In Vivo SiRNA transfecção e Gene Knockdown em Spinal Cord via rápida não invasiva lombar intratecal Injeções em Ratos

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Este relatório descreve uma técnica simples e rápida de punção intratecal para a transfecção localizada de siRNA na medula espinhal lombar em rato sob anestesia luz de curta duração.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Este relatório descreve um guia passo-a-passo para a técnica de injeção intratecal de agulhas agudas de forma não invasiva, ou seja, independente da implantação do cateter. A limitação técnica desta técnica cirúrgica encontra-se na delicadeza das mãos. A injeção é rápida, especialmente para um experimentador treinado, e desde rompimento do tecido com esta técnica é mínima, injeções repetidas são possíveis, além disso reação imune a ferramentas externas (. Eg cateter) não ocorre, dando assim uma melhor e mais específico LER de modulação da medula espinal. Uma vez que a aplicação da substância é essencialmente limitada à região alvo da medula espinal, as drogas não precisa de ser aplicado em grandes dosagens, e mais importante, os efeitos indesejados sobre outros tecidos, tal como observado com uma administração sistémica, pode ser contornado 1, 2. Além disso, combinar esta técnica com a transfecção in vivo de ácido nucleico, com a ajuda de polyethylenimine (PEI) de reagente 3, o qual proporciona uma enorme versatilidade para o estudo de funções da coluna vertebral através da administração de agentes farmacológicos, bem como do gene, RNA, e de moduladores de proteínas.

Introduction

A medula espinhal é um centro muito importante em uma variedade de processos biológicos fundamentais e as funções fisiológicas, incluindo o processamento e transmissão de dolorosas (nociceptivos) entradas 4-7. Foram desenvolvidas várias técnicas experimentais para facilitar a modulação farmacológica da medula espinal, tais como implantação crónica de cateteres intratecais 8, espinal medula microinjecção, e injecção intratecal de agulha 9. Cada técnica tem as suas próprias vantagens e desvantagens, e dependendo do paradigma experimental uma técnica podem ser mais adequados do que os outros. Considerando a implantação crônica de cateteres intratecal é facilmente viável em ratos, este método é muito difícil no mouse, dado as restrições de tamanho. A taxa de sucesso é muito baixo e os défices motores frequentemente ocorrer devido à presença de um volumoso cateter no espaço subdural severamente confinado no rato. Além disso, a entrega a longo prazo de drogas é processado devido a coagulação freqüentede cronicamente implantados cateteres. Finalmente, as reações imunológicas são comuns.

Estes problemas podem ser contornados utilizando o método de injecção intratecal aguda por meio de uma agulha, na ausência de um cateter preimplanted, o que permite uma aplicação rápida e anatomicamente limitado de medicamentos e reagentes para as medulas espinhais em ratinhos. Este método mantém totalmente os benefícios da entrega intratecal sobre outras vias de administração sistémica (por exemplo, oral, intravenosa, intraperitoneal, etc), tais como especificidade de modulação espinal, que permite doses reduzidas e limite de efeitos secundários, bem como a capacidade de fornecer substâncias não fazer normalmente não atravessam a barreira hematoencefálica, uma vez durante a injecção intratecal, a agulha é inserida entre a dura-máter e da medula espinhal. Importante, no entanto, em comparação com outros métodos de administração intratecal, o método de injecção intratecal agulha é o menos invasivos, permitindo numerosas aplicações namesmo animal, sem causar qualquer dano ao tecido considerável ou evocando reação imunológica devido à implantação de material estranho. No entanto, requer habilidades técnicas para uma segmentação muito preciso da agulha para permitir a eficácia.

Aqui, nós demonstrar visualmente o método para alcançar uma taxa ótima de sucesso para visando especificamente a medula espinhal lombar. O local de injecção que é escolhida nesta experiência é o sulco entre L5 e L6 coluna vertebrado, perto de onde a medula espinal termina, para minimizar a possibilidade de danificar a coluna. Além disso, demonstramos o uso desta técnica para derrubar genes na medula espinhal usando siRNAs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os procedimentos de uso de animais estavam de acordo com as diretrizes éticas estabelecidas pelo órgão local (Regierungspräsidium Karlsruhe, Karlsruhe, Alemanha).

1. Preparação de siRNA / PEI Complexo


A solução complexa siRNA / PEI é preparada com as instruções do fabricante da seguinte forma:

  1. Solução A: Dilui-se a quantidade desejada de siRNA com água estéril (se necessário) até um quarto do volume final e diluir este ainda com solução de glicose a 10% até a metade do volume final. Vortex suavemente ou misture pipetando cima e para baixo. A quantidade ideal de siRNA precisa ser determinada empiricamente, mas 1 mg siRNA em 10 mL solução complexa por animal é um bom ponto de partida para a otimização.
  2. Solução B: Diluir o volume necessário de reagente PEI com água estéril até um quarto do volume final e diluir esta ainda mais com solução de glicose a 10% até a metade do volume final. Vortex gently ou misture pipetando cima e para baixo.
    Nota: A quantidade de reagente de PEI determina o equilíbrio iónico no complexo, o que influencia a eficiência da transfecção. Do mesmo modo a quantidade óptima de solução de PEI tem que ser determinado empiricamente. Em nossas mãos, a quantidade ideal é de 0,12 ml de solução de PEI por 1 mg siRNA.
  3. Misture a solução A com a solução B de uma só vez, vortex suavemente.
  4. Incubar a solução da mistura durante 15 min à temperatura ambiente antes da sua utilização. Este complexo é estável durante 2 horas à temperatura ambiente e durante 24 horas a 4 ° C.

2. Injeção intratecal

  1. Anestesiar o mouse com 3% de isoflurano, até que ele não mostra sinais de reflexo de endireitamento. Além disso, verificar a existência de cauda e / ou pata pitada reflexo para garantir ainda mais o estado de anestesia.
  2. Raspar a cerca de 2 cm 2 de pele na parte posterior do animal, perto da base da cauda, ​​para facilitar uma melhor visualização durante a inserção da agulha.
  3. Coloque o mouse emum cone de nariz para uma administração contínua de isoflurano durante o procedimento, reduzir o isoflurano a 1,5%, e cobrir os olhos do rato com lubrificante ocular.
  4. Prepare o pronto para usar solução mista siRNA usando um 25 mL Hamilton seringa ligada a um 30 G 0,5 na agulha.
  5. Localize o processo espinhoso da L6, que deve ser um dos mais proeminentes e fixar a coluna de vertebrados em torno desta área, pressionando-o suavemente.
  6. Insira com cuidado a agulha entre o sulco de L5 e L6 vértebras e observar um movimento de cauda como este signo indica uma entrada bem sucedida da agulha no espaço intradural.
    Dica: Usando unha, deve-se ser capaz de localizar o sulco também.
  7. Depois da retirada da cauda é observada, de imediato, mas com cuidado, proteger a posição da agulha com uma mão e injetar o volume desejado de substância com a outra mão lentamente.
    Dica: um volume entre 5-10 mL é o ideal como o volume de menos de 5 &# 181; l não é confiável e um volume maior que 10 ml leva a muita pressão.
  8. Uma vez que a injeção é feita, mova o mouse de volta para a jaula para se recuperar da anestesia.
  9. Repetir esta injecção de, pelo menos, mais duas vezes a cada 24 horas para se conseguir a regulação negativa óptima do gene alvo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

A fim de ilustrar uma injecção bem sucedida, foi realizada utilizando a técnica rápida de corante verde FCF em adultos ratinhos C57Bl6 (8-10 semanas de idade). O animal foi deixado a recuperar durante alguns minutos após a injecção, para dar tempo suficiente para que o corante de espalhar e em seguida sacrificados com uma dose excessiva de CO2. Subsequentemente, a coluna foi dissecado vertebrado e a medula espinhal foi exposta. O puncta azul correspondente ao corante difusa, marcado no local da injecção. Nenhum sinal de lesão na medula espinal pode ser visto, o que confirma a natureza minimamente invasiva desta técnica (Figura 1A). O corante injectado difundido do local de injecção rostral, chegando-se à região torácica da medula espinal, de poucos minutos após a injecção (Figura 1B). Além disso, a infusão de sucesso do corante no espaço epidural pode ser comprovada pela superfície manchada da espinal medula, mas não o interior (Figura 1C).

in vivo para a medula espinhal. Após siRNA entrega intratecal (3x, uma vez a cada 24 horas), a expressão da proteína alvo (aqui WAVE1) em lisados ​​derivados de dorsal L3-L5 tecido espinal foi reduzida para cerca de 70% no nível de proteína (Figura 2A, n = 20) , bem como no nível de ARNm (Figura 2B, n = 6). Além disso, uma regulação negativa de uma magnitude semelhante, também pode ser visto no lisado da secção ventral (Figura 2C, n = 4). Curiosamente, uma regulação negativa, mesmo que ligeiramente mais forte, também foi observada em lisados ​​de cervical da medula espinhal (Figura 2D, n = 4). Mas, não obstante o facto de um método semelhante foi utilizado para regular negativamente genes em tecidos fora da medula espinal 10, nas nossas mãos este regulação negativa, não foi observado no ligado do cérebro (Figura 2E, n = 4), nem o DRGs (Figura 2F, n = 4).

Figura 1
Figura 1. Medular dissecados sob o microscópio após a injecção não invasivo, aguda intratecal com corante verde rápido. Um, nenhum sinal visível de lesão no tecido pode ser visto no local de injecção, caracterizada por os pontos lacrimais corante. B, da medula espinal excisada poucos minutos após a injecção, mostrando a difusão progressiva do corante no sentido rostral. Caixa branca marca região lombar, e a estrela marca o local de injecção. C, coloração específica sobre a superfície de medulas espinhais (segmento L3-L5), mas não no interior da medula espinal. r = rostral, c = caudal, cc = canal central. Clique aquipara ver a imagem maior.

Figura 2
Figura 2. . Downregulation bem sucedida da proteína alvo (aqui WAVE1) na medula espinal após a entrega do siRNA intratecal Os ratinhos foram injectados por via intratecal quer com o controlo de siRNA ou siRNA dirigido contra WAVE1 misturado com o reagente de PEI durante 3 vezes consecutivas cada 24 horas, depois disso, o dorsal e ventral secção da medula espinal lombar (segmento de 3-5), a medula espinal, cérebro e DRG cervical foram excisadas, lisadas e sujeitas a transferência de western e de qRT-PCR. AB, Western blot (n = 20) e de qRT-PCR (n = 6) Quantificação do lisado de secção dorsal da medula espinal lombar, CF transferência Western quantificação do lisado de ventral L3-L5 da medula espinal, medula espinhal cervical, cerebral e DRG respectively (n = 4). Análise foram pelo teste t de Student não pareado (* P ≤ 0,05, ** P ≤ 0,005). Clique aqui para ver a imagem ampliada .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Assim, a técnica de injecções intratecais agulhas acima descrito é eficaz, rápida, especificamente localizada, e não destrutivos. Tecnicamente, o aspecto mais importante deste processo é o ponto de inserção da agulha para dentro da ranhura. É fundamental que este procedimento é feito com as mãos e paciência muito calmas. Como muitos procedimentos cirúrgicos, a formação melhora a taxa de injecção com sucesso. Isso também é importante porque durante um experimento real, esta técnica não fornece um indicador óbvio para confirmar diretamente se uma injeção é bem sucedido ou não. O único indicador visível da inserção da agulha correta é a de retirada de cauda que é observado como um reflexo.

Este método mantém totalmente os benefícios da entrega intratecal sobre outras vias sistêmicas de entrega (por exemplo, oral, intravenosa, intraperitoneal, etc), tais como especificidade de modulação da coluna vertebral, o que permite doses reduzidas e efeitos colaterais limites; peledisso, as injecções intratecais permitir a entrega de substâncias que não são normalmente não barreira hematoencefálica, uma vez cruzado durante a injecção intratecal, a agulha é inserida entre a dura-máter e da medula espinhal. É importante notar, no entanto, em comparação com outros métodos de administração intratecal, o método de injecção intratecal agulha é o menos invasivos, permitindo uma inúmeras aplicações no mesmo animal, sem causar qualquer dano ao tecido considerável ou evocar reacção imune devido ao implante de material estranho.

Ao todo, neste relatório, mostramos não só o guia passo-a-passo para injeção intratecal agulha aguda, mas também relatam um exemplo de improvisação desta técnica, onde em um in vivo siRNA transfecção e gene específico knockdown na medula cabo pode ser conseguida. Ao lado de entrega de reagentes farmacológicos e entrega siRNA PEI-facilitada, o método da injecção intratecal de agulha também pode ser utilizada para facilitar a otos tipos de transferência de genes, tais como a entrega de genes mediada por vírus 11. Uma vez que experiência suficiente adquirida, este procedimento também pode ser realizado sem anestesia em vigília, camundongos nonanesthetized 4,12. Isso permite, por exemplo, para estudar os efeitos agudos de agentes farmacológicos de paradigmas comportamentais camundongos fornecidas são preacclimatized para evitar o stress excessivo.

Assim, a injeção intratecal agudas constituem uma ferramenta muito útil para os estudos sobre o corno dorsal da medula ea versatilidade da técnica permite que pesquisadores para personalizar e improvisar para atender seus objetivos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram não haver interesses financeiros concorrentes.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats