Invierta levadura de dos sistema híbrido para identificar mamíferos Receptor Nuclear Residuos que interactúan con ligandos y / o antagonistas

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

El ketoconazol se une a y antagoniza pregnano X activación del receptor (PXR). De levadura de alto rendimiento pantallas de mutantes PXR definen una región única para la unión ketoconazol. Este método de genética de la levadura descubre la interacción del receptor nuclear novedosas con ligandos que se asocian con los sitios de unión de la superficie.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Como un regulador crítico de la inflamación y el metabolismo de fármacos, pregnano receptor X (PXR), juega un papel importante en la fisiopatología de la enfermedad que une el metabolismo y la inflamación (por ejemplo, la esteatosis hepática) 1,2. Ha habido muchos avances en la identificación de ligandos agonistas de PXR, sin embargo, hay descripciones limitadas de antagonistas similares a las drogas y sus sitios de unión en PXR 3,4,5. Un obstáculo fundamental ha sido la incapacidad para purificar eficientemente la proteína de longitud completa para estudios estructurales con antagonistas a pesar de que PXR se clonó y caracterizó en 1998. Nuestro laboratorio desarrolló una nueva levadura de alto rendimiento basado en dos híbridos de ensayo para definir un antagonista, ketoconazol de, residuos de unión en PXR 6. Nuestro método implica la creación de bibliotecas mutacionales que rescatar el efecto de mutaciones individuales en la superficie de AF-2 de PXR espera que interactúe con ketoconazol. Rescate o "ganancia de función" second mutaciones pueden realizarse de tal manera que las conclusiones relativas a la interacción genética de ketoconazol y el residuo (s) de superficie en PXR son factibles. Por lo tanto, hemos desarrollado una evaluación de la levadura de dos híbridos de alto rendimiento de mutantes PXR que interactúan con su coactivador, SRC-1. El uso de este enfoque, en el que se modificó la levadura para acomodar el estudio del fármaco antifúngico, ketoconazol, hemos podido demostrar mutaciones específicas en PXR enriquecidos en los clones incapaces de unirse al ketoconazol. Por lógica inversa, llegamos a la conclusión de que los residuos originales son residuos de la interacción directa con ketoconazol. Este ensayo representa una novela, ensayo genético manejable para detectar sitios de unión sobre las superficies antagonistas de receptores nucleares. Este ensayo podría aplicarse a cualquier fármaco, independientemente de su potencial citotóxico a la levadura, así como a la proteína (s) celular que no pueden ser estudiados utilizando la biología estructural estándar o métodos proteómicos basada. Peligros potenciales incluyen la interpretación de los datos (métodos complementarios de utilidad), relición en un solo método Y2H, experiencia en el manejo de la levadura o la realización de dos ensayos de híbridos de levadura, y la optimización del ensayo.

Introduction

La levadura de dos híbridos (Y2H) de ensayo es ampliamente utilizado para descubrir las interacciones proteína-proteína y, más recientemente, para el descubrimiento de nuevas moléculas pequeñas que alteran los complejos proteína-proteína de interacción 7, 8, 9, 10, 11. Sin embargo, los enfoques convencionales de este ensayo, que se utiliza para la detección de drogas o "hits", no permiten la detección de residuos de interacción alostéricos de compuestos químicos en las superficies de la proteína-proteína, que cuando se alteran aún interactuar y permitir el interrogatorio de los residuos alterados 11 . De hecho, un método (s) de tal manera, si es factible desarrollar, permitiría un sistema de levadura manejable para la evaluación de alto rendimiento de los residuos de interacción alostéricos críticos para la proteína-proteína interacción interrupción. En el contexto del descubrimiento de fármacos, la forma más directa para establecer la interacción de los compuestos con proteínas implicaría la determinación estructural (por ejemplo, cristalización del complejo de proteína-inhibidor). Estos métodos son cumbersome, utilizar los recursos elaborados y que no sea técnicamente factible realizar estudios estructurales de cada proteína.

Sistemas de detección de drogas genética tratable se han establecido en las bacterias 1, 2 y otros sistemas modelo, como los mamíferos de dos híbridos. Sin embargo, estos sistemas necesitan optimización y sistemas alternativos como Y2H siguen siendo los más probado en el descubrimiento de fármacos. Hay limitaciones que incluyen poca sensibilidad y fiabilidad de las interacciones utilizando métodos singulares 13, sin embargo, un único ensayo Y2H puede ser modificado para responder a preguntas específicas respecto a los residuos de interacción. En el campo de la investigación de los receptores nucleares, Y2H se ha utilizado para definir las proteínas que interactúan 14, sin embargo, estas interacciones proteína rara vez se han utilizado para definir la naturaleza en el que los ligandos / antagonistas interactúan con complejos de proteína de receptor nuclear. Por lo tanto, nuestro laboratorio se centró esfuerzos en la definición de un método, especialmente para proteínas receptoras que no estánque se presta fácilmente a proteómicos métodos basados, eso sería desenterrar nuevo ligando / antagonista interactuar residuos utilizando una plataforma de descubrimiento Y2H basado inversa.

Basándonos en nuestra anterior conclusión de que el ketoconazol altera PXR y su activador SRC-1, hemos desarrollado un novedoso sistema de reversa Y2H que nos permiten definir e interrogar a los residuos de ketoconazol interactuar en PXR 6. Nuestro método se basa en las propiedades de la proteína GAL4 de levadura que consiste en dominios separables responsables de la activación de unión a ADN y la transcripción. La proteína PXR LBD se expresa como una fusión con el dominio de unión a ADN LexA (ADN-BD), mientras que la longitud total co-activadores SRC-1 (coactivador del receptor de esteroides 1) las proteínas se expresan como fusiones al dominio de activación de GAL4 (AD ). Interacción entre PXR y SRC-1 proteínas de fusión conduce a la activación transcripcional de los sitios de unión de GAL4-que contiene el gen reportero de β-Lac Z que está integrado en el Genom levadurae. Ketoconazol, un antagonista de PXR, interrumpe PXR y SRC-1 interacción 15, 16, 17 y que puede detectar la interacción de PXR y SRC-1 en presencia o ausencia de ketoconazol después de la tinción colonias sobre filtros para la actividad de X-gal. El principio de Y2H se ilustra en la Figura 1 y el procedimiento experimental se resume en la Figura 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Construcción de PXR y SRC-1 Las fusiones en vectores de levadura

  1. La amplificación por PCR de humano PXR LBD (107-434 aminoácidos) y SRC-1 humano de longitud completa (aminoácidos 1 a 1401).
    1. Utilice pSG5-hPXR plásmido 8 como plantilla PXR LBD, utilizar plásmido pCMX-SRC1 como SRC-1 plantillas.
    2. Descongele la PCR Supermix, plantillas de ADN y cebadores (ver Materiales), mantenerlos en hielo.
    3. Añadir 0,25 g / l de ADN plantilla 1 l, 10 mM de pares de cebadores 2 l cada uno, PCR Supermix 45 l y agregar H 2 O para traer volumen total de 50 l.
    4. Conjunto de PCR en un ciclo de 94 ° C durante 2 min, 20 ciclos de 94 ° C durante 30 seg, 55 ° C durante 30 seg y 72 ° C durante 2 min, luego un ciclo de 72 ° C durante 10 min para la extensión. Compruebe los productos de PCR mediante la ejecución de un 1% en gel de agarosa.
  2. Productos de PCR en vectores de clonación Y2H.
    1. Purificar los productos de PCR de 1% en gel de agarosa. Resumen PXR, LBD, la PCR, y Y2H vector de pSH2-1 conBamHI y SalI; digieren SRC-1 PCR y Y2H vector pGADNOT con NotΙ y SalΙ. Para ello, agregue 1 g de ADN, 3 l de 10x tampón de reacción, 1 enzimas de restricción mu l, y, finalmente, H 2 O para traer volumen total de 30 l.
    2. Coloque las muestras de digestión en 37 ° C baño de agua durante 1 hora. Compruebe la digestión mediante la ejecución de un 1% en gel de agarosa.
    3. Purificar muestras de digestión de un 1% en gel de agarosa, ligar digerido productos de PCR y vectores Y2H y transformar a las células competentes DH5a.
    4. Elige las colonias y aislar el ADN plásmido.
  3. Identificar el ADN plásmido pSH2-1-PXR por digestión BamHI / SalI, identificar pGADNOT-SRC-1 ADN plásmido por digestión con NotI / SalI. Verifique todo el ADN plásmido positivo por secuenciación.

2. La levadura de dos ensayos de híbridos

  1. Inocular la cepa de levadura en 5 ml de YPAD e incubar durante la noche por agitación constante (220 rpm a 30 ° C). Nota: La cepa de Saccharomyces cerevisiae era CTY10-5d(Mat A trp ade2 1-901 leu2-3, 112 his3-200 ga l4 - GAL80 - URA3 :: lexA-lacZ) que contiene un gen integrado GAL1-lacZ con lexA operador 10. Para obtener células de levadura viables resistentes a ketoconazol, pero los que no llevar a alteraciones del transportador como una causa de la resistencia a los azoles 18-20, nuevas cepas de levadura CTY10-5d se obtuvieron por primera ERG3 borrado (Δ ERG3) y luego la introducción de deleción adicional en ERG11 (ERG3 Δ / Δ ERG11) genes por recombinación homóloga. Los detalles de la construcción se han descrito en un manuscrito publicado previamente 6.
  2. El día siguiente (por la mañana), inocular la levadura (1:20) en 5 ml de YAPD y se incuba para obtener un OD 600 ~ 0,2 por agitación constante (220 rpm a 30 ° C).
  3. Sedimenten las células a 2000 rpm en una microcentrífuga durante 2 minutos y descartar el sobrenadante. A continuación, lavar el pellet dos veces con agua tratada en autoclave y una vez con 0,1 M LiAc.
  4. Después del lavado final, desechar el sobrenadante y agregar los siguientes reactivos al sedimento celular: 240 l PEG 3500 al 50% w / v, 36 l 1 M LiAc, 50 l 2 mg / ml hervida ssDNA de esperma de salmón, H 2 O 34 l. Vortex para mezclar, añadir 1 g PSH-PXR y 1 mg pGADNOT-SRC-1 DNA y mezclar.
  5. Transferir la mezcla al poliestireno tubo de fondo redondo, agitar la transformación, la mezcla (220 rpm a 30 ° C) durante 30 min. Mueva el tubo a 42 º C baño de agua y se incuba durante 30 min adicionales.
  6. Centrifugar el tubo a 2000 rpm durante 2 min y separar el sobrenadante. Lave pellet una vez con agua tratada en autoclave.
  7. Añadir 100 l de agua estéril en el tubo, vuelva a suspender las células mediante el dedo medio, tocando y pipeta, luego la placa en placas de -His/-Leu Dropout Medio (Formulación por litro -His/-Leu Dropout Medio: 20 g de dextrosa, 1,7 g YNB, 0,67 g CSM-His/-Leu, sulfato de amonio 5 g, 1,5% de agar) y IncUbaté a 30 ° C durante 3-4 días para aislar transformantes.

3. Ensayo Filtro de X-gal

  1. Cortar membrana de nitrocelulosa con el tamaño de una parte de una placa de Petri. Etiquetar la membrana de nitrocelulosa para marcar la orientación.
  2. Coloque membrana de nitrocelulosa previamente marcada en colonias de levaduras, asegurarse de que la membrana está en contacto con la superficie del medio de placa.
  3. Retire la membrana, colóquelo con las colonias hacia arriba sobre un papel de filtro de 3 mm, y colocar la membrana y el papel de filtro a -80 ° C durante 15 min.
  4. Haga solución X-gal. Añadir 50 l 20 mg / ml de X-gal y 15 l β-mercaptoetanol al 5 ml de Z-buffer (tampón 1 L contiene 16,1 g de Na 2 HPO 4 7H 2 O, 5,5 g de NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO4 • 7H 2 O). Si Z tampón se mantuvo a 4 ° C, llevarlo a la temperatura ambiente antes de la adición de estos reactivos.
  5. Coloque dos círculos de papel de filtro de 3 mmen una placa de Petri y déjelos remojar con 5 ml de solución de X-gal. Escurrir el exceso de tampón de la placa de Petri y colocar la membrana de nitrocelulosa con el lado de las colonias hacia arriba.
  6. Cierre la tapa, asegúrese de que la membrana está en contacto completo con el papel de filtro y es completamente mojada. Envuelva la placa de Petri en papel de aluminio y se incuba a 37 ° C durante 30 min para toda la noche.

4. Líquido de ensayo β-gal

  1. Crecer levadura en medio líquido -His/-Leu Dropout a OD 600 de 0,7.
  2. Transferencia de 1 ml de medio en un tubo de microcentrífuga de 1,5 ml y centrifugar a 3000 rpm durante 2 min. Eliminar el sobrenadante.
  3. Añadir 1 ml de tampón Z para volver a suspender el sedimento, se centrifuga a 3000 rpm de nuevo durante 2 min. Eliminar el sobrenadante.
  4. Añadir 150 l de buffer Z con 2ME para volver a suspender el sedimento celular, mezclar a continuación, añadir 50 l de cloroformo y 20 l 0,1% de SDS. Vigorosamente agite la muestra durante 15 segundos.
  5. Añadir 700 l de solución de ONPG (1 mg / ml en Z BUFfer). Ajuste el temporizador, se incuba a 30 ° C el tiempo suficiente para permitir que el color amarillo para el desarrollo y tenga en cuenta el tiempo de reacción total.
  6. Añadir 500 l de 1 M de Na 2 CO 3 para detener la reacción y determinar la absorbancia a 420 nm. El blanco es la solución de ONPG 700 l, más 500 l 1 M Na 2 CO 3.

Calcular Unidades de Miller de la siguiente manera: Miller Unidades = (A420 * 1000) / (A600 * min * ml)

A420: unidades de absorbancia a 420 nanómetros; A600: unidades de absorbancia a 600 nanómetros; min: el tiempo de reacción en minutos; ml: el volumen de reacción en ml

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Se realizó un ensayo para ver si podíamos detectar una lectura colorimétrica de la asociación de PXR y receptor de esteroides coactivador-1 (SRC-1). Dado que la levadura tiene una producción significativa de esterol, que previamente se ha demostrado que la expresión de lacZ en la levadura puede ser inducida sin la necesidad de ligando exógeno adicional. Hemos encontrado que la expresión de lacZ (colonias azules) también es inducida en la cepa de levadura transformada con PXR y SRC-1, sin embargo, no hay inducción de la expresión de LacZ (colonias blancas) en la levadura transformada con vectores vacíos, PXR o SRC-1 individual (Figura 3). Para determinar si el ketoconazol (25 M) interrumpió PXR y SRC-1 interacción en la levadura, placas de réplicas que contienen ketoconazol estaban empapadas de nitrocelulosa y el filtro X-gal, ascensor, y se realizaron ensayos de líquidos β-galactosidasa. Se demuestra que el ketoconazol altera PXR y SRC-1 interacciones en la levadura ya que todas las colonias del filtro de réplica son ahora blanco (que eraTambién se muestra por la reducida significativamente la actividad de β-galactosidasa mediante ensayos enzimáticos líquidos) (Figura 4A). Nos había demostrado en ensayos de mamíferos que el mutante PXR (T248E/K277Q) puede ser activado por un ligando fuerte (por ejemplo, rifampicina), pero es inmune a los efectos antagónicos de ketoconazol 1 7. Del mismo modo, cuando diseñamos el PXR doble mutante (T248E/K277Q) en el plásmido de levadura y luego realizamos transformaciones de levadura con SRC-1, hemos sido capaces de demostrar que las colonias expuestas al ketoconazol todavía conservan LacZ expresión (Figura 4B).

Figura 1
Figura 1. Esquemático que ilustra los principios de la levadura de dos híbridos (Y2H) de ensayo. El ensayo de levadura se ha establecido como un ensayo funcional que permite el aislamiento de mutantes PXR que son RESISTANt a la ketoconazola mediada por la inhibición de SRC-1 interacción. Una, la interacción de dos híbridos inducida por rifampicina-de la proteína de fusión LexA-DB-hPXR con SRC-1 fusionado al dominio de activación de GAL4-(GAL4AC-SRC-1). Los resultados de la interacción en colonias de color azul en un ensayo X-gal, debido a que el reportero LacZ. B, la presencia de ketoconazol interrumpe la interacción inducida por rifampicina de hPXR con SRC-1. X-gal resultados del ensayo en colonias de color blanco. C, la presencia de una mutación (se indica con un asterisco) en hPXR que lo hace inmune a la acción de ketoconazol dará lugar a una colonia azul. D, una modificación adicional de nuestro ensayo en el futuro podría incorporar mutaciones supresoras sitio segundos adicionales (ilustrados con la media luna) que anula el efecto de la primera mutación que podría dar lugar a la interrupción de hPXR-SRC-1 interacción y, por tanto, una colonia blanca en el ensayo X-gal. LexAOp, LexA operón; Galp, promotor Gal4, Lac Z, beta-glalactosidase; DB, LexAOp dominio de unión al ADN de Galp, AC, actodominio ivation; *, mutación (s). (Reproducido de la referencia 6). Haga clic aquí para ver más grande la figura .

Figura 2
Figura 2. Diagrama de Flujo Experimental.

Figura 3
Figura 3. X-gal, ensayo de ascensor, y el ensayo de líquido β-gal. Levadura se transformó con los plásmidos indicados y colonias chapados sometidos a ensayo X-gal ascensor (panel izquierdo) y el ensayo de líquido β-gal (panel derecho). PSH vector vacío + pGADNOT vector vacío (carril 1); PSH-PXR + pGADNOT vector vacío (carril 2); PSH vector vacío + pGADNOT-SRC-1 (carril 3); PSH-PXR + pGADNOT-SRC-1 (carril 4 </ Em>), 5. PSH-INI-1 + pGADNOT-c-Myc (control positivo, el carril 5). (Reproducido de la referencia 6).

Figura 4
Figura 4. Ketoconazol interrumpe de tipo salvaje pero no mutante PXR asociación con coactivador, SRC-1 colonias de levadura fueron réplica en placas que contenían vehículo. (0,2% de DMSO; carril 1) o ketoconazol (25 M; carril 2). A continuación, se llevaron a cabo el ensayo X-gal ascensor (panel izquierdo) y el ensayo de líquido β-gal (panel derecho). Tipo de PXR Wild (A, línea B, 1 y 2) y ketoconazol T248E/K277Q mutante mute (línea B 3 y 4) se muestra en esta figura. (Reproducido de la referencia 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

En nuestro ensayo Y2H modificado, hemos identificado los residuos importantes para las interacciones ketoconazol sobre PXR 6. Desde SRC-1 es un coactivador (y se clonó en el vector de pGADNot), también a prueba si SRC-1 podría activar la expresión de lacZ cuando se clona en el sistema de vector PSH y si esto cambiaría el perfil de activación y / o afectar a la permeabilidad de el ensayo de dos híbridos de levadura. Uso de nuestros plásmidos rediseñados que llevamos a cabo dos ensayos de híbridos en ERG3 Δ / Δ ERG11 levadura. Como antes, mostramos que la expresión de lacZ (colonias azules) también se induce en ERG3 Δ / Δ ERG11 cepa de levadura transformada con PXR y SRC-1, sin embargo, no hay inducción de la expresión de LacZ (colonias blancas) en la levadura transformada con vectores vacíos , PXR o SRC-1 individual (datos no mostrados). Nuestro enfoque proporciona un poderoso nuevo método para el aislamiento de interacción genética residuos allosteric proteína-ligando para las proteínas no susceptibles conventiobiología estructural nal y / o proteómicos enfoques 5,21.

El protocolo que se describe tiene varios escollos que deben ser reconocidos. En primer lugar, la sensibilidad de la detección, especialmente los efectos antagonistas parciales de los residuos de interacción proteína-proteína puede limitar la resolución del ensayo. Escaneo colorimétrico podría ayudar a resolver algunos de la detección emite 21. En segundo lugar, la presencia de colonias de color azul no puede siempre indicar mutaciones resistentes PXR ketoconazol (falso positivo). La expresión de lacZ podría ser rescatado en presencia de ketoconazol debido a la mutación (s) en el PXR que hace que la proteína constitutivamente activa o activa independiente de SRC-1 interacción. Tales mutantes de PXR se pueden distinguir de los verdaderos mutantes resistentes ketoconazol ensayando la capacidad de la LexA-DB-PXR a la libre activar la expresión de lacZ, es decir, estos mutantes producirán colonias azules en ausencia de GAL4AC-SRC-1. Como corolario, los mutantes puede alasí introducido en la levadura utilizando el GAL4AC-plásmido en ausencia de LexA-DB-SRC-1 para describir más pruebas para la auto-activación de LacZ. En tercer lugar, sigue siendo desconocido si se obtendría el mismo resultado si se utilizan otros protocolos Y2H / vectores 13. En cuarto lugar, el estudio de mutantes revertidas intramoleculares (segundo sitio mutantes supresores de mutantes resistentes ketoconazol) puede contribuir a la comprensión de la unión mediante la definición de residuos de vecinos que impactan el farmacóforo vinculante antagonista. Con una modificación de la biblioteca de mutantes, se puede definir esto con más precisión utilizando un mutante ketoconazol resistente como la plantilla de mutagénesis.

Este método se puede modificar para incorporar cualquier fármaco mediante el cual el objetivo citotóxico en la levadura está bien establecido o a un fármaco (s) que no tiene ninguna toxicidad potencial hacia la levadura. La levadura puede ser modificada, como hemos mostrado 6, y aún así sea viable para los ensayos de Y2H. El poder de este método también se basa en informar auxiliaresación de otros ensayos (por ejemplo, conexión molecular) que informan a las interacciones específicas del sitio. Por otra parte, las interacciones específicas de receptores nucleares / coregulator (por ejemplo nurr77/LKB1; AR/PELP1) pueden estudiarse 22,23. La maleabilidad de este sistema es que es portátil, se puede realizar dentro de día en un alto rendimiento y no requiere reactivos o métodos caros.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No hay conflictos de interés declarado.

Acknowledgments

Este trabajo fue financiado por los Institutos Nacionales de Salud (NIH) Otorga CA127231 y el Premio Fundación Damon Runyon Investigador Clínico (IC 1502) (para SM). Nos gustaría dar las gracias al profesor Zdenek Dvorak desde Palacky Universidad de Olomouc, República Checa por sus útiles conocimientos sobre la discusión portabilidad de esta técnica para su institución y estandarización del protocolo.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics