I Vivo siRNA Transfection og Gene Knockdown i Spinal Cord via Rapid Noninvasiv Lumbar Intratekal Injeksjoner i Mus

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Denne rapporten beskriver en enkel og rask teknikk av intratekal nålestikk for en lokalisert transfeksjon av siRNA i ryggmargen i mus på korte varig lett anestesi.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Denne rapporten beskriver en steg-for-steg guide til teknikken for akutte intratekal nål injeksjoner i en ikke-invasiv måte, det vil si uavhengig av kateter implantasjon. Den tekniske begrensning av denne kirurgiske teknikken ligger i finesse av hendene. Injeksjonen er rask, spesielt for en trent eksperimentator, og siden vevsdesintegrasjon med denne teknikken er minimal, gjentatte injeksjoner er mulig, dessuten immunreaksjon på utenlandske verktøy (. F.eks kateter) ikke forekommer, og dermed gi en bedre og mer spesifikke lese ut i ryggmarg modulasjon. Siden anvendelsen av stoffet i stor grad er begrenset til målområdet av ryggmargen, medikamenter ikke trenger å bli brukt i store doser, og enda viktigere uønskede virkninger på andre vev, slik som for en systemisk levering, kan omgås 1, 2. Videre har vi kombinerer denne teknikken med in vivo transfeksjon av nukleinsyre ved hjelp av polyethylenimine (PEI) reagens 3, noe som gir enorme allsidighet for å studere spinal funksjoner via levering av farmakologiske midler i tillegg til genet, RNA-og protein-modulatorer.

Introduction

Ryggmargen er en meget viktig senter i en rekke viktige biologiske prosesser og fysiologiske funksjoner, inkludert behandling og overføring av smertefulle (nociceptive) innganger 4-7. Forskjellige eksperimentelle teknikker har blitt utviklet for å lette farmakologisk modulering av ryggmargen, som kronisk implantasjon av intratekal kateter 8, ryggmargsmikroinjeksjon, og intratekal injeksjon nålen 9.. Hver teknikk har sine egne fordeler og ulemper, og avhengig av eksperimentet paradigmet en teknikk som kan være mer egnet enn de andre. Mens kronisk implantasjon av intratekal katetre er lett gjennomførbart i rotte, er denne metoden svært vanskelig i musen, gitt størrelsesbegrensninger. Suksess er svært lav, og motoriske mangler ofte forekommer på grunn av den voluminøse nærvær av et kateter i den sterkt begrenset subdural plass i musen. Videre er langsiktig levering av legemidler gjengitt på grunn av hyppige clottingav kronisk implantert katetre. Endelig immunreaksjoner er vanlig.

Disse problemene kan omgås ved hjelp av metoden til akutt intratekal injeksjon via en kanyle i fravær av et preimplanted kateter, noe som muliggjør en rask og anatomisk begrenset anvendelse av medikamenter og reagenser til ryggmargen hos mus. Denne metoden beholder fullt ut fordelene ved intratekal over et andre systemiske leveringsveier (for eksempel oral, intravenøs, intraperitoneal, etc.) så som spesifisiteten av spinal modulasjon, noe som muliggjør reduserte doser og grense bivirkninger, så vel som evne til å levere stoffer som ikke normalt ikke krysse blod-hjerne barrieren siden under intratekal injeksjon, er nålen inn mellom dura mater og ryggmargen. Viktigere er imidlertid i forhold til andre metoder for intratekal levering, er det intratekal nål injeksjon metode den minst invasive, slik at en rekke bruksområder i densamme dyr uten å forårsake noen betydelig skade vev eller fremkaller immunreaksjon som følge av implantasjonen av fremmed materiale. Men, det krever tekniske ferdigheter for en svært presis målretting av nålen for å tillate effekt.

Her, vi visuelt demonstrere metoden for å oppnå en optimal hastighet på suksess for spesielt rettet mot ryggmargen. Injeksjonsstedet som er valgt i dette forsøk er i sporet mellom L5-og L6 vertebrate kolonne, i nærheten av der ryggmargen ender, for å minimalisere muligheten for skade på ryggraden. Videre, vi demonstrere bruken av denne teknikken til å slå ned gener i ryggmargen ved hjelp sirnas.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle dyre bruk prosedyrer var i samsvar med etiske retningslinjer fastsatt av lokale styrende organ (Regierungspräsidium Karlsruhe, Karlsruhe, Tyskland).

En. Utarbeidelse av siRNA / PEI Complex


SiRNA / PEI kompleks løsning er utarbeidet etter produsentens anvisninger som følger:

  1. Løsning A: Fortynn den ønskede mengden av siRNA med sterilt vann (om nødvendig) inntil en fjerdedel av volumet og fortynnes ytterligere med 10% glukoseoppløsning opp til halvparten av volumet pr. Vortex forsiktig eller bland ved pipettering opp og ned. Den optimale mengde av siRNA må bestemmes empirisk, men 1 ug siRNA i 10 mL kompleks løsning per dyr er et godt utgangspunkt for optimalisering.
  2. Løsning B: Fortynn det nødvendig volum av PEI-reagens med sterilt vann opp til en fjerdedel av volumet og fortynnes ytterligere med 10% glukoseoppløsning opp til halvparten av volumet pr. Vortex gently eller bland ved pipettering opp og ned.
    Merk: mengden av PEI reagens bestemmer den ioniske balansen i komplekset som påvirker effektiviteten av transfeksjon. Likeledes den optimale mengden av PEI-løsning må bestemmes empirisk. I våre hender, er den optimale mengden 0,12 mL av PEI løsning per 1 mikrogram siRNA.
  3. Bland løsning A med løsning B på en gang, vortex forsiktig.
  4. Inkuber den blandede oppløsningen i 15 min ved RT før bruk. Dette kompleks er stabilt i 2 timer ved romtemperatur og i 24 timer ved 4 ° C.

2. Intratekal Injection

  1. Anesthetize mus med 3% isofluran, helt til det viser ingen tegn til å rettende refleks. I tillegg se etter halen og / eller pote klype refleks for ytterligere å sikre staten anestesi.
  2. Barber ca 2 cm 2 av pels ved den bakre enden av dyret ved haleroten for å lette en bedre visualisering under nålestikk.
  3. Plasser musen ien nese kjegle for en fortsatt isofluran administrasjon under prosedyren, redusere isofluran til 1,5%, og dekker øynene til musa med øye smøremiddel.
  4. Forbered klar til bruk siRNA blandet løsning ved hjelp av en 25 mL Hamilton sprøyte festet til en 30 G 0,5 i nål.
  5. Finn spinous prosessen med L6, som skal være den mest fremtredende en og fikse virveldyr kolonnen rundt dette området ved å trykke den forsiktig.
  6. Sett forsiktig nålen mellom sporet av L5 og L6 ryggvirvler og observere for en hale flick som dette skiltet indikerer en vellykket oppføring av nålen i intradural plass.
    Tips: Bruk fingernegl, bør man være i stand til å finne sporet også.
  7. Når halen flick er observert, umiddelbart, men forsiktig, fest nålen posisjon med en hånd og injisere det ønskede volum av stoffet med den andre hånden sakte.
    Tips: et volum mellom 5-10 er ul optimal som volum mindre enn 5 &# 181; l er upålitelig og et volum større enn 10 mL fører til for mye press.
  8. Når injeksjon utføres, flytter musen tilbake til buret for å komme seg fra anestesi.
  9. Gjenta denne injeksjon i det minste to ganger hver 24. time for å oppnå optimal nedregulering av den målrettede genet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

For å illustrere en vellykket injeksjon, utførte vi denne teknikken bruker Fast Grønn FCF fargestoff i voksen C57Bl6 mus (8-10 ukers alder). Dyret fikk komme seg i noen minutter etter injeksjonen for å gi nok tid til at fargestoffet til å spre seg og så drept med en overdose av CO2. Deretter ble virveldyr kolonne dissekert og ryggmargen ble utsatt. Det blå puncta svarende til diffust fargestoff, som er merket på injeksjonsstedet. Ingen tegn til skade på ryggmargen kan bli sett, bekrefter minimal invasiv art av denne teknikken (figur 1A). Den injiserte fargestoff diffust fra injeksjonsstedet rostrally, når opp til thorax-regionen i ryggmargen, bare få minutter etter injeksjonen (Figur 1B). Videre har den vellykkede infusjon av fargestoffet i epiduralrommet kan bli påvist av den beisede overflate av ryggmargen, men ikke det indre (fig. 1C).

in vivo transfeksjon inn i ryggmargen. Etter siRNA intratekal levering (3x, en gang hver 24 timer), ble ekspresjon av den målrettede protein (her Wave1) på lysater avledet fra dorsal-L3 L5 spinal vev reduseres til omtrent 70% i protein-nivå (fig. 2A, n = 20) så vel som i mRNA nivå (figur 2B, n = 6). Videre har en downregulation i samme størrelsesorden kan også sees i lysatet av den ventrale delen (figur 2C, n = 4). Interessant nok en enda noe sterkere downregulation, ble også sett i lysatet av cervikal ryggmargen (figur 2D, n = 4). Men til tross for at en lignende metode er blitt brukt til å nedregulere genet i vev utenfor ryggmargen 10, i våre hender dette downregulation ble ikke observert i lysatet av hjernen (figur 2E, n = 4) eller den DRGs (figur 2F, n = 4).

Figur 1
Figur 1. Ryggmargs dissekert under mikroskopet følgende ikke invasiv, akutt intratekal injeksjon med Fast grønt fargestoff. En kan sees Ingen synlige tegn på vevsskade på injeksjonsstedet, preget av fargestoffet puncta. B, skåret ryggmarg få minutter etter injeksjon som viser den gradvise spredningen av fargestoff i rostral retning. Hvite boksen markerer korsrygg, og stjernen markerer injeksjonsstedet. C, Spesifikk flekker på overflaten av ryggmargen (segment L3-L5), men ikke interiøret i ryggmargen. r = rostral, c = caudal, cc = sentrale kanalen. Klikk herå se større bilde.

Fig. 2
Figur 2. . Vellykket nedregulering av målrettet protein (her Wave1) i ryggmargen etter intratekal siRNA levering Mus ble intrathecally injisert enten med kontroll siRNA eller siRNA rettet mot Wave1 blandet med PEI reagens for tre ganger på rad hver 24 time, deretter, rygg-og ventral del av den lumbale ryggmargen (segment 3-5), ble cervikal ryggmarg, hjerne og DRGs fjernet, lysert og utsatt for Western blot-og QRT-PCR. AB, Western blotting (n = 20) og QRT-PCR (n = 6) kvantifisering fra lysatet av rygg delen av ryggmargen, CF Western blotting kvantifisering fra lysatet av ventral L3-L5 ryggmarg, cervical ryggmargen, hjernen og DRG respectively (n = 4). Analyse var ved uparet student t-test (* P ≤ 0,05, ** P ≤ 0005). Klikk her for å se større bilde .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Således er den ovenfor beskrevne teknikk for intratekale injeksjoner nål effektiv, rask, spesielt-lokalisert, og ikke-destruktiv. Teknisk sett er det mest kritiske aspekt ved denne fremgangsmåten punktet for nålestikk i sporet. Det er avgjørende at denne prosedyren er gjort med svært rolige hender og tålmodighet. I likhet med mange kirurgiske prosedyrer, forbedrer trening frekvensen av vellykket injeksjon. Dette er også viktig fordi under en faktisk forsøk, denne teknikk ikke gi en klar indikator for å bekrefte hvorvidt et direkte injeksjon er vellykket eller ikke. Den eneste synlige indikator på riktig nålen innsetting er halen flick som er observert som en refleks.

Denne metoden beholder fullt ut fordelene ved intratekal over et andre systemical leveringsveier (for eksempel oral, intravenøs, intraperitoneal, etc.), for eksempel spesifisiteten av spinal modulasjon, noe som muliggjør reduserte doser og begrenser bivirkninger; furUten ble intrathecal injeksjoner muliggjøre levering av stoffer som er normalt ikke kryss barriere blod-hjerne-siden under intratekal injeksjon, er nålen inn mellom dura mater og ryggmargen. Viktigere, men i forhold til andre metoder for intratekal levering, er det intratekal nål injeksjon metode den minst invasive, slik at en rekke bruksområder i samme dyr uten å forårsake noen betydelig skade vev eller fremkaller immunreaksjon på grunn av implantasjon av fremmedlegemer.

Til sammen i denne rapporten, har vi vist ikke bare enkel steg-for-steg guide til akutt intratekal injeksjon med sprøyte, men også rapportere et eksempel på improvisasjon av denne teknikken, der i en in vivo siRNA transfeksjon og bestemt gen knockdown i rygg ledningen kan oppnås. Ved levering av farmakologiske reagenser og PEI-tilrettelagt siRNA levering, kan den intratekal nålen injeksjonsmetoden også benyttes til å forenkle othennes typer av genoverføring, for eksempel viral-mediert gen-levering 11.. Når tilstrekkelig kompetanse er høstet, kan denne prosedyren også utføres uten bedøvelse i våken, nonanesthetized mus 4,12. Dette gjør det mulig for eksempel å studere akutte effekter av farmakologiske midler i atferds paradigmer gitt mus preacclimatized å hindre overdreven stress.

Dermed akutte intrathecal injeksjoner utgjør et svært nyttig verktøy for studier på rygg dorsalhorn og allsidigheten av teknikken tillater forskere å tilpasse og improvisere for å passe sine mål.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen konkurrerende økonomiske interesser.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats