In Vivo transfection de siRNA et Gene Knockdown dans la moelle épinière via rapide non invasive lombaire intrathécale injections chez des souris

1Institute for Pharmacology, University of Heidelberg
Published 3/22/2014
0 Comments
  CITE THIS  SHARE 
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Ce rapport décrit une technique simple et rapide de intrathécale ponction à l'aiguille pour une transfection de siRNA localisée dans la moelle épinière lombaire chez la souris sous anesthésie de courte durée de lumière durable.

Cite this Article

Copy Citation

Njoo, C., Heinl, C., Kuner, R. In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice. J. Vis. Exp. (85), e51229, doi:10.3791/51229 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ce rapport décrit un guide étape par étape pour la technique des injections de seringues intrathécales aigus de manière non invasive, c'est à dire indépendant du cathéter implantation. La limitation de cette technique réside dans la technique chirurgicale de la finesse des aiguilles. L'injection est rapide, en particulier pour un expérimentateur formé, et étant donné que la perturbation de tissu avec cette technique est minime, des injections répétées sont possibles; réaction en outre à l'abri des outils étrangers (. Par exemple de cathéter) ne se produit pas, ce qui donne une meilleure et plus précise read out de modulation de la moelle épinière. Etant donné que l'application de la substance est largement limitée à la région cible de la moelle épinière, les médicaments n'ont pas besoin d'être appliqué à des doses importantes, et des effets plus important non désirés sur d'autres tissus, comme observé avec une administration systémique, peuvent être contournées 1, 2. Par ailleurs, on combine cette technique avec la transfection in vivo d'acides nucléiques à l'aide d'polyethylenimine (PEI) réactif 3, qui fournit grande polyvalence pour l'étude des fonctions de la colonne vertébrale par l'intermédiaire de l'administration d'agents pharmacologiques, ainsi que le gène, l'ARN, et des modulateurs de protéine.

Introduction

La moelle épinière est un centre très important dans une variété de processus biologiques clés et les fonctions physiologiques, y compris le traitement et la transmission des entrées douloureuses (nociceptives) 4-7. Diverses techniques expérimentales ont été développées pour faciliter la modulation pharmacologique de la moelle épinière, par exemple une implantation chronique de cathéter intrathécal 8, la moelle épinière de la micro-injection et l'injection intrathécale de l'aiguille 9. Chaque technique a ses avantages et ses inconvénients, et selon le paradigme d'une expérience technique pourrait être plus appropriés que les autres. Considérant que l'implantation chronique de cathéter intrathécal est facilement réalisable chez le rat, ce procédé est très difficile dans la souris, étant donné les restrictions de taille. Le taux de réussite est très faible et des déficits moteurs se produit souvent en raison de la présence encombrante d'un cathéter dans l'espace sous-dural sévèrement limitée dans la souris. Par ailleurs, la livraison à long terme de médicaments est rendu en raison de la coagulation fréquentesdes cathéters implantés de façon chronique. Enfin, les réactions immunitaires sont fréquentes.

Ces problèmes peuvent être contournés en utilisant le procédé de l'injection intrathécale aiguë par une aiguille en l'absence d'un cathéter preimplanted, ce qui permet une application rapide et anatomiquement limité de médicaments et de réactifs de la moelle épinière chez les souris. Cette méthode conserve tous les avantages de intrathécale sur d'autres voies d'administration systémiques (par exemple, orale, intraveineuse, intrapéritonéale, etc), tels que la spécificité de la modulation de la moelle, ce qui permet des doses réduites et les effets secondaires de fin de course, ainsi que la capacité à délivrer des substances ne normalement ne pas traverser la barrière hémato-encéphalique depuis lors de l'injection intrathécale, l'aiguille est insérée entre la dure-mère et la moelle épinière. Fait important, toutefois, par rapport à d'autres méthodes d'administration intrathécale, le procédé d'injection de l'aiguille par voie intrathécale est la moins invasive, ce qui permet de nombreuses applications dans l'même animal sans causer de dommages aux tissus considérable ou évoquant la réaction immunitaire en raison de l'implantation de matériel étranger. Cependant, il nécessite des compétences techniques pour un ciblage très précis de l'aiguille pour permettre l'efficacité.

Ici, nous démontrons visuellement la méthode pour atteindre un taux optimal de réussite pour cibler spécifiquement la moelle épinière lombaire. Le site d'injection qui est choisie dans cette expérience est de la rainure entre L5 et L6 colonne vertébré, à proximité de l'endroit où se termine la moelle épinière, de réduire au minimum le risque d'endommager la colonne vertébrale. En outre, nous démontrons l'utilisation de cette technique pour abattre des gènes dans la moelle épinière en utilisant des siRNA

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les procédures d'utilisation des animaux soient conformes aux lignes directrices éthiques fixées par l'organe local (Regierungspräsidium de Karlsruhe, Karlsruhe, Allemagne).

Une. Préparation de siRNA / PEI complexe


La solution complexe siRNA / PEI est préparé en utilisant les instructions du fabricant comme suit:

  1. Solution A: Diluer la quantité souhaitée de siRNA avec de l'eau stérile (si nécessaire) jusqu'à un quart du volume final et on dilue davantage avec une solution de glucose à 10% jusqu'à la moitié du volume final. Vortex doucement ou mélanger par pipetage de haut en bas. La quantité optimale de siRNA doit être déterminée de manière empirique mais 1 pg siRNA dans 10 ul solution complexe par animal est un bon point de départ pour l'optimisation.
  2. Solution B: On dilue le volume nécessaire de PEI réactif avec de l'eau stérile jusqu'à un quart du volume final et on dilue davantage avec une solution de glucose à 10% jusqu'à la moitié du volume final. Vortex gently ou mélanger par pipetage de haut en bas.
    Note: la quantité de réactif PEI détermine l'équilibre ionique dans le complexe qui influence l'efficacité de la transfection. De même, la quantité optimale de solution de PEI doit être déterminée de façon empirique. Dans nos mains, la quantité optimale est de 0,12 pi de solution de PEI pour 1 ug siRNA.
  3. Mélanger la solution A avec la solution B à la fois, vortex doucement.
  4. Incuber la solution mélangée pendant 15 minutes à température ambiante avant utilisation. Ce complexe est stable pendant 2 heures à température ambiante et pendant 24 heures à 4 ° C.

2. Injection intrathécale

  1. Anesthésier la souris avec 3% d'isoflurane, jusqu'à ce qu'il ne montre aucun signe de réflexe de redressement. En outre, vérifiez la queue et / ou patte pincée réflexe pour assurer en outre l'état de l'anesthésie.
  2. Raser environ 2 cm 2 de fourrure à l'extrémité postérieure de l'animal près de la base de la queue afin de faciliter une meilleure visualisation lors de l'insertion de l'aiguille.
  3. Placez la souris dansun cône de nez pour une administration de l'isoflurane poursuivie au cours de la procédure, de réduire le isoflurane à 1,5%, et couvre les yeux de la souris avec lubrifiant oculaire.
  4. Préparer le prêt à utiliser siRNA solution mixte en utilisant une seringue Hamilton de 25 ul attaché à un 30 G 0,5 à aiguille.
  5. Localiser l'apophyse épineuse de la L6, qui devrait être le plus important un le et fixer la colonne de vertébré autour de cette zone en appuyant doucement.
  6. Insérez délicatement l'aiguille entre la gorge de L5 et L6 vertèbres et observer une queue film que ce signe indique une entrée réussie de l'aiguille dans l'espace intradural.
    Astuce: Utilisation de l'ongle, on devrait être en mesure de localiser la gorge ainsi.
  7. Une fois la queue film est observé, immédiatement, mais attention, fixer la position de l'aiguille d'une main et injecter le volume souhaité de la substance avec l'autre main lentement.
    Astuce: un volume compris entre 5-10 est ul optimale en volume inférieur à 5 et# 181; l est peu fiable et un volume plus grand que 10 pi conduit à trop de pression.
  8. Une fois l'injection est effectuée, déplacez la souris vers la cage pour remettre de l'anesthésie.
  9. Répéter cette injection au moins deux fois plus toutes les 24 h pour obtenir la sous-régulation optimale du gène ciblé.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Afin d'illustrer une injection réussie, nous avons réalisé cette technique en utilisant rapide colorant vert FCF chez les souris C57BL6 adultes (8-10 semaines d'âge). L'animal a été autorisée à récupérer pendant quelques minutes après l'injection de fournir assez de temps pour le colorant de se propager et ensuite tué par une overdose de CO 2. Par la suite, la colonne de vertébré a été disséqué et la moelle épinière a été exposée. Le puncta bleu correspondant au colorant diffuse, a marqué le point d'injection. Aucun signe de lésion de la moelle épinière peut être vu, ce qui confirme le caractère peu invasif de cette technique (figure 1A). Le colorant injecté diffusée à partir du site d'injection rostrale, atteignant jusqu'à la région thoracique de la moelle épinière, seulement quelques minutes après l'injection (figure 1B). De plus, le succès de la perfusion du colorant dans l'espace épidural peut être prouvée par la surface tachée de la moelle épinière, mais pas à l'intérieur (figure 1C).

efficace pour la transfection in vivo dans la moelle épinière. Après siRNA intrathécale (3x, une fois toutes les 24 h), l'expression de la protéine ciblée (ici WAVE1) sur des lysats dérivés de dorsale L3-L5 tissu spinal a été réduite à environ 70% du niveau de la protéine (Figure 2A, n = 20) ainsi que dans le niveau de l'ARNm (figure 2B, n = 6). En outre, une régulation à la baisse d'une ampleur similaire pourrait également être considérée dans le lysat de la section ventrale (figure 2C, n = 4). Fait intéressant, une régulation à la baisse encore un peu plus forte, a également été observé dans le lysat de la moelle épinière cervicale (figure 2D, n = 4). Mais, en dépit du fait qu'un procédé similaire a été utilisé pour réguler à la baisse le gène dans les tissus en dehors de la moelle épinière 10, en nos mains cette régulation à la baisse n'a pas été observée dans le lysat de cerveau (Figure 2E, n = 4), ni le DRGs (figure 2F, n = 4).

Figure 1
Figure 1. La moelle épinière disséqué sous le microscope suivante invasive, injection intrathécale aiguë non avec un colorant vert rapide. A, aucun signe visible de la lésion tissulaire peut être vu sur le site de l'injection, marquée par les points lacrymaux de colorant. B, excisés de la moelle épinière quelques minutes après l'injection montrant la diffusion progressive du colorant dans la direction rostrale. Boîte blanche marque la région lombaire, et l'étoile marque le site d'injection. C, la coloration spécifique à la surface de la moelle épinière (segment L3-L5), mais pas à l'intérieur de la moelle épinière. r = rostral, c = caudale, cc = canal central. Cliquez icipour agrandir l'image.

Figure 2
Figure 2. . Downregulation succès de la protéine ciblée (ici WAVE1) dans la moelle épinière après la livraison de siRNA intrathécale souris ont été intrathécale injecté soit avec siRNA contrôle ou siRNA ciblés contre WAVE1 mélangé avec le réactif PEI 3 fois de suite toutes les 24 heures, après quoi, la dorsale et ventrale section de la moelle épinière lombaire (segment 3-5), la moelle épinière cervicale, le cerveau et les DRG ont été excisés, lysées et soumises à un transfert de Western et qRT-PCR. AB, Western blot (n = 20) et de qRT-PCR (n = 6) la quantification du lysat de l'article dorsale de la moelle épinière lombaire, Western blot FC quantification du lysat de ventrale L3-L5 moelle épinière, la moelle épinière cervicale, le cerveau et DRG respectively (n = 4). Analyse étaient par le test t de Student non apparié (* P ≤ 0,05, ** p ≤ 0,005). Cliquez ici pour agrandir l'image .

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ainsi, la technique décrite ci-dessus des injections intrathécales de seringues est efficace, rapide, précisément localisée, et non destructif. Techniquement, l'aspect le plus critique de cette procédure est le point d'insertion de l'aiguille dans la gorge. Il est essentiel que cette procédure se fait avec les mains et la patience très calme. Comme de nombreuses procédures chirurgicales, la formation améliore la vitesse d'injection réussie. Cela est également important, car lors d'une expérience réelle, cette technique ne fournit pas une indication évidente pour confirmer si une injection directe est réussie ou non. Le seul indicateur visible de l'insertion correcte de l'aiguille est la queue film qui est observée comme un réflexe.

Cette méthode conserve tous les avantages de intrathécale sur les autres itinéraires systemical de livraison (par exemple orale, intraveineuse, intrapéritonéale, etc), tels que la spécificité de la modulation de la moelle, ce qui permet des doses réduites et les effets des limites latérales; fourrureThermore, intrathécale permettent la livraison de substances qui sont normalement ne traversent la barrière hémato-encéphalique depuis lors de l'injection intrathécale, l'aiguille est insérée entre la dure-mère et la moelle épinière. Il est important, cependant, en comparaison à d'autres méthodes de prestation intrathécale, la méthode de l'aiguille d'injection intrathécale est la moins invasive, permettant une de nombreuses applications dans le même animal sans causer de dommages aux tissus considérable ou évoquant la réaction immunitaire en raison de l'implantation de matériel étranger.

Au total, dans ce rapport, nous avons montré non seulement le guide de base, étape par étape à l'aiguille d'injection intrathécale aiguë, mais aussi signaler un exemple de l'improvisation de cette technique, où dans un in vivo transfection de siRNA et gène spécifique effet de choc dans la moelle cordon peut être réalisé. A côté de livraison de réactifs pharmacologiques et la livraison de siRNA PEI-facilité, la méthode de l'aiguille d'injection intrathécale peut également être utilisé pour faciliter otses types de transfert de gènes, tels que la livraison de gène à médiation virale 11. Une fois l'expertise suffisante aura été acquise, cette procédure peut également être effectuée sans anesthésie dans éveillé, souris anesthésiés 4,12. Cela permet, par exemple, pour étudier les effets aigus des agents pharmacologiques dans les paradigmes de comportement des souris fournis sont preacclimatized pour éviter un stress excessif.

Ainsi, intrathécale aiguës constituent un outil très utile pour les études sur la corne dorsale de la moelle et la polyvalence de la technique permet aux expérimentateurs de personnaliser et d'improviser en fonction de leurs objectifs.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent aucun intérêt financier concurrents.

Materials

Name Company Catalog Number Comments
In Vivo-jetPEI Polyplus 201-10G  
WAVE1 siRNA Santa Cruz sc-36832  
Control siRNA-A Santa Cruz sc-37007  
Anti-ß-Tubulin III antibody Sigma T2200  
Anti-WAVE1 antibody R&D Systems AF5514  
Fast green dye Sigma F-7252  
Isoflurane Baxter  
Isoflurane setup Dräger Lübeck  
Shaver Wella  
Hamilton syringe Gastight 1702 Hamilton  
30 G 1/2 in 13 mm Needle BD Microlance 304000  
Microscope Leica MS5 Leica  
WAVE1 forward primer for qRT-PCR Sigma cacagagcctcaggacagg
WAVE1 reversed primer for qRT-PCR Sigma cttttcaccaacggcatctt
FastStart Essential DNA Green Master Roche 6402712001  

DOWNLOAD MATERIALS LIST

References

  1. Hylden, J. L., Wilcox, G. L. Intrathecal morphine in mice: a new technique. Eur. J. Pharmacol. 67, 313-316 (1980).
  2. Stokes, J. A., Corr, M., Yaksh, T. L. Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling. Neurosci. Lett. 504, 215-218 (2011).
  3. Goula, D., et al. Polyethylenimine-based intravenous delivery of transgenes to mouse lung. Gene Ther. 1291-1295 (1998).
  4. Fairbanks, C. A. Spinal delivery of analgesics in experimental models of pain and analgesia. Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).
  5. Hohmann, A. G., Tsou, K., Walker, J. M. Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2. Neurosci. Lett. 257, 119-122 (1998).
  6. Song, Z. H., Takemori, A. E. Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice. J. Pharmacol. Exp. Ther. 254, 363-368 (1990).
  7. Trang, T., Sutak, M., Jhamandas, K. Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance. Neuroscience. 1275-1288 (2007).
  8. Yaksh, T. L., Rudy, T. A. Chronic catheterization of the spinal subarachnoid space. Physiol. Behav. 17, 1031-1036 (1976).
  9. Tappe, A., et al. Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain. Nat. Med. 677-681 (2006).
  10. Bourinet, E., et al. Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception. EMBO J. 24, 315-324 (2005).
  11. Wang, X., et al. Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves. Mol. Ther. 12, 314-320 (2005).
  12. Wigdor, S., Wilcox, G. L. Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways. J. Pharmacol. Exp. Ther. 242, 90-95 (1987).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats