En Vivo transfección siRNA y Gene Derribo en la médula espinal a través de Rapid no invasiva lumbar intratecal inyecciones en ratones

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Este informe describe una técnica sencilla y rápida de la aguja de punción intratecal para una transfección localizada de siRNA en la médula espinal lumbar de ratón bajo anestesia de corta luz duradera.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En este informe se describe una guía paso a paso a la técnica de inyecciones intratecales agujas agudas de una manera no invasiva, es decir, independiente de la implantación del catéter. La limitación técnica de esta técnica quirúrgica se encuentra en la finura de las manos. La inyección es rápida, sobre todo para un investigador entrenado, y dado que la interrupción del tejido con esta técnica es mínima, las inyecciones repetidas son posibles; reacción además inmune a las herramientas de extranjeros (por ej. Catéter) no ocurre, dando así una mejor y más específica leer en voz de la modulación de la médula espinal. Dado que la aplicación de la sustancia se limita en gran parte a la región diana de la médula espinal, los fármacos no necesitan ser aplicado en grandes dosis, y efectos más importante no deseados en otro tejido, como se observa con un suministro sistémico, pueden ser eludidas 1, 2. Además, combinamos esta técnica con la transfección in vivo de ácido nucleico con la ayuda de polyethylenimINE (PEI) de reactivo 3, que proporciona una gran versatilidad para el estudio de funciones de la médula a través de la administración de agentes farmacológicos, así como de genes, ARN, y moduladores de proteínas.

Introduction

La médula espinal es un centro muy importante en una variedad de procesos biológicos fundamentales y funciones fisiológicas, incluyendo el procesamiento y la transmisión de entradas dolorosas (nociceptivo) 4-7. Diversas técnicas experimentales se han desarrollado para facilitar la modulación farmacológica de la médula espinal, tales como la implantación crónica de catéteres intratecales 8, la microinyección de la médula espinal, intratecal y la aguja de inyección 9. Cada técnica tiene sus propias ventajas y desventajas, y dependiendo del paradigma experimento Una técnica podría ser más adecuado que los otros. Considerando que la implantación crónica de los catéteres intratecales es fácilmente factible en la rata, este método es muy difícil en el ratón, dadas las restricciones de tamaño. El índice de éxito es muy baja y el déficit motor a menudo se producen debido a la presencia voluminosa de un catéter en el espacio subdural severamente limitado en el ratón. Además, la administración a largo plazo de medicamentos se hace debido a la coagulación frecuentesde implantado crónicamente catéteres. Finalmente, las reacciones inmunes son comunes.

Estos problemas pueden ser evitados utilizando el método de la inyección intratecal aguda a través de una aguja en la ausencia de un catéter preimplanted, que permite una aplicación rápida y anatómicamente limitado de medicamentos y reactivos a la médula espinal en ratones. Este método mantiene plenamente los beneficios de la entrega intratecal sobre otras rutas de administración sistémica (por ejemplo, oral, intravenosa, intraperitoneal, etc) tales como especificidad de la modulación espinal, que permite la reducción de las dosis y los efectos secundarios límite, así como la capacidad para entregar sustancias no hacen normalmente no atraviesan la barrera hematoencefálica ya que durante la inyección intratecal, se inserta la aguja entre la duramadre y la médula espinal. Es importante destacar sin embargo, en comparación con otros métodos de entrega intratecal, el método de inyección de aguja intratecal es el menos invasivo, lo que permite numerosas aplicaciones en lamismo animal sin causar ningún daño tisular considerable o evocando reacción inmune debido a la implantación de material extraño. Sin embargo, requiere habilidades técnicas para una orientación muy precisa de la aguja para permitir la eficacia.

Este sentido, demostrar visualmente el método para alcanzar una tasa óptima de éxito para la orientación específica de la médula espinal lumbar. El sitio de la inyección que se elige en este experimento es el surco entre L5 y L6 columna de vertebrados, cerca de donde termina la médula espinal, para reducir al mínimo la posibilidad de dañar la columna vertebral. Por otra parte, se demuestra el uso de esta técnica para derribar los genes en la médula espinal utilizando siRNAs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los procedimientos de uso de animales estaban en conformidad con las normas éticas establecidas por la Junta de Gobierno Local (Regierungspräsidium Karlsruhe, Karlsruhe, Alemania).

1. Preparación del Complejo siRNA / PEI


La solución de complejo de ARNsi / PEI se prepara utilizando las instrucciones del fabricante de la siguiente manera:

  1. Solución A: Diluir la cantidad deseada de siRNA con agua estéril (si es necesario) hasta una cuarta parte del volumen final y diluir dicha adicionalmente con una solución de glucosa al 10% hasta la mitad del volumen final. Vortex o mezclar suavemente la pipeta hacia arriba y hacia abajo. La cantidad óptima de siRNA se debe determinar empíricamente pero 1 mg siRNA en 10 l solución compleja por animal es un buen punto de partida para la optimización.
  2. Solución B: Diluir el volumen necesario de reactivo PEI con agua estéril hasta una cuarta parte del volumen final y diluir dicha adicionalmente con una solución de glucosa al 10% hasta la mitad del volumen final. Vortex gently o mezclar pipeteando arriba y abajo.
    Nota: la cantidad de reactivo de PEI determina el equilibrio iónico en el complejo que influye en la eficiencia de la transfección. Del mismo modo la cantidad óptima de solución de PEI tiene que ser determinada empíricamente. En nuestras manos, la cantidad óptima es de 0,12 l de solución de PEI por 1 g de siRNA.
  3. Mezclar la solución A con la solución B a la vez, vórtice suavemente.
  4. Incubar la solución se mezcló durante 15 min a temperatura ambiente antes de su uso. Este complejo es estable durante 2 horas a temperatura ambiente y durante 24 horas a 4 ° C.

2. La inyección intratecal

  1. Anestesiar el ratón con el 3% isoflurano, hasta que no muestra signos de reflejo de enderezamiento. Además, compruebe si hay cola y / o la pata pizca reflex para asegurar aún más el estado de anestesia.
  2. Shave alrededor de 2 cm 2 de piel en el extremo posterior del animal cerca de la base de la cola para facilitar una mejor visualización durante la inserción de la aguja.
  3. Coloque el ratón enun cono de la nariz para una administración continua isoflurano durante el procedimiento, a reducir el isoflurano al 1,5%, y cubrir los ojos del ratón con lubricante ocular.
  4. Prepare la lista para su uso siRNA solución mixta utilizando una jeringa Hamilton de 25 l adjunto a un 30 G 0,5 en la aguja.
  5. Busque la apófisis espinosa de la L6, que debería ser el más destacado y fijar la columna de la vertebrado alrededor de esta área presionando suavemente.
  6. Inserte cuidadosamente la aguja entre la ranura de L5 y L6 vértebras y observar por un movimiento de la cola ya que este signo indica una entrada exitosa de la aguja en el espacio intradural.
    Consejo: El uso de la uña, uno debe ser capaz de localizar la ranura también.
  7. Una vez que se observa movimiento de la cola, de inmediato, pero con cuidado, asegurar la posición de la aguja con una mano e inyectar el volumen deseado de la sustancia con la otra mano lentamente.
    Consejo: un volumen de entre 5-10 l es óptima ya que el volumen de menos de 5 y# 181; l es poco fiable y un volumen más grande que 10 l conduce a demasiada presión.
  8. Una vez que se realiza la inyección, mover el ratón de nuevo a la jaula para recuperarse de la anestesia.
  9. Repita este inyección de al menos 2 veces más cada 24 horas para lograr una óptima regulación a la baja del gen diana.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Con el fin de ilustrar una inyección de éxito, se realizó esta técnica usando Fast tinte verde FCF en ratones adultos C57Bl6 (8-10 semanas de edad). El animal se le permitió recuperarse durante unos minutos después de la inyección para dar tiempo suficiente para que el tinte se extendió y luego mató con una sobredosis de CO 2. Posteriormente, la columna de la vertebrado fue disecada y la médula espinal se expuso. El puntos lagrimales azul correspondiente al colorante difusa, marcó el sitio de la inyección. No hay signos de lesión de la médula espinal podría ser visto, lo que confirma el carácter mínimamente invasivo de esta técnica (Figura 1A). El medio de contraste inyectado difunde desde el lugar de la inyección rostral, llegando hasta la región torácica de la médula espinal, a sólo unos minutos después de la inyección (Figura 1B). Además, la infusión de éxito del colorante en el espacio epidural podría ser probado por la superficie manchada de la médula espinal, pero no el interior (Figura 1C).

en la transfección in vivo en la médula espinal. Después de ARNsi entrega intratecal (3x, una vez cada 24 horas), la expresión de la proteína objetivo (aquí WAVE1) en lisados ​​derivados de dorsal L3-L5 tejido de la médula se redujo a alrededor de 70% en el nivel de proteína (Figura 2A, n = 20) así como en el nivel de mRNA (Figura 2B, n = 6). Además, una regulación a la baja de una magnitud similar también se podía ver en el lisado de la sección ventral (Figura 2C, n = 4). Curiosamente, una regulación a la baja incluso ligeramente más fuerte, también se observó en lisado de la médula espinal cervical (Figura 2D, n = 4). Pero, a pesar del hecho de que un método similar ha sido utilizado para downregulate gen en los tejidos fuera de la médula espinal 10, en nuestras manos este regulación a la baja no se observó en el lisado del cerebro (Figura 2E, n = 4) ni el DRGs (Figura 2F, n = 4).

Figura 1
Figura 1. Médula espinal diseccionado bajo el microscopio después de la inyección no invasivo, aguda por vía intratecal con tinte verde rápido. Una, Ninguna señal visible de lesión de los tejidos se puede ver en el sitio de inyección, marcada por los puntos lagrimales tinte. B, Extirpados médula espinal pocos minutos después de que muestra la difusión gradual del colorante en dirección rostral inyección. Caja blanca marca la región lumbar, y la estrella marca el sitio de la inyección. C, tinción específica en la superficie de las médulas espinales (segmento L3-L5), pero no el interior de la médula espinal. r = rostral, c = caudal, cc = canal central. Haga clic aquípara ver la imagen más grande.

Figura 2
Figura 2. . Regulación a la baja con éxito de la proteína objetivo (aquí WAVE1) en la médula espinal después de la entrega de siRNA intratecal Los ratones se inyectó por vía intratecal, ya sea con el control de siRNA o siRNA dirigidos contra WAVE1 mezclado con el reactivo de PEI para 3 veces consecutivas cada 24 horas; después, el dorsal y ventral sección de la médula espinal lumbar (segmento 3-5), la médula espinal cervical, el cerebro y los GRD se extirparon, se lisaron y se sometieron a transferencia de Western y QRT-PCR. AB, transferencia Western (n = 20) y QRT-PCR (n = 6) la cuantificación de lisado de la sección dorsal de la médula espinal lumbar, CF Western Blot cuantificación del lisado de ventral L3-L5 médula espinal cervical de la médula espinal, el cerebro y DRG respectively (n = 4). Análisis fuera por la prueba t de Student (* p ≤ 0,05, ** P ≤ 0,005). Haga clic aquí para ver la imagen más grande .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Por lo tanto, la técnica de inyecciones intratecales de aguja anteriormente descrito es eficaz, rápido, específicamente localizada-, y no destructiva. Técnicamente, el aspecto más crítico de este procedimiento es el punto de inserción de la aguja en el surco. Es crucial que este procedimiento se realiza con las manos muy tranquilas y paciencia. Como muchos procedimientos quirúrgicos, la formación mejora la tasa de éxito de la inyección. Esto también es importante porque durante un experimento real, esta técnica no proporciona un indicador obvio para confirmar directamente si una inyección tiene éxito o no. El único indicador visible de la inserción de la aguja correcta es la retirada de la cola que se observa como un reflejo.

Este método mantiene plenamente los beneficios de la entrega intratecal sobre otras rutas systemical de entrega (por ejemplo, oral, intravenosa, intraperitoneal, etc), tales como especificidad de la modulación espinal, que permite la reducción de las dosis y los efectos secundarios límites; pielesThermore, inyecciones intratecales permiten la administración de sustancias que son normalmente no barrera hematoencefálica cruz ya que durante la inyección intratecal, se introduce la aguja entre la duramadre y la médula espinal. Es importante destacar, sin embargo, en comparación con otros métodos de entrega intratecal, el método de inyección de aguja intratecal es el menos invasivo, lo que permite una numerosas aplicaciones en el mismo animal sin causar ningún daño tisular considerable o evocando reacción inmune debido a la implantación de material extraño.

En total, en el presente informe, hemos demostrado no sólo la guía básica paso a paso a la inyección intratecal de aguja aguda, sino también informar de un ejemplo de la improvisación de esta técnica, en donde en un vivo siRNA transfección y genes específicos de caída en la médula espinal se puede lograr. Al lado de entrega de reactivos farmacológicos y la salida del siRNA facilitado-PEI, el método de inyección de aguja intratecal también se puede utilizar para facilitar OTsus tipos de transferencia de genes, tales como la entrega de genes mediada por virus 11. Una vez que la suficiente experiencia se ha adquirido, este procedimiento también se puede realizar sin anestesia en despiertos, los ratones nonanesthetized 4,12. Esto permite, por ejemplo, para estudiar los efectos agudos de agentes farmacológicos en los paradigmas de comportamiento proporcionadas ratones se preacclimatized para prevenir el estrés excesivo.

Por lo tanto, las inyecciones intratecales agudas constituyen una herramienta muy útil para los estudios sobre el asta dorsal de la médula y la versatilidad de la técnica permite que los experimentadores para personalizar y improvisan para satisfacer sus objetivos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran no tener intereses financieros en competencia.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats