في فيفو سيرنا ترنسفكأيشن والجينات ضربة قاضية في الحبل الشوكي عن طريق السريع موسع قطني داخل القراب الحقن في الفئران

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

ويصف هذا التقرير تقنية بسيطة وسريعة من داخل القراب ثقب إبرة لترنسفكأيشن المترجمة من سيرنا في النخاع الشوكي القطني في الماوس تحت التخدير قصيرة ضوء دائم.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ويصف هذا التقرير دليل خطوة بخطوة لأسلوب الحقن داخل القراب إبرة حادة بطريقة موسع، أي مستقلة عن القسطرة زرع. الحد التقنية لهذه التقنية الجراحية تكمن في براعة من اليدين. حقن سريع، وخاصة بالنسبة للمجرب المدربين، ومنذ تعطل الأنسجة مع هذه التقنية هو الحد الأدنى، تكرار الحقن ممكنة؛ لا يحدث رد فعل وعلاوة على ذلك في مأمن من الأدوات الخارجية (مثل القسطرة.)، وبالتالي إعطاء محددة أفضل وأكثر من قراءة التشكيل الحبل الشوكي. منذ تطبيق هذه المادة يقتصر إلى حد كبير في المنطقة المستهدفة من الحبل الشوكي، والمخدرات، لا تحتاج إلى أن تطبق في جرعات كبيرة، والآثار غير المرغوب فيها الأهم على الأنسجة الأخرى، كما لوحظ مع التسليم النظامية، يمكن التحايل 1، 2. علاوة على ذلك، فإننا نقوم بدمج هذه التقنية في الجسم الحي مع ترنسفكأيشن من الحمض النووي بمساعدة polyethylenimالمعهد الوطني للإحصاء (PEI) كاشف التي تنص على براعة هائلة لدراسة وظائف العمود الفقري عن طريق تسليم كلاء الدوائية وكذلك الجينات، والجيش الملكي النيبالي، وجهري البروتين.

Introduction

الحبل الشوكي هو مركز مهم جدا في مجموعة متنوعة من العمليات البيولوجية الأساسية والوظائف الفسيولوجية، بما في ذلك تجهيز ونقل مؤلمة (مسبب للألم) المدخلات 4-7. وقد تم تطوير تقنيات تجريبية مختلفة لتسهيل التشكيل الدوائية من الحبل الشوكي، مثل زرع المزمنة القسطرة داخل القراب حقن مكروي الحبل الشوكي، وحقن إبرة داخل القراب 9. كل تقنية مزاياه وعيوبه، واعتمادا على نموذج التجربة أسلوب واحد قد يكون أكثر ملاءمة من غيرها. في حين زرع المزمنة القسطرة داخل القراب هو ممكن بسهولة في الفئران، وهذه الطريقة من الصعب جدا في الماوس، ونظرا حجم القيود. نسبة نجاح منخفضة جدا والعجز الحركي وغالبا ما تحدث بسبب وجود ضخمة من قسطرة في الفضاء تحت الجافية تقتصر بشدة في الماوس. وعلاوة على ذلك، يتم تقديم التسليم على المدى الطويل من الأدوية بسبب تخثر المتكررةمن مزروع مزمنة القسطرة. أخيرا، وردود الفعل المناعي شائعة.

يمكن التحايل هذه المشاكل باستخدام طريقة الحقن داخل القراب الحادة عن طريق إبرة في غياب قسطرة preimplanted، والتي تمكن التطبيق السريع وتشريحيا محدودة من الأدوية والكواشف إلى النخاع الشوكي لدى الفئران. هذا الأسلوب يحتفظ بالكامل فوائد التسليم داخل القراب على طرق أخرى النظامية التسليم (على سبيل المثال عن طريق الفم، في الوريد، داخل الصفاق، الخ) مثل خصوصية التشكيل الشوكي، والذي يسمح تخفيض الجرعات والآثار الجانبية الحد، وكذلك القدرة على تقديم المواد لا عادة لا عبور حاجز الدم في الدماغ منذ خلال حقن داخل القراب، يتم إدخال الإبرة بين الأم الجافية والحبل الشوكي. ولكن الأهم من ذلك، بالمقارنة مع غيرها من أساليب التسليم داخل القراب، وطريقة الحقن داخل القراب إبرة هو أقل الغازية، مما يتيح العديد من التطبيقات فينفس الحيوان دون أن تسبب أي تلف الأنسجة كبيرة أو إثارة رد فعل جهاز المناعة بسبب زرع المواد الأجنبية. ومع ذلك، فإنه يتطلب المهارات الفنية لاستهداف دقيقة جدا من الإبرة للسماح فعالية.

هنا، علينا أن نظهر بصريا طريقة لتحقيق المعدل الأمثل لنجاح تستهدف على وجه التحديد الحبل الشوكي القطني. موقع الحقن الذي يتم اختياره في هذه التجربة هو الأخدود بين L5 L6 وعمود فقاري، وبالقرب من حيث ينتهي الحبل الشوكي، للتقليل من إمكانية الإضرار العمود الفقري. علاوة على ذلك، ونحن لشرح استخدام هذه التقنية لنهدم الجينات في النخاع الشوكي باستخدام الرناوات siRNAs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

وكانت جميع الإجراءات استخدام الحيوانات وفقا للمبادئ التوجيهية الأخلاقية التي وضعتها هيئة الإدارة المحلية (Regierungspräsidium كارلسروه، كارلسروه، ألمانيا).

1. إعداد مجمع سيرنا / جزيرة الأمير إدوارد


يتم إعداد الحل سيرنا / PEI معقدة باستخدام توجيهات المصنع على النحو التالي:

  1. الحل ج: تمييع المبلغ المطلوب من سيرنا مع الماء المعقم (إذا لزم الأمر) ما يصل الى ربع حجم نهاية وتمييع هذا أيضا مع 10٪ محلول الجلوكوز تصل إلى نصف حجم النهاية. دوامة بلطف أو مزيج من قبل pipetting صعودا وهبوطا. كمية الأمثل للسيرنا يحتاج إلى أن تحدد تجريبيا ولكن 1 ميكروغرام سيرنا في 10 ميكرولتر حل معقد للحيوان الواحد هو نقطة انطلاق جيدة لتعظيم الاستفادة.
  2. الحل ب: تمييع حجم الحاجة من PEI كاشف مع الماء المعقم تصل إلى ربع حجم نهاية وتمييع هذا أيضا مع 10٪ محلول الجلوكوز تصل إلى نصف حجم النهاية. دوامة جنرال الكتريكntly أو مزيج من قبل pipetting صعودا وهبوطا.
    ملاحظة: كمية PEI كاشف يحدد التوازن الأيوني في المجمع الذي يؤثر على كفاءة ترنسفكأيشن. كذلك كمية الأمثل للحل PEI لابد من تحديد تجريبيا. في أيدينا، فإن المبلغ الأمثل هو 0.12 ميكرولتر من PEI الحل لكل 1 ميكروغرام سيرنا.
  3. مزيج الحل A B مع الحل في كل مرة، دوامة بلطف.
  4. احتضان الحل مختلطة لمدة 15 دقيقة في RT قبل الاستخدام. هذا المجمع هو مستقر لمدة 2 ساعة على RT ولمدة 24 ساعة في 4 درجات مئوية.

2. حقن داخل القراب

  1. تخدير الفأر مع 3٪ isoflurane و، حتى لا يظهر أي علامات على المقوم منعكس. بالإضافة إلى ذلك، تحقق من وجود الذيل و / أو قرصة مخلب العاكسة لضمان مزيد من حالة التخدير.
  2. يحلق حوالي 2 سم 2 من الفراء في نهاية الخلفي من الحيوان بالقرب من قاعدة الذيل لتسهيل التصور أفضل أثناء غرز الإبرة.
  3. وضع الماوس فيمخروط الأنف لإدارة isoflurane واستمرت أثناء الإجراء، والحد من isoflurane وإلى 1.5٪، وتغطية عيون الماوس مع زيوت التشحيم العين.
  4. إعداد جاهزة للاستخدام سيرنا حل مختلطة باستخدام حقنة هاميلتون 25 ميكرولتر تعلق على 30 G 0.5 في الإبرة.
  5. تحديد موقع العملية الشائكة من L6، والتي ينبغي أن تكون واحدة من أبرز وإصلاح العمود الفقاريات حول هذه المنطقة عن طريق الضغط عليه برفق.
  6. إدراج بعناية الإبرة بين أخدود من L5 L6 وفقرات ومراعاة لنفض الغبار الذيل كما يشير هذا التوقيع إدخال الناجح للإبرة في الفضاء داخل الجافية.
    تلميح: استخدام ظفر، ينبغي للمرء أن يكون قادرا على تحديد موقع الأخدود أيضا.
  7. مرة واحدة ويلاحظ الذيل نفض الغبار، وعلى الفور، ولكن بعناية، وتأمين موقف إبرة بيد واحدة وحقن حجم المطلوب من مادة مع جهة أخرى ببطء.
    نصيحة: حجم بين 5-10 ميكرولتر هو الأمثل حيث حجم أقل من 5 و# 181؛ ل لا يمكن الاعتماد عليها، وبحجم أكبر من 10 ميكرولتر يؤدي إلى الكثير من الضغوط.
  8. مرة واحدة يتم تنفيذ الحقن، وتحريك الماوس مرة أخرى إلى قفص للتعافي من التخدير.
  9. تكرار هذه الحقن لا يقل عن 2 مرات كل 24 ساعة لتحقيق downregulation المثلى من الجينات المستهدفة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

من أجل توضيح حقن ناجحة، أجرينا هذه التقنية باستخدام سريع الخضراء FCF الصبغة في الفئران الكبار C57BL6 (8-10 أسابيع من العمر). سمح للحيوان لاسترداد لبضع دقائق بعد الحقن لتوفير ما يكفي من الوقت للصبغة لنشر ثم قتل مع جرعة زائدة من ثاني أكسيد الكربون 2. في وقت لاحق، تم تشريح العمود الفقارية وتعرض الحبل الشوكي. ونقاط والأزرق المقابلة لصبغ منتشرة، شهد موقع الحقن. يمكن أن ينظر أي علامة على إصابة الحبل الشوكي، مما يؤكد الطبيعة الغازية الحد الأدنى من هذه التقنية (الشكل 1A). حقن الصبغة تنتشر من موقع الحقن rostrally، تصل إلى المنطقة الصدرية من الحبل الشوكي، فقط بضع دقائق بعد الحقن (الشكل 1B). وعلاوة على ذلك التسريب ناجحة للصباغة في الفضاء فوق الجافية يمكن أن يبرهن على السطح الملون من الحبل الشوكي ولكن ليس من الداخل (الشكل 1C).

الحمار = "jove_content"> وعلاوة على ذلك، هذا الأسلوب، جنبا إلى جنب مع مجموعة PEI الكاشف، تمكين سيرنا فعالة جدا في الجسم الحي ترنسفكأيشن في الحبل الشوكي. بعد تسليم سيرنا داخل القراب (3X، مرة واحدة كل 24 ساعة)، تم تخفيض التعبير عن بروتين المستهدفة (هنا WAVE1) على لست] المستمدة من الظهرية L3-L5 الأنسجة الشوكي إلى حوالي 70٪ في مستوى البروتين (الشكل 2A، ن = 20) وكذلك في مستوى مرنا (الشكل 2B، ن = 6). وعلاوة على ذلك يمكن أيضا أن ينظر إلى downregulation من حجم مماثل في المحللة من قسم بطني (الشكل 2C، ن = 4). ومن المثير للاهتمام، وهو downregulation حتى أقوى قليلا، كان ينظر أيضا في المحللة من الحبل الشوكي عنق الرحم (الشكل 2D، ن = 4). ولكن، على الرغم من أن طريقة مماثلة استخدمت لdownregulate الجيني في أنسجة خارج الحبل الشوكي 10، في أيدينا لم يكن لوحظ هذا downregulation في المحللة من الدماغ (الشكل 2E، ن = 4) ولا DRع (الشكل 2F، ن = 4).

الشكل 1
الشكل 1. الحبل الشوكي تشريح تحت المجهر التالية الغازية، والحقن داخل القراب غير الحادة مع الصبغة الخضراء سريعة. A، أي علامة واضحة على إصابة الأنسجة يمكن أن ينظر إليه على موقع الحقن، والتي تمثلت في نقاط وصبغ باء، رفعه الحبل الشوكي دقائق قليلة بعد الحقن تظهر انتشار تدريجي للصباغة في اتجاه منقاري. يصادف مربع أبيض منطقة أسفل الظهر، ويمثل النجم موقع الحقن. وتلطيخ محددة على سطح النخاع الشوكي (جزء L3-L5)، ولكن ليس داخل الحبل الشوكي. ص = منقاري، ج = الذيلية، سم مكعب = القناة المركزية. اضغط هنالمشاهدة صورة أكبر.

الرقم 2
الشكل 2. . downregulation ناجحة من البروتين المستهدفة (هنا WAVE1) في النخاع الشوكي بعد تسليم سيرنا داخل القراب تم حقن الفئران intrathecally إما مع تحكم سيرنا أو سيرنا تستهدف WAVE1 مختلطة مع PEI كاشف لمدة 3 مرات متتالية كل 24 ساعة؛ بعد ذلك، ظهري وبطني قسم من الحبل الشوكي القطني (الجزء 3-5)، تم رفعه الحبل الشوكي العنقي والدماغ وDRGs، هي lysed وتعرض لالنشاف الغربية وQRT-PCR. AB، الغربية النشاف (ن = 20) وQRT-PCR (ن = 6) الكمي من المحللة من القسم الظهري في النخاع الشوكي القطني، CF الغربية النشاف الكمي من المحللة من بطني L3-L5 الحبل الشوكي والنخاع الشوكي العنقي والدماغ وDRG respectively (ن = 4). والتحليل من قبل الطالب اختبار t المفردة في (* P ≤ 0.05، ** P ≤ 0005). اضغط هنا لمشاهدة صورة بشكل اكبر .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

وبالتالي، فإن تقنية المبين أعلاه حقن إبرة داخل القراب هو فعال وسريع، مترجمة على وجه التحديد، وغير تدميري. من الناحية الفنية، فإن الجانب الأكثر أهمية من هذا الإجراء هو نقطة الإدراج الإبرة في الأخدود. فمن الأهمية بمكان أن يتم هذا الإجراء مع أيدي هادئة جدا والصبر. مثل العديد من العمليات الجراحية، والتدريب يحسن من معدل حقن ناجحة. وهذا هو أيضا مهم جدا لأنه خلال التجربة الفعلية، وهذه التقنية لا توفر مؤشرا واضحا لتأكيد ما إذا كان حقن مباشرة هي ناجحة أم لا. المؤشر مرئية فقط من غرز الإبرة الصحيح هو نفض الغبار الذيل الذي يحتفل به بوصفه رد الفعل.

هذا الأسلوب يحتفظ بالكامل فوائد التسليم داخل القراب على طرق أخرى systemical تسليم (على سبيل المثال عن طريق الفم، في الوريد، داخل الصفاق، الخ)، مثل خصوصية التشكيل الشوكي، والذي يسمح تخفيض الجرعات والآثار الجانبية حدود؛ الفراءthermore، والحقن داخل القراب تمكين تسليم المواد التي هي عادة لا عبر حاجز الدم في الدماغ منذ خلال حقن داخل القراب، يتم إدخال الإبرة بين الأم الجافية والحبل الشوكي. الأهم من ذلك، ومع ذلك، بالمقارنة مع غيرها من أساليب التسليم داخل القراب، وطريقة الحقن داخل القراب إبرة هو أقل الغازية، مما يتيح العديد من التطبيقات في نفس الحيوان دون أن تسبب أي تلف الأنسجة كبيرة أو إثارة رد فعل جهاز المناعة بسبب زرع المواد الأجنبية.

تماما، في هذا التقرير، لقد أظهرنا ليس فقط خطوة بخطوة دليل أساسي لحقن إبرة حادة داخل القراب، ولكن أيضا تقريرا مثال على الارتجال من هذه التقنية، حيث في الجسم الحي في سيرنا ترنسفكأيشن وجين معين ضربة قاضية في العمود الفقري لا يمكن أن يتحقق الحبل. بجانب تقديم الكواشف الدوائية PEI وسهلت تسليم سيرنا، ويمكن أيضا أن تستخدم طريقة الحقن داخل القراب إبرة لتسهيل التمديدأنواع لها من نقل الجينات، مثل الفيروسية بوساطة توصيل الجينات 11. مرة واحدة وقد اكتسبت خبرة كافية، ويمكن أيضا أن يتم تنفيذ هذا الإجراء دون تخدير في اليقظة، الفئران nonanesthetized 4،12. وهذا يتيح، على سبيل المثال، لدراسة التأثيرات الحادة الناجمة عن وكلاء الدوائية في النماذج السلوكية وpreacclimatized الفئران المقدمة لمنع الإجهاد المفرط.

وبالتالي، والحقن داخل القراب الحادة تشكل أداة مفيدة جدا لدراسات عن الظهرية قرن العمود الفقري وبراعة تقنية تسمح المجربون لتخصيص والارتجال لتتناسب مع أهدافها.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب تعلن أي المصالح المالية المتنافسة.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats