Reverter levedura Sistema de dois híbridos para identificar mamíferos Receptor Nuclear Resíduos que interagem com ligantes e / ou antagonistas

1Department of Genetics, Albert Einstein College of Medicine, 2Shanghai Key Laboratory of Complex Prescription and MOE Key Laboratory for Standardization of Chinese Medicines, Institute of Chinese Materia Medica, Shanghai University of Traditional Chinese Medicine
* These authors contributed equally
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Li, H., Dou, W., Padikkala, E., Mani, S. Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists. J. Vis. Exp. (81), e51085, doi:10.3791/51085 (2013).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Como um regulador fundamental no metabolismo de drogas e inflamação, Pregnane X Receptor (PXR), desempenha um papel importante na patofisiologia da doença ligando metabolismo e inflamação (por exemplo, a esteatose hepática) 1,2. Tem havido muito progresso na identificação de ligantes agonistas para PXR, no entanto, há descrições limitadas de antagonistas droga-como e seus sítios de ligação PXR 3,4,5. Uma barreira crítica tem sido a incapacidade de purificar de forma eficiente a proteína de comprimento completo para estudos estruturais com antagonistas, apesar do facto de PXR foi clonado e caracterizado em 1998. O nosso laboratório desenvolveu uma nova levedura de alto rendimento com base ensaio de dois híbridos para definir um antagonista, de cetoconazol, os resíduos de ligação em PXR 6. O nosso método envolve a criação de bibliotecas de mutações que seriam resgatar o efeito das mutações individuais em FA-2 superfície de PXR o esperado para interagir com cetoconazol. Resgate ou "ganho de função" secomutações nd pode ser feita de tal forma que conclusões a respeito da interação genética de cetoconazol e do resíduo (s) de superfície em PXR são viáveis. Assim, foi desenvolvido um alto rendimento de dois híbridos tela levedura de mutantes PXR interagindo com sua coactivator, SRC-1. Usando esta abordagem, em que a levedura foi modificado para acomodar o estudo da droga antifúngica, cetoconazol, conseguimos demonstrar mutações específicas em PXR enriquecidas em clones incapazes de se ligar ao cetoconazol. Pela lógica inversa, podemos concluir que os resíduos originais são resíduos diretos de interação com cetoconazol. Este ensaio representa um romance, ensaio genético tratável para a tela por sítios de ligação do antagonista do receptor nuclear em superfícies. Este ensaio pode ser aplicado a qualquer medicamento, independentemente do seu potencial citotóxico de levedura, bem como a proteína (s) celular, que não pode ser estudado usando biologia estrutural padrão ou métodos proteomic base. Armadilhas potenciais incluem interpretação de dados (métodos complementares útil), reliance em método único Y2H, experiência em lidar com fermento ou levedura realizando ensaios de dois híbridos e otimização do ensaio.

Introduction

A levedura de dois híbridos (Y2H) ensaio é utilizado para descobrir as interacções proteína-proteína e, mais recentemente, para a descoberta de novas moléculas pequenas que perturbem complexos proteína-proteína de interacção 7, 8, 9, 10, 11. No entanto, as abordagens convencionais deste ensaio, usado para a descoberta de medicamentos ou "hits", não permitem a detecção de resíduos de interação de compostos químicos alostéricos dentro superfícies proteína-proteína, que, quando alterados ainda interagir e permitir o interrogatório dos resíduos alterados 11 . Com efeito, um tal método (s), se possível desenvolver, permitiria um sistema de levedura tratável para avaliação de alto rendimento de resíduos de interacção alostéricos críticos para a interacção proteína-proteína ruptura. No contexto da descoberta da droga, a maneira mais direta de estabelecer a interação de compostos com proteínas envolveria determinação estrutural (por exemplo, cristalização do complexo proteína-inibidor). Estes métodos são cumbersome, utilizar os recursos elaborados e não é tecnicamente viável a realização de estudos estruturais em cada proteína.

Sistemas de rastreio de drogas genética tratável foram estabelecidas em bactérias 1, 2 e outros sistemas modelo como mamíferos de dois híbridos. No entanto, esses sistemas precisam de otimização e sistemas alternativos como Y2H ainda são os mais testados na descoberta de medicamentos. Há limitações que incluem pouca sensibilidade e confiabilidade das interações usando métodos singulares 13, no entanto, um ensaio Y2H único pode ser modificada para responder a perguntas específicas sobre resíduos de interação. No campo da investigação de receptores nucleares, Y2H foi usado para definir as proteínas que interagem 14, no entanto, estas interacções proteína raramente foram utilizados para definir a natureza, em que os ligandos / antagonistas do receptor interajam com complexos proteicos nucleares. Assim, o nosso laboratório concentrado esforços na definição de um método, especialmente para as proteínas receptoras que não sejamprontamente passíveis de proteômica métodos baseados, que desenterrar novela ligante / antagonista interagindo resíduos utilizando uma plataforma baseada Y2H descoberta inversa.

Com base em nossa constatação anterior que o cetoconazol interrompe PXR e seu ativador SRC-1, foi desenvolvido um novo sistema de reverter Y2H que nos permitirá definir e interrogar cetoconazol interagir resíduos em PXR 6. O nosso método baseia-se nas propriedades da proteína GAL4 de levedura, que consiste em domínios separáveis ​​responsáveis ​​pela activação de ligação a ADN e transcricional. A proteína PXR LBD é expressa como uma fusão com o domínio de ligação de LexA de ADN (DNA-BD), enquanto que as de comprimento total de co-activadores de SRC-1 (coactivator do receptor de esteróides 1) as proteínas são expressas como fusões com o domínio de activação de GAL4 (AD ). Interacção entre PXR e SRC-1 As proteínas de fusão conduz à activação da transcrição de GAL4, sítios de ligação que contêm genes repórter β-Lac Z, que é integrado no genom levedurae. Cetoconazol, um antagonista de PXR, interrompe PXR e SRC-1 interacção 15, 16, 17 e que pode detectar a interacção de PXR e SRC-1 na presença ou ausência de cetoconazol após coloração colónias em filtros para a actividade de X-gal. O princípio de Y2H é ilustrada na Figura 1 e o procedimento experimental é resumido na Figura 2.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ Our lab CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium BD Biosciences 630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate BD Biosciences 233520
Bacto Agar BD Biosciences 214010
CSM-His/-Leu Complete Supplement Mixture MP Biomedicals 4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside). Sigma-Aldrich N1127
2-Mercaptoethanol Sigma-Aldrich M6250
Luria Broth (LB) Sigma-Aldrich L3022
X-Gal Fisher BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml) Life Technology 156-017
Ampicillin Acros Organics 61177
Ketoconazole Sigma-Aldrich K1003
N,N-Dimethylformamide Acros Organics 326871000
Lithium Acetate Sigma-Aldrich L4158
50% PEG-3350 solution, filter-sterilized Sigma-Aldrich P-3640
Nitrocellulose Membrane Whatman 10402091
10 cm Petri Dish Fisher 875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3' our lab PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3' our lab PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3' our lab SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3' our lab SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix Invitrogen 11306-016
BamHI our lab R0136
SalI our lab R0138
NotI our lab R0189

DOWNLOAD MATERIALS LIST

References

  1. Kliewer, S. A., et al. An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway. Cell. 92, (1), 73-82 (1998).
  2. Blumberg, B., et al. a novel steroid and xenobiotic-sensing nuclear receptor. Genes Dev. 12, (20), 3195-3205 (1998).
  3. Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists. Pharm. Res. 26, (8), 1807-1815 (2009).
  4. Pondugula, S. R., Mani, S. Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response. Cancer Lett. 328, (1), 1-9 (2013).
  5. Mani, S., Dou, V., Redinbo, M. R. PXR antagonists and implications for drug metabolism. Drug Metab. Rev. 45, (1), 60-72 (2013).
  6. Li, H., et al. Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR. J. Biol. Chem. 288, (19), 13655-13668 (2013).
  7. Hollenberg, S. M., et al. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, (7), 3813-3822 (1995).
  8. Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell. 74, (1), 205-214 (1993).
  9. Wang, H., et al. The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor. Mol. Endocrinol. 22, (4), 838-857 (2008).
  10. Kalpana, G. V., Goff, S. P. Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system. Proc. Natl. Acad. Sci. U.S.A. 90, (22), 10593-10597 (1993).
  11. Hamdi, A., Colas, P. Yeast two-hybrid methods and their applications in drug discovery. TiPS. 33, (2), 109-118 (2012).
  12. Battesti, A., Bouveret, E. The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli. Methods. 58, (4), 325-334 (2012).
  13. Caufield, J. H., Sakhawalkar, N., Uetz, P. A comparison and optimization of yeast two-hybrid systems. Methods. 58, (4), 317-324 (2012).
  14. Albers, M., et al. Automated yeast two-hybrid screening for nuclear receptor-interacting proteins. Mol. Cell Proteomics. 4, (2), 205-213 (2005).
  15. Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics. J. Biol. Chem. 277, (36), 32453-32458 (2002).
  16. Huang, H., et al. Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole. Oncogene. 26, (2), 258-268 (2007).
  17. Wang, H., et al. Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs. Clin. Cancer Res. 13, (8), 2488-2495 (2007).
  18. Ghannoum, M. A., Rice, L. B. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 12, (4), 501-517 (1999).
  19. Kaur, R., Bachhawat, A. K. The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae. Microbiology. 145, 809-818 (1999).
  20. White, T. C., Marr, K. A., Bowden, R. A., cellular, Clinical, cellular, and molecular factors that contribute to antifungal drug resistance. Clin. Microbiol. Rev. 11, (2), 382-402 (1998).
  21. Serebriiskii, I. G., et al. Detection of peptides, proteins, and drugs that selectively interact with protein targets. Genome Res. 12, 1785-1791 (2002).
  22. Yang, L., et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. Mol Endocrinol. 26, (4), 550-561 (2012).
  23. Zhan, Y. Y., et al. The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK. Nat Chem Biol. 8, (11), 897-904 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics