Farelerde Hızlı noninvaziv Lomber İntratekal enjeksiyon yoluyla Vivo siRNA'nın Transfaksiyon ve Omurilik Gen demonte olarak

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Bu rapor, kısa süreli hafif anestezi altında fare lumbar spinal kordda siRNA yerelleştirilmiş transfeksiyonu için intratekal iğne giriş basit ve hızlı bir yöntem açıklanır.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bu rapor, non-invaziv bir şekilde akut intratekal iğne enjeksiyon tekniği, kateter implantasyonu yani bağımsız bir adım-adım kılavuz açıklanır. Bu cerrahi tekniğin teknik sınırlama ellerin incelik yatıyor. Enjeksiyon, özellikle eğitimli bir deneyci için, hızlı, ve bu teknikle doku bozulma az olduğundan, tekrarlanan enjeksiyonlar mümkündür; yabancı araçlara ayrıca bağışıklık reaksiyonu (. Örneğin kateter) oluşmaz, böylece daha iyi ve daha spesifik dışarı oku verme spinal kord modülasyon. Maddenin uygulanması büyük ölçüde omurilik hedef bölge ile sınırlı olduğu için, ilaçlar büyük dozlarda uygulanması gerekmez ve diğer dokusu üzerinde istenmeyen etkileri daha da önemlisi, bir sistemik uygulama ile gözlemlendiği üzere, 1 aşılabilir 2. Ayrıca, polyethylenim yardımıyla nükleik asidin in vivo transfeksiyonu ile bu teknik kombineine (PEI) farmakolojik maddelerin teslimi hem de gen, RNA ve protein modülatörleri ile spinal fonksiyonlarını incelemek için büyük bir çok yönlü ve çok reaktif 3.,.

Introduction

Omurilik işleme ve ağrılı (nosiseptif) girişlerine 4-7 iletim dahil kilit biyolojik süreçler ve fizyolojik fonksiyonları, çeşitli çok önemli bir merkezdir. Çeşitli deneysel teknikler, intratekal kateter 8 kronik implantasyonu, omurilik mikroenjeksiyon ve intratekal enjeksiyon iğne 9 ile omurilik, farmakolojik modülasyonuna kolaylaştırmak için geliştirilmiştir. Her teknik kendine özgü avantajları ve dezavantajları vardır, ve deney paradigma bağlı olarak bir teknik diğerlerine göre daha uygun olabilir. Intratekal kateter kronik implantasyonu sıçanda kolayca mümkün olduğu iken, bu yöntem, boyut kısıtlamaları göz önüne alındığında, fare çok zordur. Başarı oranı çok düşüktür ve motor açıkları nedeniyle sık sık fare ciddi sınırlı subdural alanda bir kateterin büyük varlığı nedeniyle meydana gelir. Ayrıca, ilaçların uzun süreli teslimat nedeniyle sık pıhtılaşma işlenirkronik kateter yerleştirildi. Son olarak, bağışıklık reaksiyonları yaygındır.

Bu sorunlar, farelerde omurilik için ilaç ve reaktiflerin hızlı ve anatomik olarak sınırlı uygulama sağlayan bir preimplanted kateter yokluğunda bir iğne vasıtasıyla, akut intratekal enjeksiyon yöntemi kullanılarak atlatılabilir. Bu yöntem, tam olarak böyle spinal düşük dozajları ve sınır yan etkileri izin modülasyonu, hem de maddelerin yok sunmak için yeteneği özgüllük gibi diğer sistemik tatbikat yolları (örneğin, oral, intravenöz, intraperitonal vs) üzerinden teslim intratekal yararlarını muhafaza intratekal enjeksiyon sırasında iğne dura mater ve omurilik arasına sokulur olduğundan, normal olarak kan-beyin bariyerinden geçmezler. Önemli olarak, ancak, intratekal teslimat diğer yöntemlere kıyasla, intratekal enjeksiyon iğne yöntem olup, çok sayıda uygulama sağlayan, en az invazivHerhangi bir ciddi doku hasarına neden veya bağlı yabancı madde implantasyonuna bağışıklık reaksiyonunu çağrıştıran olmadan aynı hayvan. Ancak, bu etkinlik için izin iğnenin çok hassas hedefleme için teknik beceri gerektirir.

Burada, özellikle görsel olarak lumbar spinal kordon hedeflenmesi için bir başarı oranı elde etmek için uygun bir yöntem göstermektedir. Bu deneyde seçilmiş enjeksiyonu site L5 ve omurga zarar olasılığını en aza indirmek için, spinal kordon uçları yere yakın L6 omurgalı kolonu arasındaki oluktur. Ayrıca, siRNA'lar kullanarak omurilikte genleri yıkmak için bu tekniğin kullanımını göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm hayvan kullanım prosedürleri yerel yönetim organı (Regierungspräsidium Karlsruhe, Karlsruhe, Almanya) tarafından belirlenen etik kurallara uygun idi.

1.. SiRNA / PEI Kompleksi hazırlanması


SiRNA / PEI kompleks çözeltisi aşağıdaki gibi üreticinin talimatlarını kullanarak hazırlanır:

  1. Çözelti A: uç hacminin dörtte birine kadar steril su ile siRNA istenilen miktarda (eğer gerekli ise) seyreltin ve son hacminin yarısına% 10 glükoz çözeltisi ile daha da bu seyreltin. Vortex hafifçe yukarı veya aşağı pipetleme karıştırın. SiRNA optimal miktarı deneysel olarak tespit edilmesi gerekmektedir, ancak, hayvan başına 10 ul kompleksi çözeltisi içinde 1 | ig siRNA optimizasyonu için iyi bir başlangıç ​​noktasıdır.
  2. Çözelti B: uç hacminin dörtte birine kadar steril su ile PEI reaktifinin gerekli hacmi seyreltin ve uç hacminin yarısına% 10 glükoz çözeltisi kadar bu daha fazla seyreltilir. Vortex gently veya aşağı yukarı pipetleme karıştırın.
    Not: PEI maddesi miktarı, transfeksiyon verimini etkilemektedir kompleks içindeki iyonik denge belirler. Aynı şekilde PEI solüsyonu optimal miktarı deneysel olarak tespit edilmelidir. Bizim ellerde, optimal miktarı 1 mikrogram siRNA'nın başına PEI çözeltisinin 0.12 ul.
  3. B çözeltisi ile çözüm A karıştırın seferde, vorteks nazikçe.
  4. Kullanmadan önce, oda sıcaklığında 15 dakika boyunca karıştırılmış çözelti inkübe edin. Bu kompleks, 4 ° C'de, oda sıcaklığında 2 saat boyunca ve 24 saat boyunca stabildir

2. Intratekal Enjeksiyon

  1. Bu refleksi hiçbir belirti gösterir kadar,% 3 izofluran ile fare anestezisi. Buna ek olarak, ayrıca anestezi sağlamak için devlet kuyruk ve / veya pençe tutam refleksi kontrol edin.
  2. Iğne yerleştirilmesi sırasında daha iyi bir görüntü sağlamak için kuyruğun tabanına yakın hayvanın arka ucunda kürk yaklaşık 2 cm 2 tıraş.
  3. Içinde fare yerleştirinişlem sırasında sürekli bir izofluran uygulanması için bir burun konisi,% 1.5 izofluran azaltmak ve göz yağ ile fare gözleri kapsamaktadır.
  4. Iğne, bir 30 G 0.5 bağlanmış bir 25 ul Hamilton şırıngası kullanılarak siRNA karışık çözelti, kullanıma hazır hazırlayın.
  5. En önemli biri ve hafifçe basarak bu alanı çevresinde omurgalı sütun düzeltmek gerekir L6 spinöz süreci bulun.
  6. Dikkatli L5 ve L6 vertebra yiv arasında iğne yerleştirin ve bu işareti intradural uzayda iğnenin başarılı bir giriş anlaşılacağı gibi bir kuyruk hareketiyle gözleyin.
    İpucu: tırnağınızı kullanarak, bir de oluk bulmak gerekir.
  7. Tail flick görülmektedir kez, hemen, ama dikkatle, tek elle iğne konumunu güvenli ve diğer taraftan yavaş yavaş ile maddenin istenilen hacmi enjekte.
    İpucu: 5-10 arasında bir hacim ul hacim en az 5 olarak optimal &# 181; l güvenilmez ve 10 ul daha büyük bir hacim çok fazla baskı yol açar.
  8. Enjeksiyonu yapılır sonra, anestezi kurtarmak için kafesine geri fareyi hareket ettirin.
  9. Hedeflenen genin optimum infekte elde etmek için bu enjeksiyon en az 2 defa daha, her 24 saat tekrarlayın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Başarılı bir enjeksiyon örnekle açıklamak için, erişkin C57BL6 farelerde hızlı yeşil boya FCF (yaş, 8-10 haftalık) kullanarak bu tekniği uygulandı. Hayvan boya yayılmış ve daha sonra CO2 bir dozu ile öldürülmüş için yeterli zamanı sağlamak üzere enjeksiyon sonrası birkaç dakika geri bırakıldı. Daha sonra, omurgalı kolon kesitlere ayrılmıştır ve omurilik ortaya çıkmıştır. Dağınık boya karşılık gelen Mavi puncta, enjeksiyon yerinde oldu. Omurilik yaralanma izi yok, bu tekniğin (Şekil 1A) minimal invaziv doğasını teyit görülebilir. Enjekte edilen boya omurilik, enjeksiyon (Şekil 1 B) sonra, sadece birkaç dakika içinde göğüs bölgesinde kadar ulaşan, rostral enjeksiyon bölgesinden yayılan. Ayrıca epidural boşluğa boyanın başarılı infüzyon omurilik lekeli yüzeyi tarafından kanıtlanmış bulunmakla beraber iç (Şekil 1C).

vivo transfeksiyonu içinde çok etkili bir siRNA sağladı. SiRNA intratekal Doğumdan sonra (3x, her 24 saat), dorsal L3-L5 spinal dokusundan türetilen lizatları üzerindeki hedeflenen protein (burada WAVE1) ekspresyon protein seviyesi yaklaşık% 70 azaldı (Şekil 2A, n = 20) yanı sıra, mRNA düzeyi (Şekil 2B, n = 6). Ayrıca benzer büyüklükte bir aşağı regülasyonu da (Şekil 2C, n = 4) ventral bölümün lizatı olarak görülebilir. İlginç bir şekilde, daha da biraz daha güçlü bir aşağı doğru düzenleme, aynı zamanda, (Şekil 2D, n = 4) servikal spinal kord lizatı görülmüştür. Ancak, benzer bir yöntem olup, omurilik 10 dış dokularda gen baskılanabileceği kullanılmış olmasına rağmen, bizim elimizde bu aşağı regülasyonu veya DR beyin lizatı gözlenmiştir (Şekil 2E = 4, n) değilGs (Şekil 2F, n = 4).

Şekil 1
Şekil 1. Hızlı yeşil boya ile invazif olmayan akut intratekal enjeksiyonundan sonra, mikroskop altında kesilerek omurilik. A, doku hasarının yok görünür işaret boya puncta ile işaretlenmiş, enjeksiyon yerinde görülebilir. B, rostral yönde boyanın kademeli difüzyon gösterilen enjeksiyon sonrası omurilik birkaç dakika çıkarıldı. Beyaz kutu bel bölgesini işaretleri ve yıldız enjeksiyon yerinde işaretler. C, Özgül omurilik (segment L3-L5) yüzeyinde boyama değil, omuriliğin iç. r = rostral, c = kaudal, cc = merkezi kanal. buraya tıklayınDaha büyük resmi görmek için.

Şekil 2,
Şekil 2. . Sonra, dorsal ve ventral, omurilik (burada WAVE1) hedeflenen bir proteinin başarılı aşağı regülasyonu intratekal siRNA doğum sonrası Fareler intratekal kontrol siRNA veya siRNA ile 3 kez arka arkaya, her 24 saat için PEI reaktif maddesi ile karıştırılır WAVE1 karşı hedef ya da enjekte edilmiştir lumbar spinal kord (bölüm 3-5) bölümünde, servikal spinal kord, beyin ve DRG, lize kesilmiş ve western blot ve QRT-PCR. AB, tabi tutulmuştur Western (n = 20), kurutma ve QRT-PCR (n = lumbar spinal kord dorsal bölümünde lizatından 6) miktar, ventral L3-L5 spinal kord, servikal omurilik, beyin ve DRG respe lizattan CF Western blot miktarctively (n = 4). Analiz Student t-testi (* P ≤ 0.05, ** P ≤ 0.005) tarafından idi. resmi büyütmek için buraya tıklayın .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bu nedenle, iğne intratekal enjeksiyonlar yukarıda tarif edilen teknik, etkili, hızlı, spesifik olarak lokalize edilmiş ve geri dönüşlü bir. Teknik olarak, bu prosedür, en kritik yönü oluk içine iğne sokulması noktasıdır. Bu prosedür çok sakin elleri ve sabır ile yapılır önemlidir. Birçok cerrahi işlemler gibi, eğitim başarılı enjeksiyon oranını artırır. Gerçek bir deney sırasında, bu teknik, doğrudan enjeksiyon başarılı olup olmadığını teyit etmek için açık bir göstergesi sağlamaz, çünkü bu da önemlidir. Doğru iğne yerleştirilmesi yalnızca görünen göstergesi bir refleks olarak görülmektedir kuyruk fiske.

Bu yöntem, tam olarak bu tür düşük dozajları ve sınırları yan etkileri verir spinal modülasyon, spesifitesi gibi diğer sistemik tatbikat yolları (örneğin, oral, intravenöz, intraperitoneal ve benzeri), intratekal fazla teslimat yararlarını muhafaza eder; furbaşka, intratekal enjeksiyonlar intratekal enjeksiyon sırasında iğne dura mater ve omurilik arasına sokulur olduğundan, normal olarak, çapraz kan-beyin bariyeri yok olan maddelerin teslim sağlar. Önemli bir şekilde, bununla birlikte, intratekal teslimat diğer yöntemlere kıyasla, intratekal enjeksiyon iğne yöntemi, herhangi bir önemli bir doku hasarı nedeni neden olan ya da yabancı madde implantasyonuna bağışıklık reaksiyonunu uyandırma olmadan aynı hayvanda bir çok uygulama sağlayan, en az invaziv.

Toplamda, bu raporda, akut intratekal iğne enjeksiyonu için temel adım-adım rehber değil sadece gösterildiği, aynı zamanda bu tekniği, doğaçlama bir örnek rapor nerede spinal in vivo siRNA transfeksiyon ve belirli gen demonte olarak kablosu elde edilebilir. Farmakolojik reaktifler ve PEI-kolaylaştırılmış siRNA teslim edilmesi yanında, intratekal enjeksiyon iğne yöntemi de ot kolaylaştırmak için kullanılabilirörneğin viral aracılı gen aktarımı 11 gibi gen transferi onun türleri. Yeterli uzmanlık kazanmıştır edildikten sonra, bu prosedür de uyanık, nonanesthetized farelerde 4,12 anestezi olmadan yapılabilir. Bu sağlanan fareler aşırı stres önlemek için preacclimatized olan davranışsal paradigmalar farmakolojik ajanların akut etkilerini incelemek için, örneğin, sağlar.

Böylece akut intratekal enjeksiyonlar spinal dorsal boynuz üzerinde çalışmalar ve tekniğin çok yönlülük denemecileri kişiselleştirmek ve hedeflerine uygun doğaçlama olanak için çok yararlı bir araç oluşturmaktadır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar herhangi bir mali çıkarlarını beyan.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats