In Vivo siRNA transfektion og Gene Knockdown i Spinal Cord via Rapid Noninvasiv Lumbar Intrathekal Injektioner i mus

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Denne rapport beskriver en enkel og hurtig teknik til intratekal nål punktering for en lokaliseret transfektion af siRNA i den lumbale rygmarv i mus under kortvarig let anæstesi.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Denne rapport beskriver en trin-for-trin guide til teknikken af akutte intratekal nål injektioner på en noninvasiv måde, dvs uafhængigt af kateter implantation. Den tekniske begrænsning af denne kirurgiske teknik ligger i finesse af hænderne. Injektionen er hurtig, især for en uddannet eksperimentatoren, og siden vævsødelæggelse med denne teknik er minimal, er mulige gentagne injektioner og desuden immunreaktion udenlandske værktøj (. F.eks kateter) ikke forekommer, hvilket giver en bedre og mere specifik udlæses af rygmarven graduering. Da anvendelsen af stoffet i høj grad er begrænset til målområdet i rygmarven, kan lægemidler, der ikke skal anvendes i store doser, og endnu vigtigere uønskede virkninger på andre væv, som observeret en systemisk levering, kunne blive omgået 1, 2. Desuden har vi kombinere denne teknik med in vivo-transfektion af nukleinsyre ved hjælp af polyethylenimine (PEI) reagens 3, som giver enorme alsidighed til at studere spinal funktioner via levering af farmakologiske midler samt gen, RNA og protein-modulatorer.

Introduction

Rygmarven er en meget vigtigt centrum i en lang række vigtige biologiske processer og fysiologiske funktioner, herunder behandling og transmission af smertefulde (nociceptive) indgange 4-7. Forskellige eksperimentelle teknikker er blevet udviklet for at lette farmakologisk modulation af rygmarv, såsom kronisk implantation af intratekale katetere 8, rygmarv mikroinjektion og intrathecal injektion med nål 9. Hver teknik har sine egne fordele og ulemper, og afhængig af eksperimentet paradigme en teknik kan være mere egnede end de andre. Betragtninger kronisk implantation af intratekal katetre er let gennemførlig i rotter, er meget vanskeligt denne metode i mus, givet størrelse restriktioner. Succes er meget lav og motoriske underskud opstår ofte på grund af den omfangsrige tilstedeværelse af et kateter i den alvorligt begrænset subduralt plads i mus. Desuden er langsigtet afgivelse af lægemidler gengives på grund af hyppig størkningaf kronisk implanterede katetre. Endelig immunreaktioner er almindelige.

Disse problemer kan afhjælpes ved anvendelse af fremgangsmåden af akut intratekal injektion via en nål i fravær af en preimplanted kateter, som muliggør en hurtig og anatomisk begrænsede anvendelse af lægemidler og reagenser til rygmarven i mus. Denne metode bevarer fuldt ud fordelene ved intratekal levering via andre systemiske administrationsveje (fx oral, intravenøs, intraperitoneal osv.), såsom specificiteten af spinal modulation, der tillader reducerede doseringer og begrænse bivirkninger, såvel som evnen til at levere stoffer ikke normalt ikke krydse blod-hjerne barrieren, da løbet intratekal injektion, indsættes nålen mellem dura mater og rygmarven. Vigtigere men i forhold til andre metoder til intratekal levering, intratekal nåleinjektion metode er den mindst invasive, så talrige anvendelser isamme dyr uden at forårsage nogen betydelig vævsskade eller fremkalder immunreaktion grund implantation af fremmed materiale. Men det kræver tekniske færdigheder for en meget præcis målretning af nålen for at tillade effekt.

Her har vi visuelt demonstrere metode til at opnå en optimal hastighed på succes for specifikt rettet mod den lumbale rygmarv. Injektionsstedet der er valgt i dette eksperiment er rillen mellem L5 og L6 hvirveldyr kolonne, tæt på hvor rygmarven slutter, for at minimere risikoen for at beskadige rygsøjlen. Desuden vi demonstrere brugen af ​​denne teknik til at vælte gener i rygmarven ved hjælp siRNAs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle dyreforsøg procedurer var i overensstemmelse med etiske retningslinjer, der er fastlagt af den lokale ledelsesorgan (Regierungspräsidium Karlsruhe, Karlsruhe, Tyskland).

1.. Fremstilling af siRNA / PEI Complex


SiRNA / PEI-kompleks opløsning fremstilles ved anvendelse af producentens anvisninger som følger:

  1. Opløsning A: Fortynd den ønskede mængde siRNA med sterilt vand (om nødvendigt) op til en fjerdedel af enden volumen og fortynde denne yderligere med 10% glucoseopløsning op til halvdelen af ​​enden volumen. Vortex forsigtigt eller blandes ved pipettering op og ned. Den optimale mængde af siRNA skal bestemmes empirisk, men 1 ug siRNA i 10 pi kompleks løsning per dyr er et godt udgangspunkt for optimering.
  2. Opløsning B: Fortynd den nødvendige mængde af PEI-reagens med sterilt vand op til en fjerdedel af enden volumen og fortynde dette yderligere med 10% glucoseopløsning op til halvdelen af ​​slutvolumen. Vortex gently eller blandes ved pipettering op og ned.
    Bemærk: den mængde af PEI reagens bestemmer den ioniske balance i komplekset, som har indflydelse på effektiviteten af ​​transfektion. Ligeledes den optimale mængde af PEI-opløsning skal bestemmes empirisk. I vores hænder, den optimale mængde er 0,12 ul PEI opløsning pr 1 ug siRNA.
  3. Bland opløsning A med opløsning B på én gang, vortex forsigtigt.
  4. Inkuber den blandede opløsning i 15 minutter ved stuetemperatur før brug. Dette kompleks er stabilt i 2 timer ved stuetemperatur og i 24 timer ved 4 ° C.

2. Intratekal injektion

  1. Bedøve mus med 3% isofluran, indtil det viser ingen tegn på stabilitetsrefleks. Derudover, så tjek for hale og / eller pote knivspids refleks yderligere at sikre en tilstand af anæstesi.
  2. Barbere omkring 2 cm2 af pels på den bageste ende af dyret nær bunden af halen for at fremme en bedre visualisering under indføring af kanylen.
  3. Placer musen ien næse kegle for en fortsat isofluran administration under proceduren, reducere isofluran til 1,5%, og dækker øjnene af mus med øje smøremiddel.
  4. Forbered klar til at bruge siRNA blandede opløsning ved hjælp af en 25 ul Hamilton sprøjte knyttet til en 30 G 0,5 i nål.
  5. Find den spinosus proces L6, som bør være den mest fremtrædende og løse hvirveldyr kolonnen omkring dette område ved at trykke det forsigtigt.
  6. Sæt forsigtigt nålen mellem rillen af ​​L5 og L6 ryghvirvler og observere for en hale svirp, da dette tegn indikerer en vellykket indtræden af ​​nålen i intradural rum.
    Tip: Brug af fingernegl, skal man være i stand til at lokalisere rillen så godt.
  7. Når haleslag overholdes, det samme, men omhyggeligt, sikre nåleposition med den ene hånd og injicere den ønskede mængde af stoffet med den anden hånd langsomt.
    Tip: en volumen mellem 5-10 pi er optimal som volumen mindre end 5 &# 181; l er upålidelige, og et volumen større end 10 ul fører til for meget pres.
  8. Når injektionen er udført, skal du flytte musen tilbage til buret for at komme sig efter anæstesi.
  9. Gentag denne injektion mindst endnu 2 gange hver 24 timer for at opnå optimal nedregulering af målgenet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

For at illustrere en vellykket injektion, udførte vi denne teknik ved hjælp af Fast Green FCF-farvestof i voksne C57Bl6 mus (8-10 uger). Dyret fik lov til at komme sig efter et par minutter efter injektion for at give tilstrækkelig tid til farvestoffet til at sprede og derefter dræbt med en overdosis af CO 2. Efterfølgende blev hvirveldyr kolonnen dissekeret og rygmarven blev blotlagt. Den blå puncta svarende til den spredte farvestof, mærket injektionsstedet. Intet tegn på skade på rygmarven kunne ses, bekræfter den minimalt invasive karakter af denne teknik (figur 1A). Den injicerede farvestof diffust fra injektionsstedet rostrally, og nåede op til den bryst-regionen af rygmarven, kun få minutter efter injektion (figur 1B). Desuden vellykket infusion af farvestoffet i epiduralrummet kunne bevises af den farvede overflade af rygmarven, men ikke det indre (figur 1C).

in vivo transfektion ind i rygmarven. Efter siRNA intratekal levering (3x gang hver 24 timer) blev ekspressionen af målrettet protein (her WAVE1) om lysater afledt fra dorsal L3-L5 rygmarvsvæv reduceret til omkring 70% i proteinniveau (figur 2A, n = 20) samt i mRNA-niveauet (figur 2B, n = 6). Desuden vil en nedregulering af samme størrelsesorden kan også ses i lysatet af den ventrale del (figur 2C, n = 4). Interessant nok et endnu lidt stærkere nedregulering, blev også set i lysatet af cervikal rygmarv (figur 2D, n = 4). Men på trods af det faktum, at en lignende fremgangsmåde er blevet anvendt til at nedregulere genet i væv uden rygmarv 10, i vore hænder denne nedregulering blev ikke observeret i lysatet af hjernen (figur 2E, n = 4) eller DRGs (figur 2F, n = 4).

Figur 1
Figur 1. Rygmarv dissekeret under lup følgende ikke invasive, akut intratekal injektion med Fast Green farvestof. A, kan Ingen synlige tegn på vævsskade ses på injektionsstedet, præget af farvestoffet puncta. B, udskåret rygmarv få minutter efter injektion viser den gradvise diffusion af farvestoffet i rostrale retning. White box markerer lænden, og stjernen markerer injektionsstedet. C Specifik farvning på overfladen af rygmarven (segment L3-L5), men ikke det indre af rygmarven. r = rostrale, c = caudale, cc = central kanal. Klik herfor at se større billede.

Figur 2
Figur 2. . Vellykket nedregulering af den målrettede protein (her WAVE1) i rygmarven efter intratekal siRNA levering Mus blev intrathecalt injiceret enten med kontrol siRNA eller siRNA rettet mod WAVE1 blandet med PEI reagens til 3 på hinanden følgende gange hver 24 timer; derefter ryg og ventrale sektion af den lumbale rygmarv (segment 3-5) blev cervikale rygmarv, hjerne og DRG udskåret, lyseret og underkastet western blotting og QRT-PCR. AB, Western blotting (n = 20) og QRT-PCR (n = 6) kvantificering fra lysat af dorsale del af lumbale rygmarv, CF Western blotting kvantificering fra lysat af ventrale L3-L5 rygmarv, cervikal rygmarv, hjerne og DRG respektivctively (n = 4). Analyse var ved uparret student t-test (* P ≤ 0,05, ** P ≤ 0,005). Klik her for at se større billede .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

De ovenfor beskrevne teknik intratekal nål injektioner er effektiv, hurtig, specielt lokaliseret og ikke-destruktiv. Teknisk set mest kritiske aspekt af denne procedure er det punkt af indføring af kanylen ind i rillen. Det er afgørende, at denne procedure er gjort med meget rolige hænder og tålmodighed. Ligesom mange kirurgiske procedurer, uddannelse forbedrer hastigheden af ​​en vellykket injektion. Det er også vigtigt, fordi i et virkeligt eksperiment, er denne teknik ikke en indlysende indikator direkte bekræfte, om en injektion er vellykket eller ej. Den eneste synlige indikator for korrekt indføring af kanylen er halen svirp, der er observeret som en refleks.

Denne metode bevarer fuldt ud fordelene ved intratekal levering via andre systemical levering ruter (f.eks oral, intravenøs, intraperitoneal osv.), såsom specificitet spinal modulation, der tillader reducerede doseringer og begrænsninger bivirkninger; pelsdere intrathekale injektioner muliggøre levering af stoffer, der normalt ikke cross blod-hjerne barrieren, da løbet intratekal injektion, indsættes nålen mellem dura mater og rygmarven. Vigtigere er det, men i forhold til andre metoder til intratekal levering, intratekal nål injektion metode er den mindst invasive, så en lang række applikationer i det samme dyr uden at forårsage nogen betydelig vævsskade eller fremkalder immunreaktion grund implantation af fremmed materiale.

Alt i alt, i denne rapport har vi vist ikke kun de grundlæggende trin-for-trin guide til akut intratekal nål injektion, men også rapportere et eksempel på improvisation af denne teknik, hvor i et in vivo siRNA transfektion og bestemt gen knockdown i spinal ledning kan opnås. Udover levering af farmakologiske reagenser og PEI-faciliteret siRNA levering, kan det intratekale nåleinjektion metoden også anvendes til at lette othendes typer af genoverførsel, såsom viral-medieret gen levering 11. Når tilstrækkelig ekspertise er opnået, kan denne procedure også udføres uden bedøvelse i vågen, nonanesthetized mus 4,12. Dette gør det muligt for eksempel at undersøge akutte virkninger af farmakologiske midler i adfærdsmæssige tilvejebragte paradigmer mus preacclimatized at forhindre overdreven stress.

Således akutte intrathecale injektioner udgør et meget nyttigt værktøj til undersøgelser af spinal dorsale horn og alsidigheden af ​​teknikken tillader eksperimentatorer at tilpasse og improvisere, der passer til deres mål.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer ingen konkurrerende finansielle interesser.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats