Omvänd jäst två-hybridsystemet för att identifiera Mammalian Nuclear Receptor Stoder som interagerar med ligander och / eller-antagonister

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ketokonazol binder till och motverkar pregnanderivat X Receptor (PXR) aktivering. Jäst hög genomströmning skärmar PXR mutanter definierar en unik region för ketokonazol bindning. Denna jäst-baserad genetisk metod upptäcker nya nukleära receptorinteraktioner med ligander som associerar med ytan bindningsställen.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Som en kritisk regulator av läkemedelsmetabolism och inflammation, pregnan X Receptor (PXR), spelar en viktig roll i sjukdoms patofysiologi bindnings metabolism och inflammation (leversteatos) 1,2. Det har skett stora framsteg i att identifiera agonistligander för PXR, men det finns begränsade beskrivningar av läkemedelsliknande antagonister och deras bindningsställen på PXR 3,4,5. En kritisk barriär har varit oförmågan att effektivt rena fullängds-protein för strukturella studier med antagonister trots att PXR klenades och karakteriserades 1998. Vårt laboratorium utvecklat en ny hög genomströmning jäst baserad två-hybrid analys för att definiera en antagonist, ketokonazol s, bindande rester på PXR 6. Vår metod innebär att skapa mutationsbibliotek som skulle rädda effekten av enkla mutationer på AF-2 yta PXR förväntas interagera med ketokonazol. Rescue eller "gain-of-function" second mutationer kan göras på så sätt att slutsatser avseende den genetiska interaktion av ketokonazol och ytan rest (er) på PXR är genomförbara. Därför utvecklade vi en hög genomströmning två-hybrid jäst skärm PXR mutanter som interagerar med sin coactivator, SRC-1. Med hjälp av denna metod, där jästen ändrades för att rymma studiet av den svampdödande läkemedel, ketokonazol, kunde vi påvisa specifika mutationer på PXR anrikas i kloner som inte kan binda till ketokonazol. Genom omvänd logik, drar vi slutsatsen att de ursprungliga rester är direkta interaktions rester med ketokonazol. Denna analys är en roman, foglig genetisk analys för att skärmen för antagonistbindningsställen på kärnreceptorytor. Denna analys skulle kunna tillämpas på alla läkemedel, oberoende av dess cytotoxiska potential att jäst såväl som till cellulärt protein (er) som inte kan studeras med användning av standard strukturell biologi eller proteomic baserade metoder. Potentiella fallgropar inkluderar tolkning av data (kompletterande metoder användbara), relining på enstaka Y2H metod, kompetens för att hantera jäst eller utför jäst två-hybrid analyser och analysoptimering.

Introduction

Jästen två-hybrid (Y2H)-analys används i stor utsträckning för att upptäcka protein-proteininteraktioner och mer nyligen för upptäckten av nya små molekyler som stör protein-proteininteraktion komplex 7, 8, 9, 10, 11. Men de konventionella metoder för denna analys, som används för läkemedelsforskning eller "träffar", inte tillåter detektion av allosteriska interaktions rester av kemiska föreningar inom protein-proteinytor, att då förändras fortfarande samverka och tillåta förhör av de förändrade resterna 11 . I själva verket, en sådan metod (er), om möjligt att utveckla, skulle göra det möjligt för en lätthanterlig jäst-system för hög genomströmning bedömning av allosteriska interaktions rester kritiska för protein-proteininteraktion störningar. I samband med läkemedelsutveckling, skulle det mest direkta sättet att skapa interaktion av föreningar med proteiner involverar strukturbestämning (t ex kristallisation av protein-inhibitor-komplex). Dessa metoder är cumbersome, använd arbetade resurser och det är inte tekniskt möjligt att genomföra strukturella studier av varje protein.

Lätthanterlig genetiska drogscreeningssystem har etablerats i bakterier 1, 2 och andra modellsystem som däggdjur två-hybrid. Dessa system behöver optimering och alternativa system som Y2H är fortfarande den mest testade i läkemedelsutveckling. Det finns begränsningar som inkluderar dålig känslighet och tillförlitlighet interaktioner använder singulära metoder 13 dock en enda Y2H analys kan modifieras för att svara på specifika frågor om interaktionsrester. På området nukleära receptorer forskning har Y2H använts för att definiera interagerande proteiner 14 dock dessa proteininteraktioner har sällan använts för att fastställa arten där ligander / antagonister interagerar med kärnreceptorproteinkomplex. Alltså, vårt laboratorium fokuserade ansträngningar på att definiera en metod, speciellt för receptorproteiner som intelätt mottaglig för proteomik baserade metoder, som skulle gräva nya ligand / antagonist samverkande rester med hjälp av en omvänd Y2H baserad upptäckt plattform.

Baserat på vår tidigare bedömning att ketokonazol stör PXR och dess aktivator SRC-1, utvecklade vi en ny vända Y2H system som gör det möjligt för oss att definiera och förhöra ketokonazol samverkande rester på PXR 6. Vår metod är baserad på egenskaperna hos jäst GAL4-proteinet som består av separerbara domäner som ansvarar för DNA-bindning och transkriptionsaktivering. Den PXR LBD proteinet uttrycks som en fusion till den LexA DNA-bindande domänen (DNA-BD), medan fullängds samaktivatorer SRC-1 (steroid receptor coactivator 1) proteiner uttrycks som fusioner till GAL4-aktiveringsdomänen (AD ). Interaktion mellan PXR och SRC-1-fusionsproteiner leder till transkriptionell aktivering av GAL4-bindningsställen innehållande reportergen β-Lac Z som är integrerad i jäst Genomete. Ketokonazol, ett PXR antagonist, stör PXR och SRC-1 interaktion 15, 16, 17 och vi kan detektera interaktionen av PXR och SRC-1 i närvaro eller frånvaro av ketokonazol efter färgning kolonier på filtren för X-gal-aktivitet. Principen för Y2H illustreras i figur 1 och den experimentella proceduren sammanfattas i figur 2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Konstruktion av PXR-och SRC-1 Fusioner i jästvektorer

  1. PCR-amplifiering av humant PXR LBD (107-434 aminosyror) och Human SRC-1 full längd (1-1401 aminosyror).
    1. Använd pSG5-hPXR plasmid 8 som PXR LBD mall, använd pCMX-SRC1 plasmid som SRC-1-mallar.
    2. Tina PCR SuperMix, DNA-mallar och primers (se Material), hålla dem på is.
    3. Addera 0,25 ug / ul DNA-mall 1 | il, 10 mM primerpar 2 | il vardera, PCR SuperMix 45 | il och tillsätt H2O att bringa totala volymen till 50 | il.
    4. Ställ PCR vid en cykel av 94 ° C under 2 min, 20 cykler av 94 ° C under 30 sek, 55 ° C under 30 sek och 72 ° C under 2 min, varefter en cykel av 72 ° C under 10 min för förlängning. Kontrollera PCR-produkter genom att köra på en% agarosgel.
  2. PCR-produkter kloning in Y2H vektorer.
    1. Rena PCR-produkter från 1% agarosgel. Sammandrag PXR, LBD, PCR och Y2H vektor pSH2-1 medBamHI-och Sall; smälta SRC-1 PCR och Y2H vektor pGADNOT med NotΙ och SalΙ. För att göra detta, tillsätt 1 | j, g DNA, 3 | il 10 x reaktionsbuffert, 1 pl av restriktionsenzymer, och slutligen H2O för att bringa den totala volymen till 30 | il.
    2. Sätt uppslutnings prover i 37 ° C vattenbad i en timme. Kontrollera digestion genom körning på 1% agarosgel.
    3. Rena uppslutnings prover från 1% agarosgel, ligera spjälkades PCR-produkterna och Y2H vektorer och omvandla till DH5a-kompetenta celler.
    4. Plocka kolonierna och isolera plasmid-DNA.
  3. Identifiera pSH2-1-PXR-plasmid-DNA genom BamHI / Sall-digerering, identifiera pGADNOT-SRC-1 plasmid DNA med Notl / Sall-digerering. Verifiera alla positiva plasmid-DNA genom sekvensering.

2. Jäst två-hybrid Analyser

  1. Inokulera jäststammen i 5 ml YPAD och inkubera över natten genom konstant omrörning (220 varv per minut vid 30 ° C). Obs: Saccharomyces cerevisiae stammen var CTY10-5d(Mat en ade2 trp 1-901 leu2-3, 112 his3-200 ga L4 - Gal80 - URA3 :: lexA-lacZ) som innehåller en integrerad GAL1-lacZ genen med lexA operatör 10. För att erhålla livsdugliga jästceller som är resistenta mot ketokonazol, men de som inte bär transportören förändringar som orsak till azol motstånd 18-20, nya stammar av CTY10-5d jäst erhölls genom att först ta bort ERG3 (erg3 Δ) och därefter införa ytterligare deletion i ERG11 (erg3 Δ / ERG11 Δ) gener genom homolog rekombination. Detaljerna konstruktion har beskrivits i en tidigare publicerad manuskript 6.
  2. Nästa dag (på morgonen), ympa jäst (1:20) i 5 ml YAPD och inkubera att få en OD 600 ~ 0,2 med konstant omrörning (220 rpm vid 30 ° C).
  3. Pelletera cellerna vid 2000 rpm i en mikrocentrifug under 2 minuter och kassera supernatanten. Tvätta sedan av pellet två gånger med autoklaverat vatten och en gång med 0,1 M LiAc.
  4. Efter den sista tvätten, kassera supernatanten och lägga till följande reagenser till cellpelleten: 240 l PEG 3500 50% w / v, 36 pl 1 M LiAc, 50 ^ 2 mg / ml kokt lax spermier ssDNA, H 2 O 34 pl. Vortex att blanda, tillsätt 1 mikrogram PSH-PXR och 1 mikrogram pGADNOT-SRC-1-DNA och blanda.
  5. Överför blandningen till polystyren med rund botten rör, agitera omvandlingen, blanda (220 rpm vid 30 ° C) under 30 min. Flytta röret till 42 ° C vattenbad och inkubera under ytterligare 30 min.
  6. Centrifugera röret vid 2000 rpm i 2 min och avlägsna supernatanten. Tvätta pelleten en gång med autoklaverat vatten.
  7. Tillsätt 100 l sterilt vatten i röret, slamma upp cellerna under lätt finger tapping och pipettering, sedan plattan på plattor av -His/-Leu Dropout Medium (Formulering per en liter -His/-Leu Dropout Medium: 20 g dextros, 1,7 g YNB, 0,67 g CSM-His/-Leu, 5 g ammoniumsulfat, 1,5% agar) och inklUbaté vid 30 ° C under 3-4 dagar för att isolera transformanter.

3. X-gal-filteranalys

  1. Skär nitrocellulosamembran till storleken på en del av en petriskål. Märk nitrocellulosamembran för att markera orientering.
  2. Placera preparerade nitrocellulosamembran på jästkolonier, se till att membranet är i kontakt med ytan av plattan mediet.
  3. Ta bort membranet, placera den med kolonisidan upp på en 3 mm filterpapper, och placera membranet och filterpapper vid -80 ° C under 15 min.
  4. Lägg ett X-gal-lösning. Tillsätt 50 | il 20 mg / ml X-gal och 15 | il β-merkaptoetanol till 5 ml av Z-buffert (1 L buffert innehåller 16,1 g Na 2 HPO 4 7 H2O, 5,5 g NaH 2 PO 4 H2O, 0,75 g KCl, 0,25 g MgSO 4 • 7H 2 O). Om Z-buffert hölls vid 4 ° C, ta med den till rumstemperatur innan du lägger dessa reagenser.
  5. Placera två cirklar av 3 mm filterpapperi en petriskål och blöta dem med 5 ml X-gal-lösning. Töm överskottsbuffert från petriskål och placera nitrocellulosamembran med kolonisidan uppåt.
  6. Stäng locket, se till att membranet gör helt i kontakt med filterpapper och det är helt blött. Vira petriskålens i folie och inkubera vid 37 ° C under 30 min till över natten.

4. Vätska β-gal-analys

  1. Väx Jäst i -His/-Leu dropout flytande medium till OD 600 0,7.
  2. Överför 1 ml medium i ett 1,5 ml mikrocentrifugrör och centrifugera vid 3000 rpm under 2 min. Kasta bort supernatanten.
  3. Tillsätt 1 ml Z-buffert för att resuspendera pelleten, centrifugera vid 3000 rpm på nytt i 2 min. Kasta bort supernatanten.
  4. Tillsätt 150 l av Z-buffert med 2ME att resuspendera cellpelleten, blanda sedan 50 l kloroform och 20 l 0,1% SDS. Kraftfullt virvel provet för 15 sek.
  5. Lägg till 700 l av ONPG lösning (1 mg / ml i Z-buffer). Ställ in timern, inkubera vid 30 ° C tillräckligt lång för att den gula färgen utvecklas och notera total reaktionstid.
  6. Addera 500 pl av 1 M Na 2 CO 3 för att stoppa reaktionen och bestämma absorbansen vid 420 nm. Ämnet är 700 l ONPG-lösning plus 500 pl 1 M Na 2 CO 3.

Beräkna Miller Heter enligt följande: Miller Units = (A420 * 1.000) / (A600 * min * ml)

A420: absorbansenheter vid 420 nanometer, A600: absorbansenheter vid 600 nanometer, min: reaktionstiden i minuter, ml: reaktionsvolymen i ml

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi utförde en analys för att se om vi kunde upptäcka en kolorimetrisk avläsning av föreningen för PXR och steroidreceptor coactivator-1 (SRC-1). Eftersom jäst har betydande sterol produktion har det tidigare visats att lacZ-expression i jäst kan induceras utan behov av extra exogen ligand. Vi fann att lacZ-uttrycket (blå kolonier) också induceras i jäststam transformerad med PXR och SRC-1, men det finns ingen induktion av LacZ-expression (vita kolonier) i jäst transformerad med tomma vektorer, PXR eller SRC-en individuellt (Figur 3). För att bestämma huruvida ketokonazol (25 pM) störs PXR och SRC-1 interaktion i jäst var replika plattor innehållande ketokonazol indränkt med nitrocellulosa och X-gal-filter, hiss och β-galaktosidas-vätskeanalyser utfördes. Vi visar att ketokonazol stör PXR och SRC-1 interaktioner i jäst eftersom alla kolonier från repliken filtret var nu vit (som varvisas också av den signifikant reducerad β-galaktosidasaktivitet genom flytande enzymatiska analyser) (Figur 4A). Vi hade tidigare visat i däggdjurs analyser som PXR mutanten (T248E/K277Q) kan aktiveras av en stark ligand (t ex rifampicin) men är immun mot de antagonistiska effekter av ketokonazol 1 7. Likaså när vi iscensatte PXR dubbel mutant (T248E/K277Q) i jästplasmiden och sedan utfört jästtransformationer med SRC-1, kunde vi visa att kolonierna som utsätts för ketokonazol fortfarande kvar LacZ uttryck (Figur 4B).

Figur 1
Figur 1. Schematiskt visar principerna för jäst två-hybrid (Y2H)-analys. Jästen assay har etablerats som en funktionell analys som möjliggör isolering av PXR mutanter som är resistant för att ketokonazol medierad hämning av SRC-1-interaktion. En rifampicin-inducerade två-hybrid-interaktion av LexA-DB-hPXR fusionsprotein med SRC-1 fuserad till GAL4-aktiveringsdomänen (GAL4AC-SRC-1). Interaktions ger blå kolonier i en X-gal-analysen på grund av LacZ reporter. B, närvaro av ketokonazol stör rifampicin-inducerade interaktion av hPXR med SRC-1. X-gal-analysen resulterar i vita kolonier. C, närvaron av en mutation (anges med en asterisk) i hPXR som gör den okänslig för verkan av ketokonazol kommer att ge en blå koloni. D, en ytterligare modifikation av vår analys i framtiden kan införliva ytterligare andra plats suppressormutationer (illustrerade med halvmåne) omintetgöra effekten av första mutationen som kan leda till avbrott i hPXR-SRC-1 interaktionen och därmed en vit koloni i X-gal-analysen. LexAOp, LexA-operonet; Galp, Gal4-promotorn, Lac Z-, beta-glalactosidase; DB, LexAOp DNA-bindande domänen hos Galp, AC, ageraivation domän, *, mutation (er). (Återgiven från referens 6). Klicka här för att visa en större bild .

Figur 2
Figur 2. Experimentell Flödesschema.

Figur 3
Figur 3. X-gal, hissen assay och β-gal-vätskeanalys. Jäst transformerades med angivna plasmider och ströks kolonier utsattes för X-gal hiss analys (vänster panel) och β-gal-vätskeanalys (höger panel). PSH tom vektor + pGADNOT tom vektor (rad 1), PSH-PXR + pGADNOT tom vektor (spår 2); PSH tom vektor + pGADNOT-SRC-1 (bana 3); PSH-PXR + pGADNOT-SRC-1 (spår 4 </ Em>), 5. PSH-INI-1 + pGADNOT-c-Myc (positiv kontroll, bana 5). (Återges från referens 6).

Figur 4
Figur 4. Ketokonazol stör vildtyp men inte mutant PXR association med coactivator, SRC-1 jäst kolonier replik på plattor innehållande fordon. (0,2% DMSO, rad 1) eller ketokonazol (25 ^ M, bana 2). X-gal hiss analys (vänster panel) och β-gal-vätskeanalys (höger fält) utfördes sedan. Vildtyp PXR (A, B linje 1 och 2) och ketokonazol mute mutant T248E/K277Q (B linje 3 och 4) visade i denna figur. (Återges från referens 6).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I vår modifierade Y2H analys har vi identifierat viktiga rester för ketokonazol interaktioner på PXR 6. Eftersom SRC-1 är en coactivator (och klonades in i pGADNot vektorn), vi testade även om SRC-1 kan aktivera lacZ uttryck när klonad i PSH vektorsystem och om detta skulle förändra aktiveringsprofil och / eller påverka leakiness av jäst-två-hybridanalys. Med hjälp av våra omgjorda plasmider vi utförde två-hybrid analyser i erg3 Δ / ERG11 Δ jäst. Som tidigare, visar vi att lacZ-uttrycket (blå kolonier) också induceras i erg3 Δ / ERG11 Δ jäststam transformerad med PXR och SRC-1, men det finns ingen induktion av LacZ-expression (vita kolonier) i jäst transformerad med tomma vektorer , PXR eller SRC-1 individuellt (data visas ej). Vår strategi ger en kraftfull ny metod för isolering av genetisk interaktion allosteric ligand-proteinrester för proteiner som inte kan bli föremål för Conventionella strukturbiologi och / eller proteomik närmar sig 5,21.

Protokollet som beskrivs har flera fallgropar som måste erkännas. Först, känslighet för upptäckt, särskilt de partiella antagonisteffekter på protein-proteininteraktioner rester kan begränsa upplösningen av analysen. Kolorimetrisk scanning kan hjälpa till att lösa en del av upptäckten frågor 21. För det andra, kan närvaron av blå kolonier inte alltid indikerar ketokonazol resistenta PXR mutationer (falskt positiva). LacZ expression kunde räddas i närvaro av ketokonazol på grund av mutation (er) i PXR som gör proteinet konstitutivt aktiv eller aktiv oberoende av SRC-1-interaktion. Sådana mutanter av PXR kan särskiljas från de verkliga ketokonazol resistenta mutanter genom att testa förmågan hos LexA-DB-PXR att själv aktivera lacZ-uttryck, dvs dessa mutanter kommer att ge blå kolonier i frånvaro av GAL4AC-SRC-1. Som en naturlig följd, mutanter kan alså införes i jäst med användning av GAL4AC-plasmid i frånvaro av LexA-DB-SRC-1 att ytterligare beskriva bevis för själv-aktivering av LacZ. För det tredje, är det fortfarande okänt om samma resultat skulle erhållas om andra Y2H protokoll / vektorer användes 13. För det fjärde, kan studiet av intramolekylära reverterande mutanter (andra plats suppressor mutanter av ketokonazol-resistenta mutanter) lägga till förståelsen av antagonisten bindande genom att definiera grann rester som påverkar bindande farmakoforen. Med en modifiering av bibliotek av mutanter, kan man definiera detta mer exakt med hjälp av ett ketokonazol-resistent mutant som mutagenes mallen.

Detta förfarande kan modifieras för att inkorporera någon drog varvid det cytotoxiska målet i jäst är väl etablerad eller till en drog (er) som inte har någon potentiell toxicitet mot jäst. Jästen kan ändras, eftersom vi har visat 6, och fortfarande vara lönsamt för Y2H analyser. Kraften i denna metod förlitar sig också på sido informeraation från andra analyser (t.ex. molekyl dockning) som informerar platsspecifika interaktioner. Dessutom specifika nukleära receptorer / coregulator interaktioner (t.ex. nurr77/LKB1, AR/PELP1) kan studeras 22,23. Den spårbarhet med detta system är att den är bärbar, kan utföras inom några dagar i en hög genomströmning sätt och inte kräver dyra reagens och metoder.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

Detta arbete stöddes av National Institutes of Health (NIH) Grants CA127231 och The Damon Runyon Foundation Clinical Investigator Award (CI 1502) (SM). Vi vill tacka professor Zdenek Dvorak från Palacky University Olomouc, Tjeckien för hans hjälp insikter diskutera överföra denna teknik till sin institution och standardisering av protokoll.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics