Реверс дрожжевой Два-гибридная система для идентификации Mammalian ядерного рецептора Остатки, которые взаимодействуют с лигандами и / или антагонистов

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Кетоконазол связывается и противодействует прегнановых X рецептор (ПРИ) активации. Дрожжи высокой пропускной экраны PXR мутантов определить уникальный регион для связывания кетоконазол. Этот генетический метод дрожжей на основе обнаруживает новые взаимодействия ядерных рецепторов с лигандами, которые связывают с поверхности участков связывания.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

В критической регулятора метаболизма лекарств и воспаления, прегнан Х-рецептора (ПРИ), играет важную роль в патофизиологии болезни обмена веществ, связывающую и воспаление (например, стеатоза печени) 1,2. Там был достигнут значительный прогресс в идентификации агонистов лигандов для ПРИ, однако, есть ограниченные описания наркотиками как антагонистов и их сайтов связывания на PXR 3,4,5. Критический барьер была неспособность эффективно очистить полнометражный белка для структурных исследований с антагонистами, несмотря на то, что ПРИ клонировали и характеризуется в 1998 году. Наша лаборатория разработала новую высокую пропускную дрожжи основе двугибридная анализа определить антагонист, кетоконазол х, связывания остатков на ПРИ 6. Наш метод включает в себя создание мутационные библиотеки, которые бы спасти эффект одиночных мутаций на AF-2 поверхности ПРИ ожидается, взаимодействовать с кетоконазол. Спасение или «усиления из-функции" вторй мутации могут быть сделаны таким образом, что выводы о генетическом взаимодействии кетоконазол и поверхностного остатка (ов) на ПРИ осуществимы. Таким образом, мы разработали высокую пропускную двухгибридного дрожжей экран PXR мутантов, взаимодействующих с ее коактиватора, SRC-1. Используя этот подход, в которых дрожжи был изменен, чтобы приспособить изучение противогрибкового препарата, кетоконазол, мы могли бы продемонстрировать специфические мутации на ПРИ обогащенные клонов не могли связать с кетоконазол. По обратной логике, мы приходим к выводу, что первоначальные остатки являются прямыми остатки взаимодействия с кетоконазолом. Этот анализ представляет собой роман, послушный генетический анализ для скрининга антагонистов сайтов связывания на поверхности ядерного рецептора. Этот анализ может быть применен к любому препарату независимо от его цитотоксического потенциала для дрожжей, а также клеточного белка (ов), которые не могут быть изучены с помощью стандартного структурной биологии или протеомических на основе методов. Потенциальные ловушки включают интерпретацию данных (нетрадиционные методы полезны), надежAnce на одного метода Y2H, опыт в обращении с дрожжей или выполнение дрожжей двух гибридных анализов и оптимизации анализа.

Introduction

Дрожжи двугибридная (Y2H) анализ широко используется, чтобы обнаружить белок-белковых взаимодействий и совсем недавно для открытия новых малых молекул, которые разрушают белок-белковых комплексов взаимодействия 7, 8, 9, 10, 11. Однако обычные подходы этом анализе используется для лекарственных препаратов или "попаданий", не позволяют для обнаружения аллостерических остатков химических веществ взаимодействия соединений в белок-белковых поверхности, что, когда изменяется еще взаимодействовать и позволяют опроса измененных остатков 11 . В самом деле, такой способ (ы), если это возможно, чтобы развиваться, позволило бы сговорчивым систему дрожжей для оценки высокой пропускной аллостерических остатков взаимодействия критических для нарушения взаимодействия белок-белок. В контексте открытия новых лекарств, наиболее прямой путь для установления взаимодействия соединений с белками предполагает структурную определение (например Кристаллизация белок-ингибитор комплекса). Эти методы дипломbersome, использовать сложные ресурсы, и это технически невозможно выполнить структурные исследования по каждой белка.

Сговорчивым системы генетического скрининга наркотиков были созданы в бактериях 1, 2 и других модельных систем, как млекопитающих двугибридная. Тем не менее, эти системы должны оптимизацию и альтернативные системы, такие как Y2H-прежнему являются наиболее протестирован в лекарственных препаратах. Существуют ограничения, которые включают слабую чувствительность и надежность взаимодействия с использованием особых методов 13, однако, один Y2H анализ может быть изменен, чтобы ответить на конкретные вопросы, касающиеся остатков взаимодействия. В области исследований ядерной рецепторов, Y2H был использован для определения взаимодействующих белков 14, однако, эти белковые взаимодействия редко используется для определения характера, в которых лиганды / антагонисты взаимодействуют с ядерными рецептор-белковых комплексов. Таким образом, наша лаборатория сосредоточены усилия на определении метода, особенно для белков-рецепторов, которые нелегко поддаются протеомные методы, основанные, что бы раскопать роман лиганд / антагониста, взаимодействующих остатков с использованием обратной Y2H основе платформу открытия.

Основываясь на нашем предыдущем открытии, что кетоконазол нарушает PXR и его активатор SRC-1, мы разработали роман обратного Y2H систему, которая позволит нам определить и допросить кетоконазол взаимодействующих остатков на ПРИ 6. Наша методика основана на свойствах белка GAL4 дрожжей, который состоит из отделимых областей, отвечающих за активацию ДНК-связывающего и транскрипции. Белок PXR LBD выражается в виде гибрида к LexA ДНК-связывающий домен (ДНК-BD), в то время как по всей длине Соактиваторы SRC-1 (стероид коактиватор рецептор 1) белки экспрессируются в виде слитых с доменом активации GAL4 (AD ). Взаимодействие между ПРИ и SRC-1 слитых белков приводит к транскрипционной активации GAL4-связывающие сайты, содержащие репортерный ген β-Lac Z, который интегрирован в геноме дрожжейэ. Кетоконазол, антагонист PXR, нарушает PXR и SRC-1 взаимодействие 15, 16, 17, и мы можем детектировать взаимодействие ПРИ и SRC-1 в присутствии или в отсутствие кетоконазол после окрашивания колонии на фильтров для X-гал активности. Принцип Y2H иллюстрируется на рисунке 1 и экспериментальная процедура показаны на рисунке 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Строительство ПРИ и SRC-1 Fusions в дрожжевые векторы

  1. ПЦР-амплификации человеческого PXR ДТЛ (107-434 аминокислот) и человека SRC-1 полной длины (1-1401 аминокислот).
    1. Используйте pSG5-hPXR плазмиды 8 как ПРИ LBD шаблона, используйте PCMX-SRC1 плазмиды как SRC-1 шаблонов.
    2. Оттепель ПЦР SuperMix, ДНК-матрицы и праймеры (см. материалы), держать их на льду.
    3. Добавить 0,25 мкг / мкл матричной ДНК 1 мкл, 10 мМ пары праймеров 2 мкл каждый, ПЦР SuperMix 45 мкл и добавить H 2 O, чтобы довести общий объем до 50 мкл.
    4. Набор ПЦР на один цикл при 94 ° С в течение 2 мин, 20 циклов при 94 ° С в течение 30 сек, 55 ° С в течение 30 сек и 72 ° С в течение 2 мин, а затем один цикл при 72 ° С в течение 10 мин для расширения. Проверка продуктов ПЦР, запустив на 1% агарозном геле.
  2. Продукты ПЦР клонирования в Y2H векторов.
    1. Очищают продуктов ПЦР с 1% агарозном геле. Дайджест ПРИ, ДТЛ, ПЦР и Y2H вектор pSH2-1 сBamHI и SalI; переварить SRC-1 ПЦР и Y2H вектор pGADNOT с NotΙ и SalΙ. Чтобы сделать это, добавьте 1 мкг ДНК, 3 мкл 10х реакционного буфера, 1 мкл ферменты рестрикции, и, наконец H 2 O, чтобы принести общий объем до 30 мкл.
    2. Положите образцы пищеварения в 37 ° С водяной бане в течение 1 часа. Проверка на пищеварение работает на 1% агарозном геле.
    3. Очищают образцы пищеварения от 1% агарозном геле, переваривали перевязывать продуктов ПЦР и Y2H векторы и преобразования, чтобы компетентных клеток DH5б.
    4. Выберите колонии и изолировать ДНК плазмиды.
  3. Определить pSH2-1-PXR ДНК плазмиды по BamHI / SalI пищеварения, определить pGADNOT-SRC-1 ДНК плазмиды на NotI / SalI пищеварения. Проверьте весь положительный ДНК плазмиды путем секвенирования.

2. Дрожжи двугибридная Анализы

  1. Инокуляции штамма дрожжей в 5 мл YPAD и инкубировать в течение ночи при постоянном перемешивании (220 оборотов в минуту при 30 ° С). Примечание: Штамм Saccharomyces CEREVISIAE был CTY10-5d(MAT ade2 ГТО 1-901 leu2-3, 112 his3-200 га L4 - gal80 - URA3 :: Lexa-LacZ), который содержит интегрированный ген GAL1-LacZ с Lexa оператора 10. Для получения жизнеспособных дрожжевых клеток, устойчивых к кетоконазол, но те, которые не несут транспортера изменения в качестве причины азольного сопротивления 18-20 новых штаммов CTY10-5d дрожжей были получены предварительного удаления ERG3 (erg3 Δ), а затем введения дополнительного удаления в ERG11 (erg3 Δ / erg11 Δ) гены путем гомологичной рекомбинации. Конструктивные детали были описаны в ранее опубликованной рукописи 6.
  2. На следующий день (утром), привить дрожжи (1:20) в 5 мл YAPD и инкубировать, чтобы получить OD 600 ~ 0,2 на постоянном перемешивании (220 оборотов в минуту при 30 ° С).
  3. Гранул клеток при 2000 оборотах в минуту в микроцентрифуге в течение 2 мин и отбросить супернатант. Затем промыть Pelleт дважды автоклавного водой и один раз 0,1 М LiAc.
  4. После последней промывки, отбросить супернатант и добавьте следующие реагенты к осадку клеток: 240 мкл ПЭГ 3500 50% вес / объем, 36 мкл 1 М LiAc, 50 мкл 2 мг / мл кипяченой одноцепочечной ДНК спермы лосося, H 2 O 34 мкл. Vortex перемешать, добавить 1 мкг ПШ-PXR и 1 мкг pGADNOT-SRC-1 ДНК и перемешать.
  5. Перенести смесь с полистиролом с круглым дном трубки, агитировать преобразование, смешать (220 оборотов в минуту при 30 ° С) в течение 30 мин. Перемещение трубки 42 ° С на водяной бане и инкубируют в течение еще 30 мин.
  6. Центрифуга трубки при 2000 оборотах в минуту в течение 2 минут и удалить супернатант. Вымойте гранул один раз автоклавного воды.
  7. Внесите 100 мкл стерильной воды в трубку, вновь приостановить клеток путем легкого пальцем разговоров и пипетки, затем пластину на пластинах -His/-Leu Dropout Medium (композиции на один литр -His/-Leu Dropout Medium: 20 г декстрозы, 1,7 г YNB, 0,67 г CSM-His/-Leu, 5 г сульфата аммония, 1,5% агар) и вклUbate при 30 ° С в течение 3-4 дней, чтобы изолировать трансформантов.

3. X-гал фильтр Анализ

  1. Cut нитроцеллюлозную мембрану с размером части чашке Петри. Этикетка нитроцеллюлозную мембрану, чтобы отметить ориентацию.
  2. Поместите premarked на нитроцеллюлозную мембрану дрожжевых колоний, убедитесь, что мембрана находится в контакте с поверхностью пластины среде.
  3. Удалить мембрану, поместите его колонии стороной вверх на 3 мм фильтровальной бумаги и поместите мембрану и фильтровальную бумагу при -80 ° С в течение 15 мин.
  4. Сделать X-гал решение. Добавить 50 мкл 20 мг / мл X-Gal и 15 мкл β-меркаптоэтанола в 5 мл Z-буфера (1 л буфер содержит 16,1 г Na 2 HPO 4 7H 2 O, 5,5 г NaH 2 PO 4 H 2 O, 0,75 г KCl, 0,25 г MgSO 4 • 7H 2 O). Если Z буфера выдерживали при 4 ° С, довести его до комнатной температуры перед добавлением этих реагентов.
  5. Поместите два круга 3 мм фильтровальной бумагив чашку Петри и впитать их с 5 мл X-гал раствора. Слейте избыток буфера от чашки Петри и поместите нитроцеллюлозную мембрану с колонии стороной вверх.
  6. Закройте крышку, убедитесь, что мембрана делает полный контакт с фильтровальной бумаги, и это полностью мокрой. Обертка чашку Петри в фольгу и инкубируют при 37 ° С в течение 30 мин в течение ночи.

4. Жидкость Анализ β-гал

  1. Расти дрожжи в жидкой среде -His/-Leu Dropout к OD 600 0,7.
  2. Передача 1 мл среды в 1,5 мл микроцентрифужных трубки и центрифуге при 3000 оборотах в минуту в течение 2 мин. Удалите супернатант.
  3. Добавьте 1 мл Z-буфером, чтобы ресуспендируют осадок, центрифуги при 3000 оборотах в минуту снова в течение 2 мин. Удалите супернатант.
  4. Добавить 150 мкл Z-буфером с 2ME чтобы ресуспендируют осадок клеток, смешать затем добавить 50 мкл хлороформа и 20 мкл 0,1% SDS. Энергично вихрь образец в течение 15 сек.
  5. Добавить 700 мкл ONPG решения (1 мг / мл в Z BUFфер). Установка таймера, инкубировать при 30 ° С достаточно долго, чтобы позволить желтый цвет разработать и отметить общее время реакции.
  6. Добавить 500 мкл 1 М Na 2 CO 3, чтобы остановить реакцию, и определить оптическую плотность при 420 нм. Заготовка решение ONPG 700 мкл плюс 500 мкл 1 М Na 2 CO 3.

Рассчитать Миллер единиц следующим образом: Миллер Единицы = (A420 * 1000) / (A600 * мин * мл)

A420: единиц поглощения при 420 нм; A600: единиц поглощения в 600 нанометров; мин: время реакции в минутах; мл: реакционного объема в мл

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Мы провели анализ, чтобы убедиться, что мы могли обнаружить колориметрического считывание ассоциации ПРИ и стероидного рецептора коактиватор-1 (SRC-1). Поскольку дрожжи имеет значительный производства стерола, это ранее было показано, что LacZ экспрессии в дрожжах могут быть вызваны без необходимости дополнительного экзогенного лиганда. Мы обнаружили, что LacZ выражение (голубые колонии) также индуцируется в дрожжевой штамм трансформированного ПРИ и SRC-1, однако нет индукция LacZ выражения (белые колонии) в дрожжи, трансформированные с пустыми векторов, ПРИ или SRC-1 отдельности (рис. 3). Чтобы определить, является ли кетоконазол (25 мкм) нарушен PXR и SRC-1 взаимодействие в дрожжах, реплики планшеты, содержащие кетоконазол были пропитаны нитроцеллюлозы и X-гал фильтра, лифт, и были выполнены жидкие анализы β-галактозидазы. Мы покажем, что кетоконазол нарушает ПРИ и SRC-1 взаимодействий в дрожжах, так как все колоний от реплик фильтра были теперь белый (который былПоказано также, по значительно сниженной β-галактозидазы жидкими ферментативных анализов) (фиг.4А). Мы ранее показали в анализах млекопитающих, что ПРИ мутант (T248E/K277Q) могут быть активированы сильным лиганда (например рифампицин), но не застрахован от антагонистических эффектов кетоконазол 1 7. Точно так же, когда мы проектировали PXR двойной мутант (T248E/K277Q) в дрожжевой плазмиды, а затем выполняется дрожжевых преобразований с SRC-1, мы смогли показать, что колонии подвергаются кетоконазол по-прежнему сохраняют LacZ выражение (рис. 4б).

Рисунок 1
Рисунок 1. Схему, иллюстрирующую принципы дрожжевой двухгибридной (Y2H) анализа. Дрожжи анализ был создан в качестве функционального анализа, который позволяет для изоляции PXR мутантов, которые стойкиет кетоконазол, опосредованного ингибирования SRC-1 взаимодействия., рифампицин-индуцированной двугибридная взаимодействие LexA-DB-hPXR слитого белка с SRC-1, слитого с доменом активации GAL4-(GAL4AC-SRC-1). Результаты взаимодействия в синих колоний в Х-гал анализа из-за репортера LacZ. B, наличие кетоконазол нарушает рифампицин-индуцированной взаимодействие hPXR с SRC-1. X-Gal результаты анализа в белых колоний. C, наличие мутации (указаны звездочками) в hPXR, которая делает его невосприимчивым к действию кетоконазол даст синий колонии. D, дополнительную модификацию нашего анализа в будущем может включать дополнительные второго мутации сайт супрессоров (иллюстрированные полумесяца) сводит на нет эффект первой мутации, которая может привести к срыву hPXR-SRC-1 взаимодействия и, следовательно, белой колонии в X-гал анализа. LexAOp, LexA Оперон; Galp, Gal4 промоутер, Лак Z, бета-glalactosidase; DB, LexAOp ДНК-связывающий домен Galp; AC, актдомен ivation; *, мутация (ы). (Воспроизводится по ссылке 6). Нажмите здесь, чтобы увеличить рисунок .

Рисунок 2
Рисунок 2. Экспериментальная Блок-схема.

Рисунок 3
Рисунок 3. X-гал, лифт анализ и β-гал жидкость анализ. Дрожжи трансформировали указанных плазмид и высевали колоний, подверженных X-гал подъема теста (слева) и β-гал жидкого теста (правая панель). PSH пустой вектор + pGADNOT пустой вектор (полоса 1); ПШ-ПРИ + pGADNOT пустой вектор (дорожка 2); PSH пустой вектор + pGADNOT-SRC-1 (полоса 3); ПШ-ПРИ + pGADNOT-SRC-1 (полоса 4 </ EM>) 5. ПШ-INI-1 + pGADNOT-с-Мус (положительный контроль; дорожка 5). (Воспроизведено из работы 6).

Рисунок 4
Рисунок 4. Кетоконазол разрушает дикого типа, но не мутантный ассоциацию PXR с коактиватора, SRC-1 дрожжевых колоний были реплики в виде пластин, содержащих автомобиль. (0,2% ДМСО; полоса 1) или кетоконазол (25 мкМ; дорожка 2). X-гал лифт анализ (левая панель) и β-гал жидкость анализ (правая панель) были затем выполняется. Дикого типа ПРИ (А, В линии 1 и 2) и кетоконазол немой мутант T248E/K277Q (В линии 3 и 4) были показаны на этом рисунке. (Воспроизведено из работы 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

В нашем модифицированном Y2H анализа, мы выявили важные остатки для кетоконазол взаимодействий на ПРИ 6. Поскольку SRC-1 представляет собой коактиватор (и клонировали в вектор pGADNot), мы также протестировали, может ли SRC-1 активировать экспрессию LacZ, когда клонировали в векторе системы PSH и будет ли это изменить профиль активации и / или воздействовать на неплотности в дрожжи двугибридная анализ. Используя наши изменен плазмиды мы провели два гибридных анализы в erg3 Δ / erg11 Δ дрожжей. Как и прежде, мы показываем, что LacZ выражение (синие колонии) также индуцируется в erg3 Δ / erg11 Δ штамма дрожжей, трансформированных ПРИ и SRC-1, однако, нет индукция экспрессии LacZ (белые колонии) в дрожжах трансформируется с пустыми векторов , PXR или SRC-1 индивидуально (данные не показаны). Наш подход обеспечивает новый мощный метод для изоляции генетического взаимодействия аллостерический лиганд-белковых остатков для белков не поддающихся conventioНАЛ структурной биологии и / или протеомный приближается 5,21.

Протокол, как описано имеет несколько ошибок, которые необходимо признать. Во-первых, чувствительность обнаружения, особенно те, частичного антагонистического эффекта на остатках взаимодействия белок-белковых можете ограничить разрешение анализа. Колориметрический сканирования может помочь решить некоторые из обнаружения вопросы 21. Во-вторых, присутствие синих колоний не всегда указывают кетоконазол устойчивых PXR мутации (ложно положительные). Выражение LacZ можно было спасти в присутствии кетоконазола из-за мутации (ов) в ПРИ что делает белок конститутивно активным или активным независимо от SRC-1 взаимодействии. Такие мутанты ПРИ можно отличить от истинных кетоконазол устойчивых мутантов путем тестирования способности LexA-DB-ПРИ самостоятельно активировать экспрессию LacZ, т.е. эти мутанты дадут синих колоний в отсутствие GAL4AC-SRC-1. Как следствие, мутанты могут др.так введен в дрожжах с использованием GAL4AC-плазмиды при отсутствии LexA-DB-SRC-1 для дальнейшего описания доказательств для самостоятельного активации LacZ. В-третьих, остается неизвестным, если же результат будет получен, если другие протоколы Y2H / векторы использовали 13. В-четвертых, изучение внутримолекулярных ревертанта мутантов (второй сайт супрессоры мутанты кетоконазол устойчивых мутантов) можно добавить к пониманию антагониста связывания, определив соседние остатки, которые влияют на связывание фармакофор. С модификации библиотеки мутантов, можно определить это более точно, используя кетоконазол устойчивостью мутанта в качестве матрицы мутагенеза.

Этот способ может быть модифицирован, чтобы включить любой лекарственный препарат в котором мишень цитотоксических в дрожжах хорошо известна или к препарата (ов), который не имеет потенциальную токсичность по отношению к дрожжей. Дрожжи могут быть изменены, как мы показали 6, и при этом быть жизнеспособными в течение Y2H анализов. Мощность этого метода также опирается на вспомогательное сообщитьрадиоизлучение от других анализов (например молекулярный докинг), которые сообщают взаимодействия по конкретным участкам. Кроме того, конкретные ядерных рецепторов / coregulator взаимодействия (например nurr77/LKB1; AR/PELP1) могут быть изучены 22,23. Трактабильность этой системы является то, что он является портативным, может быть выполнена в течение нескольких дней в высокой пропускной образом и не требует дорогих реагентов или методов.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgments

Эта работа была поддержана Национальными Институтами Здоровья (NIH) Гранты CA127231 и Дэймон Руньон Foundation Award клинический исследователь (CI 1502) (на SM). Мы хотели бы поблагодарить профессора Зденек Дворак из Палацкого университета Оломоуц, Чехия за его полезные проникновения в обсуждении переносимости этой методики их организации и стандартизации протокола.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics