In vivo siRNA-Transfektion und Gene Knockdown im Rückenmark über Rapid-Nichtinvasive Lendenwirbel intrathekale Injektionen in Mäuse

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Dieser Bericht beschreibt eine einfache und schnelle Technik der intrathekalen Punktion für eine lokalisierte Transfektion von siRNA in der Lenden-Wirbelsäule in der Maus unter Kurznarkose dauerhafte Licht.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dieser Bericht beschreibt eine Schritt-für-Schritt-Anleitung für die Technik der akuten intrathekalen Nadel-Injektionen in einer nicht-invasive Weise, dh unabhängig von der Katheter-Implantation. Der technische Nachteil dieser Operationstechnik liegt in der Feinheit der Hände. Die Einspritzung schnell, vor allem für einen geschulten Experimentator, und da Gewebezerstörung mit dieser Technik minimal ist, sind wiederholte Injektionen möglich, außerdem Immunreaktion auf Fremdwerkzeugen (. Z. B. Katheter) tritt nicht auf, wodurch eine bessere und spezifischere ausgelesen Rückenmarks Modulation. Da die Anwendung der Substanz im Wesentlichen auf die Zielregion des Rückenmarks beschränkt sind, Arzneimittel, nicht in großen Dosierungen angewendet werden müssen, und vor allem unerwünschte Wirkungen auf andere Gewebe, wie bei einer systemischen Verabreichung beobachtet dann umgangen werden, 1, 2. Darüber hinaus kombinieren wir diese Technik mit in-vivo-Transfektion von Nukleinsäure mit Hilfe polyethylenimine (PEI)-Reagens 3, die enorme Vielseitigkeit für die Untersuchung der Wirbelsäule Funktionen über Lieferung von pharmakologischen Wirkstoffen sowie Gen-, RNA-und Protein-Modulatoren zur Verfügung stellt.

Introduction

Das Rückenmark ist ein sehr wichtiges Zentrum in einer Vielzahl von wichtigen biologischen Prozessen und physiologischen Funktionen, einschließlich der Verarbeitung und Übertragung von schmerzhaften (nozizeptiven) Eingängen 4-7. Verschiedene experimentelle Techniken entwickelt, um pharmakologische Modulation des Rückenmarks, wie chronische Implantation intrathekalen Katheter 8, Rückenmark-Mikroinjektion und intrathekale Injektion Nadel 9 zu ermöglichen. Jedes Verfahren hat seine eigenen Vorteile und Nachteile, je nach dem Experiment Paradigma eine Technik vielleicht besser geeignet als die anderen. Während chronische Implantation von intrathekalen Katheter ist ohne weiteres möglich in Ratte, ist diese Methode sehr schwierig in der Maus, da Größenbeschränkungen. Erfolgsquote ist sehr niedrig und motorische Defizite auftreten, oft aufgrund der sperrigen Anwesenheit eines Katheters in der stark beschränkt Subduralraum in der Maus. Darüber hinaus wird langfristig Abgabe von Medikamenten durch häufige Gerinnungs gemachtchronisch implantierten Katheter. Schließlich sind Immunreaktionen häufig.

Diese Probleme können unter Verwendung des Verfahrens von akuten intrathekale Injektion durch eine Nadel in der Abwesenheit eines vorimplantiert Katheter, der einen schnellen und anatomisch begrenzte Anwendung von Medikamenten und Reagenzien zu dem Rückenmark von Mäusen können umgangen werden. Dieses Verfahren die Vorteile der intrathekale Abgabe über andere systemische Lieferwege (z. B. oral, intravenös, intraperitoneal, etc.), wie Spezifität Rücken Modulation, die Dosierungen verringert und Grenze Nebenwirkungen erlaubt, sowie die Fähigkeit zu liefern Stoffe nicht vollständig beibehält normalerweise nicht die Blut-Hirn-Schranke zu überwinden, da während intrathekale Injektion wird die Nadel zwischen der Dura und dem Rückenmark eingesetzt. Wichtig ist jedoch im Vergleich zu anderen Methoden der intrathekalen Lieferung, ist die intrathekale Nadelinjektion die am wenigsten invasive Verfahren, so dass eine Vielzahl von Anwendungen in derelbe Tier, ohne dass eine erhebliche Gewebeschädigung oder Immunreaktion hervorzurufen durch Implantation von Fremdmaterial. Technische Fähigkeiten erfordert jedoch eine sehr genaue Ausrichtung der Nadel, um die Wirksamkeit zu ermöglichen.

Hier haben wir visuell demonstrieren das Verfahren zum Erreichen einer optimalen Erfolgsquote für die speziell auf die Lendenrückenmark. Die Injektionsstelle, die in diesem Experiment gewählt wird, ist die Nut zwischen L5 und L6 wirbel Spalte, in der Nähe, wo das Rückenmark endet, um die Möglichkeit der Beschädigung der Wirbelsäule zu minimieren. Darüber hinaus zeigen wir die Verwendung dieser Technik, um Gene im Rückenmark mit siRNAs niederschlagen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle Tiernutzung Verfahren waren nach ethischen Leitlinien, die von der lokalen Verwaltungskörper (Regierungspräsidium Karlsruhe, Karlsruhe, Deutschland) festgelegt.

1. Herstellung von siRNA / PEI-Komplex


Die siRNA / PEI-Komplex-Lösung wird mit Herstellers wie folgt hergestellt:

  1. Lösung A: Man verdünnt die gewünschte Menge der siRNA mit sterilem Wasser (falls erforderlich) bis zu einem Viertel des Endvolumens und verdünnte diese mit weiteren 10% igen Glucoselösung bis zur Hälfte des Endvolumens. Vortex sanft oder mischen durch Pipettieren von oben und unten. Die optimale Menge an siRNA muss empirisch ermittelt werden, aber 1 pg siRNA in 10 ul-Komplex-Lösung pro Tier ist ein guter Ausgangspunkt für die Optimierung.
  2. Lösung B: Man verdünnt das benötigte Volumen an Reagens PEI mit sterilem Wasser bis zu einem Viertel des Endvolumens und verdünnte diese mit weiteren 10% igen Glucoselösung bis zur Hälfte des Endvolumens. Vortex gently oder mischen durch Pipettieren von oben und unten.
    Anmerkung: Die Menge an PEI-Reagenz bestimmt den ionischen Gleichgewicht des Komplexes, der die Effizienz der Transfektion beeinflusst. Ebenso kann die optimale Menge an PEI-Lösung muss empirisch ermittelt werden. In unseren Händen ist die optimale Menge 0,12 ul der PEI-Lösung pro 1 ug siRNA.
  3. Mischen Sie die Lösung A mit Lösung B auf einmal, Wirbel sanft.
  4. Inkubieren der gemischten Lösung für 15 min bei RT vor der Verwendung. Dieser Komplex ist stabil für 2 h bei RT und 24 h bei 4 ° C.

2. Intrathekale Injektion

  1. Anesthetize die Maus mit 3% Isofluran, bis es zeigt keine Anzeichen des Stellreflexes. Überprüfen Sie außerdem, für Schwanz und / oder Pfote Prise Reflex, den Zustand der Anästhesie weiter zu gewährleisten.
  2. Rasur etwa 2 cm 2 Pelz am hinteren Ende des Tieres in der Nähe der Basis des Schwanzes, um eine bessere Visualisierung während Nadeleinführung zu erleichtern.
  3. Zeigen Maus inein Nasenkonus für eine weiterhin Isofluran Verwaltung während des Verfahrens, reduzieren Sie die Isofluran auf 1,5%, und decken die Augen der Maus mit Augen Gleitmittel.
  4. Bereiten Sie die bereit sind, siRNA Mischlösung verwenden mit einem 25 ul Hamilton Spritze zu einer 30 G in 0,5 Nadel.
  5. Suchen Sie den Dornfortsatz des L6, die das prominenteste und fixieren die Wirbel Spalte in dieser Gegend durch leichten Druck sollte.
  6. Die Nadel zwischen der Nut der L5 und L6 Wirbel vorsichtig und beachten Sie für einen Tail-flick, wie dieses Zeichen weist auf eine erfolgreiche Eintritt der Nadel in der Intraduralraum.
    Tipp: Mit dem Fingernagel, sollte man in der Lage, die Nut als auch lokalisieren.
  7. Sobald Tail-flick beobachtet wird, sofort, aber vorsichtig, sichern Sie die Nadelposition mit einer Hand und injizieren das gewünschte Volumen der Substanz mit der anderen Hand langsam.
    Tipp: ein Volumen zwischen 5-10 ul optimal als Volumen weniger als 5 &# 181; l ist unzuverlässig und ein Volumen größer als 10 ul führt zu viel Druck.
  8. Nach Injektion durchgeführt wird, bewegen Sie die Maus zurück in den Käfig, um aus der Narkose zu erholen.
  9. Wiederholen Sie diese Injektion mindestens 2 mal je 24 h zur optimalen Herunterregulation des Zielgens zu erreichen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Um eine erfolgreiche Injektion zu veranschaulichen, diese Technik durchgeführt, die wir mit Fast Green FCF Farbstoff in der Erwachsenen C57Bl6 Mäuse (8-10 Wochen alt). Das Tier wurde für ein paar Minuten nach der Injektion zu erholen, um genügend Zeit für den Farbstoff verteilt und dann mit einer Überdosis von CO 2 getötet werden. Anschließend wurde das Wirbeltier Spalte seziert und das Rückenmark wurde freigelegt. Die blaue puncta entsprechend der Farbstoff diffundiert, markiert die Injektionsstelle. Keine Verletzungen des Rückenmarks zu sehen war, bestätigt die minimal invasive Natur dieser Technik (Fig. 1A). Die injizierte Farbstoff aus der Injektionsstelle rostral diffundiert, die bis zu der Brustregion des Rückenmarks, nur wenige Minuten nach der Injektion (Fig. 1B). Darüber hinaus ist die erfolgreiche Infusion des Farbstoffs in den Epiduralraum könnte durch die verschmutzte Oberfläche des Rückenmarks nachgewiesen werden, aber nicht das Innere (Fig. 1C).

in vivo Transfektion in das Rückenmark. SiRNA nach intrathekaler Lieferung (3x, einmal alle 24 Stunden) wird die Expression des Zielproteins (hier WAVE1) auf Lysaten von dorsal L3-L5 Rückengewebe gewonnen wurde, um etwa 70% in der Proteinebene reduziert (2A, n = 20) sowie in der mRNA-Ebene (Fig. 2B, n = 6). Außerdem wird ein Herunterregulieren der gleichen Größenordnung könnte auch in dem Lysat des ventralen Abschnitt ersichtlich (2C, n = 4). Interessanterweise ist eine noch etwas stärker Herunterregulierung, wurde auch in Lysaten zervikalen Wirbelsäule gesehen (Fig. 2D, n = 4). Aber trotz der Tatsache, dass ein ähnliches Verfahren wurde verwendet, um Gen in Geweben außerhalb des Rückenmarks 10 herunterregulieren, in unseren Händen diese Herunterregulierung nicht im Lysat des Gehirns beobachtet (2E, n = 4) noch die DRGs (2F, n = 4).

Figur 1
Fig. 1 ist. Rückenmark unter dem Mikroskop folgenden, nicht-invasive, akute intrathekale Injektion mit Fast Green-Farbstoff präpariert. A kann keine sichtbaren Anzeichen von Gewebeverletzung an der Injektionsstelle zu sehen ist, durch den Farbstoff puncta markiert. B Abgeschnittene Rückenmark wenigen Minuten nach der Injektion, das die allmähliche Diffusion des Farbstoffs in rostrale Richtung. White-Box markiert den Lendenbereich, und der Stern markiert die Einstichstelle. C, spezifische Markierung auf der Oberfläche des Rückenmark (Segment L3-L5), aber nicht das Innere des Rückenmarks. r = rostral, c = Schwanz, cc = zentralen Kanal. Klicken Sie hierfür eine größere Ansicht.

Figur 2
2. . Danach der dorsalen und ventralen; erfolgreichen Herunterregulation des Zielproteins (hier WAVE1) im Rückenmark nach intrathekaler siRNA Mäuse wurden intrathekal entweder mit Kontroll-siRNA oder siRNA gegen WAVE1 gezielt mit PEI-Reagenz für 3 aufeinanderfolgende Male jede 24 Stunden gemischt spritzt Abschnitt der lumbalen Rückenmark (Segment 3-5) wurden zervikalen Rückenmark, Gehirn und DRGs ausgeschnitten, lysiert und einer Western-Blot-und qRT-PCR. AB, Western Blot unterzogen (n = 20) und qRT-PCR (n = 6) Quantifizierung von Lysat von dorsalen Abschnitt der lumbalen Rückenmark, CF Western Blot Quantifizierung aus dem Lysat der ventralen L3-L5 Rückenmark, Halsmark, Gehirn und DRG respectively (n = 4). Analyse waren von ungepaarten Student-t-Test (* p ≤ 0,05, ** p ≤ 0,005). Klicken Sie hier für eine größere Ansicht .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Somit ist die oben beschriebene Technik der Nadel intrathekale Injektionen wirksam, schnell, spezifisch lokalisiert und zerstörungsfrei. Technisch gesehen ist der wichtigste Aspekt des Verfahrens der Punkt der Nadeleinführung in die Nut. Es ist entscheidend, dass dieses Verfahren mit einer sehr ruhigen Hand und Geduld getan. Wie viele chirurgische Verfahren, Schulung verbessert die Rate der erfolgreichen Injektion. Dies ist auch deshalb wichtig, weil bei einem tatsächlichen Experiment erfordert diese Technik keine offensichtliche Anzeige direkt bestätigen, ob eine Injektion erfolgreich ist oder nicht. Der einzige sichtbare Indikator für die richtige Nadeleinführung ist der Tail-flick, die als Reflex zu beobachten ist.

Dieses Verfahren vollständig behält die Vorteile der intrathekale Abgabe über andere systemische Lieferwege (z. B. oral, intravenös, intraperitoneal, etc.), wie die Spezifität der Rücken Modulation, die reduzierten Dosierungen und Nebenwirkungen Grenzen erlaubt; Pelzhinaus, intrathekale Injektionen zu ermöglichen Abgabe von Substanzen, die normalerweise nicht grenzBlutHirnSchranke, da während intrathekale Injektion wird die Nadel zwischen der Dura und dem Rückenmark eingesetzt. Wichtiger ist jedoch, im Vergleich zu anderen Methoden der intrathekalen Lieferung, der intrathekalen Nadel-Injektionsverfahren die am wenigsten invasive, so dass eine Vielzahl von Anwendungen in dem gleichen Tier, ohne eine beträchtliche Gewebeschädigungen hervorzurufen oder Immunreaktion durch Implantation von Fremdmaterial.

Insgesamt in diesem Bericht, haben wir nicht nur die Grund Schritt-für-Schritt-Anleitung, um akute intrathekale Nadelinjektion gezeigt, aber auch berichten, ein Beispiel für Improvisation dieser Technik, wo in einem in vivo siRNA-Transfektion und spezifische Gen-Knockdown im Rücken Kabel erreicht werden. Neben der Lieferung pharmakologische Reagenzien und PEI-siRNA erleichtert, kann die intrathekale Nadelinjektionsverfahren verwendet werden, um zu ermöglichen otihre Arten von Gentransfer, wie viral vermittelten Genübertragung 11. Sobald genügend Erfahrung gesammelt wurde, kann dieses Verfahren auch ohne Narkose in wach, nonanesthetized 4,12 Mäusen durchgeführt werden. Dies ermöglicht es, beispielsweise akute Wirkungen von pharmakologischen Mitteln in Verhaltensexperimenten bereitgestellt Mäuse preacclimatized übermäßige Belastung verhindern studieren.

So akuten intrathekale Injektionen stellen einen sehr nützliches Werkzeug für Studien über die Rückenhinterhorn und die Vielseitigkeit der Technik ermöglicht Experimentatoren anpassen und improvisieren, um ihre Ziele zu entsprechen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, keine finanziellen Interessen konkurrieren.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats