוקטורי שמרים

  1. ההגברה PCR של אדם PXR LBD (107-434 חומצות אמינו) וSRC-1 אורך אנוש מלא (1-1,401 חומצות אמינו).
    1. השתמש פלסמיד pSG5-hPXR 8 כתבנית PXR LBD, השתמש פלסמיד pCMX-src1 כSRC-1 תבניות.
    2. הפשירו PCR Supermix, תבניות ה-DNA ופריימרים (ראה חומרים), לשמור אותם על קרח.
    3. הוספת 0.25 מיקרוגרם / תבנית ה-DNA μl μl 1, זוגות פריימר 10 מ"מ 2 μl כל אחד, PCR Supermix 45 μl ולהוסיף H 2 O להביא נפח כולל 50 μl.
    4. הגדרת ה-PCR במחזור אחד של 94 מעלות צלזיוס למשך 2 דקות, 20 מחזורים של 94 מעלות צלזיוס במשך 30 שניות, 55 מעלות צלזיוס במשך 30 שניות ו72 מעלות צלזיוס למשך 2 דקות, ולאחר מכן מחזור של 72 ° C אחד עבור 10 דקות להארכה. בדקו מוצרי ה-PCR בריצה על 1% agarose ג'ל.
  2. מוצרי ה-PCR שיבוט לתוך וקטורי Y2H.
    1. לטהר את מוצרי ה-PCR מ1% agarose ג'ל. Digest PXR, LBD, PCR, וY2H וקטור pSH2-1 עםBamHI וסאלי; לעכל SRC-1-PCR וpGADNOT וקטור Y2H עם NotΙ וSalΙ. כדי לעשות זאת, להוסיף DNA 1 מיקרוגרם, 3 μl חיץ תגובת 10x, אנזימי הגבלת μl 1, ולבסוף H 2 O להביא נפח הכולל עד 30 μl.
    2. שים דגימות עיכול ב37 אמבט מים C ° במשך שעה 1. בדוק עיכול על ידי הפעלה על 1% agarose ג'ל.
    3. לטהר דגימות עיכול מ1% agarose ג'ל, ולקשור מתעכלים מוצרי ה-PCR ווקטורי Y2H ולהפוך לתאים המוסמכים DH5α.
    4. פיק המושבות ולבודד את ה-DNA פלסמיד.
  3. זיהוי ה-DNA פלסמיד pSH2-1-PXR ידי עיכול BamHI / סאלי, לזהות פלסמיד דנ"א pGADNOT-SRC-1 על ידי עיכול NotI / סאלי. ודא שכל פלסמיד דנ"א החיובי על ידי רצף.

2. מבחני דו היברידי שמרים

  1. לחסן זן השמרים לתוך 5 YPAD מיליליטר ו דגירה במשך הלילה על ידי תסיסה מתמדת (220 סל"ד ב30 מעלות צלזיוס). הערה: זן שמר האפייה היה CTY10-5D(MAT TRP ade2 1-901 LEU2-3, 112 his3-200 ga l4 - gal80 - URA3 :: LexA-lacZ) המכיל גן GAL1-lacZ משולב עם LexA מפעיל 10. כדי להשיג תאי שמרי קיימא עמידים לketoconazole, אבל אלה שלא נשאו שינויי טרנספורטר כגורם להתנגדות azole 18-20, זנים חדשים של שמרי CTY10-5D התקבלו על ידי ERG3 הראשון מחיקה (Δ erg3) ולאחר מכן החדרת מחיקה נוספת ב ERG11 (erg3 Δ / Δ erg11) גנים על ידי רקומבינציה הומולוגית. פרטי הבנייה תוארו בכתב יד שפורסם בעבר 6.
  2. למחרת (בבוקר), לחסן שמרים (1:20) ב5 YAPD מיליליטר דגירה להשיג OD 600 ~ 0.2 ידי תסיסה מתמדת (220 סל"ד ב30 מעלות צלזיוס).
  3. גלולה התאים ב 2,000 סל"ד בmicrocentrifuge למשך 2 דקות וזורקים supernatant. לאחר מכן לשטוף את פלהפעמיים עם מים autoclaved ופעם אחת עם 0.1 M LiAc לא.
  4. לאחר לשטוף הסופי, להשליך supernatant ולהוסיף את ריאגנטים הבאים לתא גלולה: 240 μl PEG 3,500 50% w / v, 36 μl 1 M LiAc, 50 μl 2 מ"ג / ssDNA זרע סלמון מבושל מיליליטר, H 2 O 34 μl. מערבולת לערבב, להוסיף 1 מיקרוגרם הפש-PXR ו-DNA pGADNOT-SRC-1 1 מיקרוגרם ומערבבים.
  5. מעביר את התערובת לפוליסטירן צינור עגול תחתון, להתסיס את השינוי, לערבב (220 סל"ד ב30 מעלות צלזיוס) במשך 30 דקות. העבר את הצינור ל42 אמבט המים C ° דגירה במשך 30 דקות נוספות.
  6. צנטריפוגות הצינור ב2,000 סל"ד במשך 2 דקות ולהסיר את supernatant. לשטוף גלולה פעם אחת עם מים autoclaved.
  7. מים סטריליים 100 μl פיפטה לתוך הצינור, מחדש להשעות את התאים על ידי אצבע עדינה הקשה וpipetting, אז צלחת על גבי צלחות של -His/-Leu נשירה בינונית (גיבוש לליטר אחד -His/-Leu נשירה בינוני: 20 דקסטרוז גרם, 1.7 YNB גרם, CSM-His/-Leu 0.67 גרם, אמוניום סולפט 5 גרם, אגר 1.5%) וincubate ב30 מעלות צלזיוס במשך 3-4 ימים לבודד transformants.

3. Assay סינון X-gal

  1. חותכים קרום ניטרוצלולוזה לגודל של חלק מצלחת פטרי. תווית קרום ניטרוצלולוזה כדי לסמן את הכיוון.
  2. מקום קרום ניטרוצלולוזה premarked על שמרי מושבות, לוודא כי הקרום נמצא במגע עם פני השטח של מדיום הצלחת.
  3. להסיר את הקרום, למקם אותו בצד מושבה על נייר סינון 3 מ"מ, ולמקם את הקרום ונייר הסינון ב -80 מעלות צלזיוס במשך 15 דקות.
  4. הפוך פתרון X-gal. הוסף 50 μl 20 מ"ג / מיליליטר X-gal ו -15 μl β-mercaptoethanol עד 5 מיליליטר של Z-חיץ (חיץ L 1 מכיל 16.1 גרם Na 2 HPO 4 7H 2 O, 2 PO 4 H 2 O, גרם 0.75 5.5 אא g KCl, 0.25 גרם MgSO 4 • 7H 2 O). אם Z הצפת נשמרה על 4 מעלות צלזיוס, להביא אותו לטמפרטורת חדר לפני הוספת חומרים כימיים אלה.
  5. הנח שני עיגולים של נייר סינון 3 מ"מבצלחת פטרי ולהשרות אותם עם 5 מיליליטר פתרון X-gal. מסננים חיץ עודף מצלחת פטרי והנח את קרום ניטרוצלולוזה עם הצד עד המושבה.
  6. סגור את המכסה, להבטיח כי הממברנה היא מגע מלא עם נייר הסינון והוא רטוב לגמרי. עטוף את צלחת פטרי בנייר כסף ולדגור על 37 מעלות צלזיוס במשך 30 דקות ללילה.

4. Assay β-gal הנוזלי

  1. לגדול שמרים במדיום נוזלי -His/-Leu נשירה לOD 600 0.7.
  2. בינוני מיליליטר העברת 1 לתוך צינור 1.5 מיליליטר microcentrifuge ו צנטריפוגות ב 3,000 סל"ד במשך 2 דקות. בטל supernatant.
  3. הוסף 1 מיליליטר של Z הצפת לresuspend את הכדור, צנטריפוגות ב 3,000 סל"ד שוב למשך 2 דקות. בטל supernatant.
  4. הוסף 150 μl של Z הצפת עם 2ME לresuspend התא גלולה, לערבב ולאחר מכן להוסיף 50 כלורופורם μl ו20 μl SDS .0.1%. במרץ מערבולת המדגם עבור 15 שניות.
  5. הוסף 700 μl של ONPG פתרון (1 מ"ג / מיליליטר בbuf Zfer). לכוון את השעון, דגירה על 30 מעלות צלזיוס ארוכות מספיק כדי לאפשר את הצבע הצהוב כדי לפתח ולב כולל זמן תגובה.
  6. הוסף 500 μl של 1 M Na 2 CO 3 כדי לעצור את התגובה ולקבוע את הספיגה ב 420 ננומטר. הריק הוא פתרון 700 μl ONPG תוספת 500 μl 1 M Na 2 CO 3.

חישוב יחידות מילר כדלקמן: מילר יחידות = (Å420 * 1,000) / (A600 * דקות מיליליטר *)

Å420: יחידות הספיגה ב 420 ננומטר; A600: יחידות הספיגה ב 600 ננומטר; דקות: זמן התגובה בדקות; מיליליטר: נפח התגובה במ"ל

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ביצענו assay כדי לראות אם אנחנו יכולים לזהות readout colorimetric של העמותה של PXR וקולטן סטרואידי coactivator-1 (SRC-1). מאז שמרים יש ייצור סטרולים משמעותי, זה כבר בעבר הראה כי ביטוי lacZ בשמרים יכול להיגרם ללא הצורך יגנד אקסוגניים נוסף. מצאנו כי ביטוי lacZ (מושבות כחולות) הוא גם מושרה בזן השמרים הפכו עם PXR וSRC-1, עם זאת, אין אינדוקציה של ביטוי LacZ (מושבות הלבנות) בשמרים הפכה עם וקטורים ריקים, PXR או SRC-1 בנפרד (איור 3). כדי לקבוע אם ketoconazole (25 מיקרומטר) שיבש PXR ואינטראקציה SRC-1 בשמרים, צלחות העתק המכילות ketoconazole היו ספוגות בניטרוצלולוזה ומסנן X-gal, מעלית, ומבחני נוזל β-galactosidase בוצעו. אנו מראים כי ketoconazole משבש PXR וSRC-1 אינטראקציות בשמרים שכן כל המושבות ממסנן ההעתק היו לבנים עכשיו (שהיהמוצג גם על ידי הפעילות מופחתת באופן משמעותי β-galactosidase ידי מבחני האנזימטית נוזליים) (איור 4 א). אנחנו הראיתי בעבר במבחנים של יונקים שמוטצית PXR (T248E/K277Q) יכולה להיות מופעלת על ידי ליגנד חזק (למשל ריפאמפיצין), אך אינו חסין להשפעות המנוגדות של ketoconazole 1 7. באופן דומה, כאשר אנו מהונדסים המוטציה הכפולה PXR (T248E/K277Q) בשמרים פלסמיד ולאחר מכן ביצענו שינויי שמרים עם SRC-1, הצלחנו להראות שהמושבות נחשפו לketoconazole עדיין שומרות על ביטוי LacZ (איור 4).

איור 1
איור 1. סכמטי המדגים את העקרונות של שמרי שני היברידי assay (Y2H). השמרים assay כבר נקבע כassay פונקציונלי המאפשר בידוד של מוטציות PXR כי הם ההתנגדלא לKetoconazole עיכוב בתיווך של אינטראקציה SRC-1., אינטראקציה דו היברידית מושרה ריפאמפיצין חלבון היתוך LexA-DB-hPXR של עם SRC-1 התמזגו לתחום GAL4-הפעלה (GAL4AC-SRC-1). תוצאות האינטראקציה במושבות כחולות בassay X-gal בגלל כתב LacZ. B, נוכחות של ketoconazole משבשת את האינטראקציה מושרה ריפאמפיצין של hPXR עם SRC-1. תוצאות assay X-gal במושבות הלבנות. C, נוכחות של מוטציה (מסומנת בכוכבית) בhPXR שהופך אותו חסין מפני הפעולה של ketoconazole יניבו מושבה כחולה. D, שינוי נוסף של assay שלנו בעתיד יכול לשלב מוטציות נוספות השניה מדכאת אתר (מאוירות עם חצי ירח) כדי לסכל את ההשפעה של המוטציה הראשונה שעלולים לגרום לשיבוש של אינטראקציה hPXR-SRC-1 ולכן מושבה לבנה בassay X-gal. LexAOp, אופרון LexA; Galp, אמרגן Gal4, Lac Z, בטא glalactosidase; DB, תחום ה-DNA מחייב LexAOp של Galp; AC, מעשהתחום ivation; *, מוטציה (ים). (לשכפל מהתייחסות 6). לחץ כאן כדי להציג דמות גדולה.

איור 2
איור 2. תרשים זרימה ניסיוני.

איור 3
איור 3. X-gal, assay מעלית, וassay נוזל β-gal. שמרים הפכו עם פלסמידים מצויינים ומושבות מצופות נתון assay X-gal מעלית (פנל משמאל) וassay β-gal הנוזלי (פנל מימין). וקטור ריק פש + וקטור ריק pGADNOT (מסלול 1); וקטור ריק הפש-PXR + pGADNOT (מסלול 2); וקטור ריק פש + pGADNOT-SRC-1 (מסלול 3); הפש-PXR + pGADNOT-SRC-1 (מסלול 4 </ Em>): 5. פש-INI-1 + pGADNOT-c-Myc (בקרה חיובית; מסלול 5). (לשכפל מהתייחסות 6).

איור 4
איור 4. Ketoconazole משבש wild-type אך קשר PXR לא מוטציה עם coactivator, SRC-1 מושבות שמרים היו העתק בצלחות המכילות רכב. (DMSO 0.2%; מסלול 1) או ketoconazole (25 מיקרומטר; מסלול 2). assay X-gal מעלית (פנל משמאל) וassay β-gal הנוזלי (פנל מימין) בוצעו לאחר מכן. PXR Wild הסוג (A, B קו 1 ו -2) וT248E/K277Q ketoconazole האילם המוטציה (ב 'שורה 3 ו -4) הוצגו בנתון זה. (לשכפל מהתייחסות 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

ב assay Y2H שונה שלנו, זיהינו שאריות חשובות לאינטראקציות ketoconazole על PXR 6. מאז SRC-1 הוא coactivator (ושובט לתוך וקטור pGADNot), אנחנו גם בדקנו האם SRC-1 יכול להפעיל ביטוי lacZ כאשר משובט למערכת הווקטור הפשה והאם זה הייתי משנה את פרופיל ההפעלה ו / או להשפיע על הדליפות של assay שני היברידי השמרים. שימוש בפלסמידים מחדש ביצענו מבחני שני היברידיים בשמרי Δ Δ / erg11 erg3. כמו בעבר, אנו מראים כי ביטוי lacZ (מושבות כחולות) הוא גם מושרה בerg3 שמרי Δ Δ מתח / erg11 הפך עם PXR וSRC-1, עם זאת, אין אינדוקציה של ביטוי LacZ (מושבות הלבנות) בשמרים הפכו עם וקטורים ריקים , PXR או SRC-1 בנפרד (מידע לא מוצג). הגישה שלנו מספקת שיטה חדשה ורבת עוצמה לבידוד של שאריות יגנד חלבון allosteric אינטראקציה גנטית לחלבונים לא מקובל conventioביולוגיה מבנית nal ו / או proteomic גישות 5,21.

יש הפרוטוקול כמתואר כמה ממלכודות שיש להכיר. ראשית, רגישות של זיהוי, במיוחד השפעות אלה חלקיים אנטגוניסט על שאריות אינטראקציה בין חלבונים יכולות להגביל את הרזולוציה של assay. סריקת Colorimetric עשויה לעזור לפתור חלק מבעיות זיהוי 21. שנית, נוכחותם של מושבות כחולות לא תמיד מצביעה על מוטציות ketoconazole עמידות PXR (חיוביות כוזבות). ביטוי lacZ ניתן היה להציל בנוכחות ketoconazole עקב מוטציה (ים) בPXR שהופך את החלבון פעיל constitutively או פעיל עצמאי של אינטראקציה SRC-1. מוטציות כאלה של PXR ניתן להבחין בין מוטנטים עמידים ketoconazole הנכון על ידי בדיקת היכולת של LexA-DB-PXR לעצמי להפעיל ביטוי lacZ, כלומר מוטציות אלה יניבו מושבות כחולות בהעדר GAL4AC-SRC-1. כפועל יוצא, מוטציות יכולה אלכך הוכנס לשמרים באמצעות GAL4AC-פלסמיד בהעדר LexA-DB-SRC-1 כדי לתאר עוד ראיות להפעלה עצמית של LacZ. שלישית, הוא נותר עלום, אם אותה התוצאה הייתה מתקבלת אם פרוטוקולי Y2H / וקטורים אחרים שימשו 13. הרביעית, המחקר של מוטציות intramolecular revertant (מוטציות מדכאי אתר השני של מוטציות ketoconazole עמיד) יכול להוסיף להבנה של יריב מחייב על ידי הגדרת שאריות השכנות המשפיעות על pharmacophore המחייב. עם שינוי של הספרייה של מוטציות, אפשר להגדיר את זה באופן מדויק יותר באמצעות מוטציה ketoconazole עמיד כתבנית mutagenesis.

שיטה זו יכולה להיות שונה כדי לשלב כל תרופה לפי היעד ציטוטוקסיות בשמרים שהוקם או לסמים (ים) שאין לה פוטנציאל רעיל לשמרים היטב. השמרים יכולים להיות שונה, כפי שהראינו 6, ועדיין להיות מעשי עבור מבחני Y2H. כוחה של שיטה זו נשען גם על להודיע ​​נלווהation ממבחנים אחרים (למשל עגינה מולקולרית) להודיע ​​כי אינטראקציות באתר ספציפי. יתר על כן, אינטראקציות רצפטור הגרעיני / coregulator ספציפיות (למשל nurr77/LKB1; AR/PELP1) ניתן ללמוד 22,23. העקיבות של מערכת זו היא שהוא נייד, יכול להתבצע בתוך כמה ימים באופן תפוקה גבוה ואינו דורש חומרים כימיים או בשיטות יקרים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אין ניגודי האינטרסים הכריזו.

Acknowledgments

עבודה זו נתמכה על ידי המכונים הלאומיים לבריאות (NIH) מענקי CA127231 ופרס דיימון רניון קרן החוקר קליני (CI 1502) (לSM). ברצוננו להודות לפרופסור זדנק דבוז'ק מPalacky אוניברסיטת אולומוץ, צ'כיה לתובנה מועילות שלו לדיון בניידות של טכניקה זו למוסד וסטנדרטיזציה של פרוטוקול שלהם.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics