Reverse-Hefe-Zwei-Hybrid-System an Säugetier Nuclear Receptor Rückstände Identifizieren Sie, dass Interagieren Sie mit Liganden und / oder Antagonisten

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Ketoconazol bindet und antagonisiert Pregnane X-Rezeptor (PXR) Aktivierung. Hefe-Hochdurchsatz-Screening von Mutanten PXR definieren eine einzigartige Region für Ketoconazol verbindlich. Diese Hefe-basierten genetischen Methode entdeckt neue Kernrezeptor-Interaktionen mit Liganden, die mit Oberflächenbindungsstellen zuordnen.

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Als ein entscheidender Regulator des Arzneimittelstoffwechsel und Entzündung, Pregnane X-Rezeptor (PXR), spielt eine wichtige Rolle in der Pathophysiologie Krankheit Verknüpfung Stoffwechsel und Entzündungen (z. B. Fettleber) 1,2. Es hat viele Fortschritte bei der Identifizierung von Liganden für PXR-Agonisten, jedoch gibt es begrenzte Beschreibungen arzneimittelähnlichen Antagonisten und ihre Bindungsstellen auf PXR 3,4,5. Ein kritisches Hindernis war die Unfähigkeit, effizient reinigen Protein voller Länge für Strukturuntersuchungen mit Antagonisten obwohl PXR wurde 1998 kloniert und charakterisiert. Unser Labor entwickelt einen neuartigen Hochdurchsatz-Hefe-basierten Zwei-Hybrid-, ein Antagonist, Ketoconazol definieren, Bindungsreste auf PXR 6. Unsere Methode umfasst das Erstellen Mutations Bibliotheken, die die Wirkung der einzelnen Mutationen auf die AF-2 Oberfläche des PXR erwartet, dass mit Ketoconazol interagieren zu retten wäre. Rettung oder "Gain-of-function" second Mutationen vorgenommen, so daß Rückschlüsse auf die genetische Interaktion von Ketoconazol und der Oberflächenrest (e) auf PXR realisierbar werden. So entwickelten wir einen hohen Durchsatz Hefe-Zwei-Hybrid-Bildschirm des PXR Mutanten die Interaktion mit seinen Co-Aktivator, SRC-1. Mit diesem Ansatz, bei dem die Hefe wurde modifiziert, um die Untersuchung des Antimykotikums, Ketoconazol aufnehmen, könnten wir bestimmte Mutationen auf PXR in Klonen nicht auf Ketoconazol binden angereichert demonstrieren. Durch die umgekehrte Logik schließen wir, dass die Original-Reste sind direkte Interaktion Reste mit Ketoconazol. Dieser Test stellt eine neuartige, gefügig genetischen Test zum Screening auf-Antagonist-Bindungsstellen auf Kernrezeptor-Oberflächen. Dieser Assay kann zu jedem Medikament unabhängig von seiner zytotoxischen Potential, Hefe sowie zur zellulären Protein (e), die unter Verwendung von Standardstrukturbiologie oder Proteom-basierte Verfahren nicht untersucht werden können, angewendet werden. Mögliche Fallstricke beinhalten Interpretation der Daten (komplementäre Methoden sinnvoll), Zuverlässigkeitrung auf einzelne Y2H Verfahren, Know-how im Umgang mit Hefe-oder Durchführen Hefe-Zwei-Hybrid-Assays und Assay-Optimierung.

Introduction

Das Hefe-Zwei-Hybrid (Y2H) Assay wird häufig verwendet, um Protein-Protein-Wechselwirkungen zu entdecken und vor kurzem zur Entdeckung von neuen kleinen Molekülen, die Protein-Protein-Wechselwirkung Komplexe 7, 8, 9, 10, 11 zu stören. Die herkömmlichen Ansätze dieses Tests, für die Wirkstoffforschung oder "Treffer" verwendet werden, nicht für die Detektion von allosterischen Interaktion Rückstände von Chemikalien, Verbindungen, die in Protein-Protein-Oberflächen, ermöglichen, dass, wenn noch verändert interagieren und ermöglichen eine Abfrage der geänderten Reste 11 . Tatsächlich ist ein solches Verfahren (e), wenn möglich, zu entwickeln, würde eine lenkbar Hefe-System für die Bewertung der allosterische Wechselwirkung Reste kritisch für die Protein-Protein-Wechselwirkung Unterbrechung zu ermöglichen. Im Rahmen der Wirkstoffentwicklung, würde der direkteste Weg zur Wechselwirkung der Verbindungen mit Proteinen herzustellen beinhalten Strukturbestimmung (z. B. Kristallisation von Protein-Inhibitor-Komplexes). Diese Methoden sind cumbersome verwenden aufwendigen Ressourcen und es technisch nicht möglich, Strukturuntersuchungen an jedem Protein durchzuführen.

Tractable genetische Wirkstoff-Screening-Systeme in Bakterien 1, 2 und andere Modellsysteme wie Säugetier-Zwei-Hybrid etabliert. Allerdings müssen diese Systeme Optimierung und alternative Systeme wie Y2H sind immer noch die am meisten in der Wirkstoffforschung getestet. Es gibt Grenzen, die geringe Empfindlichkeit und Zuverlässigkeit der Wechselwirkungen mit singulären Methoden 13 enthalten, auf eine einzige Y2H-Assay modifiziert werden, um spezielle Fragen zu beantworten Interaktion Rückstände. Im Bereich der Kernrezeptorforschung Y2H wurde verwendet, um interagierende Proteine ​​14 definieren, jedoch sind diese Protein-Wechselwirkungen wurden selten verwendet worden, um die Art, in der die Liganden / Antagonisten die Interaktion mit nukleären Rezeptor-Protein-Komplexe bilden. Somit unserem Labor konzentriert Bemühungen auf eine Methode zu definieren, vor allem für Rezeptorproteine, die nichtleicht zu einer Proteom-basierte Verfahren, das wäre neuartige Ligand / Antagonist Interaktion Rückstände mit einem Reverse-Discovery-Plattform basierend Y2H auszugraben.

Aufgrund unserer bisherigen Erkenntnis, dass Ketoconazol stört PXR und seine Aktivator SRC-1, entwickelten wir eine neuartige Umkehr Y2H System, das uns ermöglichen, auf PXR 6 zu definieren und zu verhören Ketoconazol Interaktion Rückstände. Unser Verfahren basiert auf den Eigenschaften des Hefe-GAL4-Protein, das von trennbaren Domänen für die DNA-Bindung und Transkriptionsaktivierung verantwortlich besteht basiert. PXR LBD-Protein als Fusion mit dem LexA-DNA-Bindungsdomäne (DNA-BD) ausgedrückt, während die volle Länge Coaktivatoren SRC-1 (Steroid-Rezeptor-Coaktivator 1) Proteine ​​als Fusionen mit der GAL4-Aktivierungsdomäne exprimiert (AD ). Die Interaktion zwischen PXR und SRC-1-Fusionsproteinen führt zur Transkriptionsaktivierung von GAL4-Bindungsstellen enthält Reportergen β-Lac Z, die in den Hefe-Genom integriert istE. Ketoconazol, ein PXR-Antagonisten, stört PXR und SRC-1-Wechselwirkung 15, 16, 17, und wir können die Wechselwirkung von PXR in Gegenwart oder Abwesenheit von Ketoconazol nach Färbung Kolonien auf den Filtern für die X-gal-Aktivität nachzuweisen und SRC-1. Das Prinzip der Y2H ist in Fig. 1 dargestellt und das experimentelle Verfahren ist in Fig. 2 zusammengefaßt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Bau von PXR und SRC-1-Fusionen in Hefe-Vektoren

  1. PCR-Amplifikation der Menschen PXR LBD (107-434 Aminosäuren) und Menschen SRC-1 voller Länge (1 bis 1401 Aminosäuren).
    1. Verwenden pSG5-hPXR Plasmid 8 als PXR LBD-Vorlage, verwenden Sie pCMX SRC1-Plasmid als SRC-1-Vorlagen.
    2. Tauwetter SuperMix PCR, DNA-Template und Primer (siehe Materialien), halten Sie sie auf Eis.
    3. In 0,25 ug / ul ul DNA-Vorlage 1, 10 mM Primerpaare jeweils 2 ul, 45 ul PCR SuperMix und fügen H 2 O auf ein Gesamtvolumen von 50 ul zu bringen.
    4. Eingestellt PCR bei einem Zyklus von 94 ° C für 2 min, 20 Zyklen von 94 ° C für 30 sec, 55 ° C für 30 sec und 72 ° C für 2 min, dann einen Zyklus von 72 ° C für 10 min zur Erweiterung. Überprüfen PCR-Produkte von über 1% Agarose-Gel läuft.
  2. PCR-Produkte, die Klonierung in Y2H Vektoren.
    1. Reinige PCR-Produkten aus 1% Agarose-Gel. Digest PXR, LBD, PCR und Y2H Vektor pSH2-1 mitBamHI und SalI; verdauen SRC-1 PCR und Y2H Vektor pGADNOT mit NotΙ und SalΙ. Um dies zu tun, fügen Sie 1 ug DNA, 3 ul 10x Reaktionspuffer, 1 ul Restriktionsenzymen und schließlich H 2 O auf ein Gesamtvolumen von 30 ul zu bringen.
    2. Setzen Verdauung Proben in 37 ° C Wasserbad für 1 Stunde. Überprüfen Verdauung durch auf 1% Agarose-Gel läuft.
    3. Reinige Verdauung Proben aus 1% Agarosegel, Ligat verdauten PCR-Produkte und Y2H Vektoren und Transformation auf DH5 &agr; kompetente Zellen.
    4. Wählen Sie die Kolonien und Isolierung der Plasmid-DNA.
  3. Identifizieren pSH2-1-PXR Plasmid-DNA durch BamHI / SalI Verdauung, identifizieren pGADNOT-SRC-1 Plasmid-DNA durch NotI / SalI Verdauung. Überprüfen Sie alle positiven Plasmid-DNA durch Sequenzierung.

2. Hefe-Zwei-Hybrid-Assays

  1. Impfen den Hefestamm in 5 ml YPAD und Inkubation über Nacht von ständigem Rühren (220 UpM bei 30 ° C). Hinweis: Der Saccharomyces cerevisiae-Stamm war CTY10-5d(MAT ein ade2 trp 1-901 leu2-3, 112-200-ga his3 l4 - GAL80 - URA3 :: lexA-lacZ), die eine integrierte GAL1-lacZ-Gen mit lexA Betreiber 10 enthält. Um lebensfähigen Hefezellen resistent gegen Ketoconazol erhalten, sondern diejenigen, die nicht-Transporter Veränderungen als Ursache von Azol-Widerstand 18-20, neue Stämme von CTY10-5d Hefe tragen hatten, wurden durch erste Lösch ERG3 (ERG3 Δ) erhalten und dann die Einführung zusätzlicher Deletion in ERG11 (ERG3 Δ / Δ ERG11)-Gene durch homologe Rekombination. Die konstruktiven Details wurden in einer zuvor veröffentlichten Manuskript 6 beschrieben.
  2. Am nächsten Tag (morgens), impfen Hefe (1:20) in 5 ml YAPD und Inkubation eine OD 600 ~ 0,2 von ständigem Rühren (220 UpM bei 30 ° C) zu erhalten.
  3. Pellet die Zellen bei 2000 rpm in einer Mikrozentrifuge für 2 min und den Überstand verwerfen. Dann waschen Sie die pellet zweimal mit autoklaviertem Wasser und einmal mit 0,1 M LiAc.
  4. Nach dem letzten Waschüberstand verwerfen und fügen Sie die folgenden Reagenzien zu dem Zellpellet: 240 ul PEG 3500 50% w / v, 36 ul 1 M LiAc, 50 ul 2 mg / ml Lachssperma-ssDNA gekocht, H 2 O 34 ul. Vortex zu mischen, 1 ug PSH-PXR und 1 ug pGADNOT-SRC-1-DNA und mischen.
  5. Übertragen Sie die Mischung auf Rundrohr (bei 30 ° C 220 rpm) für 30 min Polystyrol, agitieren die Transformation, mischen. Bewegen Sie das Rohr auf 42 ° C Wasserbad inkubiert und für weitere 30 min.
  6. Zentrifugieren bei 2.000 rpm für 2 min und Überstand. Einmal waschen Pellet mit autoklaviertem Wasser.
  7. Je 100 ul sterilem Wasser in das Rohr, erneut zu suspendieren, die Zellen durch leichtes Fingertippen und Pipettieren, dann auf Platten von -His/-Leu Dropout Medium (Formulierung pro Liter -His/-Leu Dropout-Medium-Platte: 20 g Dextrose, 1,7 g YNB, 0,67 g CSM-His/-Leu, 5 g Ammoniumsulfat, 1,5% Agar) und incUbate bei 30 ° C für 3-4 Tage, um Trans isolieren.

3. X-gal-Filter-Assay

  1. Geschnitten Nitrocellulosemembran auf die Größe des Teils der Petrischale. Beschriften Sie die Nitrocellulose-Membran, um die Orientierung zu markieren.
  2. Zeigen vormarkierten Nitrozellulosemembran auf Hefe-Kolonien, stellen Sie sicher, dass die Membran in Kontakt mit der Oberfläche der Platte Medium.
  3. Entfernen Sie die Membran, legen Sie sie Kolonieseite nach oben auf einem 3 mm Filterpapier und legen Sie die Membran und das Filterpapier bei -80 ° C für 15 min.
  4. Stellen Sie X-gal-Lösung. Dann werden 50 &mgr; l 20 mg / ml X-gal und 15 ul β-Mercaptoethanol auf 5 ml Z-Puffer (1 l Puffer enthält 16,1 g Na 2 HPO 4 · 7H 2 O, 5,5 g NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO 4 • 7H 2 O). Wenn Z-Puffer wurde bei 4 º C gehalten wurde, bringen es auf Raumtemperatur vor der Zugabe dieser Reagenzien.
  5. Legen Sie zwei Kreise von 3 mm Filterpapierin einer Petrischale und genießen sie mit 5 ml X-gal-Lösung. Überschüssiges Puffer aus der Petrischale und legen Sie die Nitrocellulosemembran mit der Kolonieseite nach oben.
  6. Schließen Sie den Deckel, sicherzustellen, dass die Membran macht vollständigen Kontakt mit dem Filterpapier und es ist völlig nass ist. Wickeln die Petrischale in Folie und bei 37 ° C für 30 min bis über Nacht.

4. Flüssig β-Gal-Assay

  1. Wachsen Hefe in -His/-Leu Dropout flüssigen Medium bis DA 600 0,7.
  2. 1 ml Medium in ein 1,5 ml Mikrozentrifugenröhrchen und Zentrifuge bei 3.000 Upm 2 min. Überstand verwerfen.
  3. 1 ml Z-Puffer, um das Pellet, Zentrifuge bei 3.000 Upm für 2 Minuten wieder zu resuspendieren. Überstand verwerfen.
  4. In 150 ul Z-Puffer mit 2ME, um die Zellpellet resuspendieren, mischen dann fügen Sie 50 ul Chloroform und 20 ul 0,1% SDS. Kräftig vortexen die Probe für 15 Sekunden.
  5. Add 700 ul ONPG-Lösung (1 mg / ml in Z buffer). Stellen Sie den Timer, Inkubation bei 30 ° C lange genug, damit die gelbe Farbe zu entwickeln und zu beachten Gesamtreaktionszeit.
  6. Gib 500 &mgr; l 1 M Na 2 CO 3, um die Reaktion zu stoppen, und wird die Absorption bei 420 nm auf. Der Rohling wird 700 ul ONPG-Lösung plus 500 ul 1 M Na 2 CO 3.

Berechnen Miller Einheiten wie folgt: Miller Units = (A420 * 1000) / (A600 * min * ml)

A420: Absorptionseinheiten bei 420 Nanometern; A600: Absorptionseinheiten bei 600 Nanometer; min: die Reaktionszeit in Minuten; ml: Reaktionsvolumen in ml

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Wir führten einen Test, um zu sehen, ob wir ein farbmetrische Auslesen der Vereinigung von PXR und Steroid-Rezeptor Co-Aktivator-1 (SRC-1) zu erkennen. Da Hefe signifikante Sterol-Produktion, ist früher gezeigt worden, dass die lacZ-Expression in Hefe kann ohne die Notwendigkeit für zusätzliche exogene Liganden induziert werden. Wir fanden, dass lacZ-Expression (blaue Kolonien) ist auch in den Hefestamm mit PXR und SRC-1 transformiert induziert, jedoch gibt es keine Induktion des LacZ-Expression (weiße Kolonien) in Hefe mit leeren Vektoren, PXR oder SRC-1 einzeln umgewandelt (Abbildung 3). Um festzustellen, ob Ketoconazol (25 uM) gestört PXR und SRC-1-Wechselwirkung in Hefe wurden Replika-Platten mit Ketoconazol enthalten Nitrocellulose und X-gal-Filter, Lift eingeweicht und β-Galactosidase Flüssigkeit Assays wurden durchgeführt. Wir zeigen, dass Ketoconazol stört PXR und SRC-1-Interaktionen in Hefe, da alle Kolonien von der Replik-Filter waren jetzt weiß (was warAuch durch die deutlich verringerte β-Galactosidase-Aktivität von flüssigen enzymatischen Assays) (4A) gezeigt ist. Wir hatten zuvor in Säugetier-Assays, die PXR-Mutante (T248E/K277Q) durch einen starken Liganden (z. B. Rifampicin) aktiviert werden gezeigt, jedoch ist immun gegen die antagonistische Wirkung von Ketoconazol 1 7. Ebenso, wenn wir technisch die PXR Doppelmutante (T248E/K277Q) in der Hefe-Plasmid und dann durchgeführt, Hefe-Transformationen mit SRC-1, konnten wir zeigen, dass die Kolonien auf Ketoconazol ausgesetzt noch LacZ-Expression (4B) zu behalten.

Figur 1
Fig. 1 ist. Schematische Darstellung der Prinzipien der Hefe-Zwei-Hybrid (Y2H)-Assay. Die Hefe-Assay wurde als ein Funktionstest, die für die Isolierung von Mutanten, die PXR resistan sind erlaubt etabliertt, um vermittelte Hemmung der SRC-1 Interaktion Ketoconazol. A, Rifampicin-induzierten Zwei-Hybrid-Interaktion von LexA-DB-hPXR Fusionsprotein mit SRC-1 bis GAL4-Aktivierungsdomäne (GAL4AC-SRC-1) fusioniert. Die Wechselwirkung führt zu blauen Kolonien auf einem X-gal-Assay aufgrund des LacZ-Reporter. B Anwesenheit von Ketoconazol stört die Rifampicin-induzierte Wechselwirkung von hPXR mit SRC-1. X-gal-Assay-Ergebnisse in weißen Kolonien. C, Vorhandensein einer Mutation (mit * gekennzeichnet), die in hPXR macht sie immun gegen die Wirkung von Ketoconazol wird ergeben eine blaue Kolonie. D, eine weitere Modifikation der Assay in der Zukunft könnte beinhalten zusätzliche zweite Website-Suppressor-Mutationen (mit Halbmond dargestellt) Aufheben der Wirkung der ersten Mutation, die zur Störung der hPXR-SRC-1-Interaktion und damit eine weiße Kolonie in der X-Gal-Test führen kann. LexAOp, LexA-Operon, Galp, Gal4-Promotor, Lac Z, Beta-glalactosidase, DB, LexAOp DNA-bindende Domäne von Galp, AC, handelnivation Domäne, *, Mutation (en). (Wiedergabe aus Lit. 6). Klicken Sie hier, um eine größere Abbildung anzuzeigen .

Figur 2
2. Experimentelle Flow Chart.

Fig. 3
3. X-gal, Lift Assay und β-gal Flüssigkeitstest. Hefe wurde mit angegeben Plasmide und plattiert Kolonien auf X-gal-Lift-Assay (links) und β-Gal-Flüssigkeitstest (rechts) unterzogen umgewandelt. PSH leeren Vektor + pGADNOT leeren Vektor (Spur 1); PSH-PXR + pGADNOT leeren Vektor (Spur 2); PSH leeren Vektor + pGADNOT-SRC-1 (Spur 3); PSH-PXR + pGADNOT-SRC-1 (Bahn 4 </ Em>), 5. PSH-INI-1 + pGADNOT-c-Myc (Positivkontrolle, Spur 5). (Von Referenz 6 wiedergegeben).

Fig. 4
4. Ketoconazol stört Wildtyp, aber nicht mutierten PXR Zusammenarbeit mit Co-Aktivator, SRC-1 Hefe-Kolonien waren Replik in Platten Fahrzeugs enthält. (0,2% DMSO, Spur 1) oder Ketoconazol (25 uM, Spur 2). X-gal-Lift-Assay (links) und β-Gal-Flüssigkeitstest (rechts) wurden dann durchgeführt. Wildtyp-PXR (A, B-Linie 1 und 2) und Ketoconazol Stumm T248E/K277Q Mutante (B-Linie 3 und 4) wurden in dieser Abbildung gezeigt. (Von Referenz 6 wiedergegeben).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In unserer modifizierten Y2H-Assay haben wir wichtige Reste für Ketoconazol Interaktionen auf PXR 6 identifiziert. Seit SRC-1 ist ein Co-Aktivator (und wurde in die pGADNot kloniert), haben wir auch getestet, ob SRC-1 könnte lacZ-Expression, wenn sie in der PSH-Vektorsystem kloniert aktivieren und ob dies die Aktivierungsprofil ändern und / oder auf die Undichtigkeit die Hefe-Zwei-Hybrid-Assay. Mit unserem neu gestalteten Plasmide wir in ERG3 Δ / Δ ERG11 Hefe-Zwei-Hybrid-geführt Assays. Nach wie vor zeigen wir, dass lacZ-Expression (blaue Kolonien) ist auch in ERG3 Δ / Δ ERG11 Hefestamm mit PXR und SRC-1 transformiert induziert, jedoch gibt es keine Induktion von LacZ-Expression (weiße Kolonien) in Hefe mit leeren Vektoren transformiert , PXR oder SRC-1 einzeln (Daten nicht gezeigt). Unser Ansatz bietet eine leistungsstarke neue Methode zur Isolierung von genetischen Interaktion allosterischer Ligand-Protein-Rückstände für Proteine ​​nicht zugänglich konventionellennal Strukturbiologie und / oder proteomische Ansätze 5,21.

Das Protokoll, wie beschrieben, hat mehrere Fallstricke, die bestätigt werden muss. Zuerst Nachweisempfindlichkeit, insbesondere diejenigen Teil antagonistischen Wirkungen auf Protein-Protein-Wechselwirkung Reste können die Auflösung des Assays zu begrenzen. Farbmetrische Scan könnte zur Lösung einiger der Erfassung gibt 21. Zweitens kann das Vorhandensein von blauen Kolonien nicht immer auf Ketoconazol beständig PXR Mutationen (falsch positiv). Die lacZ-Expression konnte in Gegenwart von Ketoconazol durch Mutation (en) in PXR, die das Protein konstitutiv aktiven oder aktiven unabhängig von SRC-1-Wechselwirkung macht gerettet werden. Solche Mutanten von PXR können von den wahren Ketoconazol resistenten Mutanten durch Testen der Fähigkeit des LexA-DB-PXR Selbst unterschieden aktivieren lacZ-Expression, dh diese Mutanten blaue Kolonien in Abwesenheit von GAL4AC-SRC-1 zu ergeben. Als logische Folge, kann die Mutanten alVerwendung der GAL4AC-Plasmid in Abwesenheit von LexA-DB-SRC-1 weiter zu beschreiben Beweise für Selbstaktivierung von LacZ so in Hefe eingeführt. Drittens bleibt es unbekannt, ob das gleiche Ergebnis erhalten würde, wenn andere Protokolle Y2H / Vektoren wurden verwendet, 13. Viertens kann die Untersuchung der intramolekularen Revertanten-Mutanten (zweite Stelle Suppressormutanten Ketoconazol-resistente Mutanten), um das Verständnis der Antagonist die Bindung durch Definieren benachbarten Resten, die die Bindung beeinflussen Pharmakophor hinzuzufügen. Bei einer Modifikation der Bibliothek von Mutanten, kann dies genauer mit einem Ketoconazol-resistente Mutante als Mutagenese Vorlage definieren.

Dieses Verfahren kann modifiziert werden, um ein Medikament, wobei das zytotoxische Ziel in Hefe ist gut bekannt, oder mit einem Medikament (en), die keine potentiellen Toxizität gegenüber Hefe zu integrieren. Die Hefe kann modifiziert werden, wie wir 6 gezeigt ist, und noch lebensfähig für Y2H Assays. Die Leistungsfähigkeit dieser Methode stützt sich auch auf Neben informierenation aus anderen Tests (zB molekulare Docking), die ortsspezifische Wechselwirkungen informieren. Weiterhin spezifischen Kernrezeptor / coregulator Interaktionen (zB nurr77/LKB1; AR/PELP1) kann 22,23 sucht werden. Die Lenkbarkeit dieses Systems ist, dass es tragbar ist, kann innerhalb von Tagen in einem Hochdurch Weise durchgeführt werden kann und keine teuren Reagenzien oder Verfahren erfordern.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Keine Interessenskonflikte erklärt.

Acknowledgments

Diese Arbeit wurde vom National Institutes of Health (NIH) unterstützt Grants CA127231 und The Damon Runyon Stiftung Clinical Investigator Award (CI 1502) (SM). Wir möchten Professor Zdenek Dvorak danken von Palacky Universität Olomouc, Tschechische Republik für seine hilfreiche Einblicke in Diskussion Tragbarkeit dieser Technik auf ihre Institution und Standardisierung von Protokoll.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics