מתקפל ואפיון של רובוט ביו-תגובה מה- DNA אוריגמי

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nanorobot DNA הוא מכשיר חלול משושה ננומטריים, שנועד לפתוח בתגובה לגירויים ספציפיים ובהווה מטען מוחרם בפנים. ניתן להתאים גירויים ומטען שני בהתאם לצרכים ספציפיים. כאן אנו מתארים את פרוטוקול ייצור nanorobot DNA, עם השימוש בטכניקת אוריגמי DNA. ההליך יוזם על ידי ערבוב סיכות DNA חד-גדיל קצרים לתערובת מניות אשר לאחר מכן הוסיפה לפיגום ארוך, עגול, אחד גדיל DNA בנוכחותו של חיץ מתקפל. Cycler תרמו סטנדרטי מתוכנת להוריד את טמפרטורת תגובת ערבוב בהדרגה כדי להקל על חישול סיכות ל- פיגום, שהוא הכוח המנחה מאחורי הקיפול של nanorobot. ברגע שהתגובה מתקפל 60 שעות שלמה, סיכות עודפות מבוטלים באמצעות מסנן צנטריפוגלי, ואחריו להדמיה באמצעות אלקטרופורזה agarose-ג'ל (גיל). לבסוף, ייצור מוצלח של nanorobot מאומת על ידי מיקרוסקופי אלקטרונים הילוכים (TEM),עם השימוש בuranyl-formate ככתם שלילי.

Introduction

השימושים לננוטכנולוגיה חומצות גרעין הם מדהימים. נְהִילוּת של זיווג הבסיס ווטסון-קריק, כמו גם את הקלות והבעלות נמוכה היחסית של סינתזה בקנה מידה גדולה של oligos מחוייט 2 ניב פרץ של יישומים 3 ומחקר בתחום הננו-טכנולוגיה ה- DNA. המבנית DNA ננוטכנולוגיה, המבוססת על 4,5 צומת Seeman הנייחת כאבן בניין בסיסית עושה שימוש בדנ"א כיחידה יסודי הרכבה עצמית לבניית צורות שרירותיות 6-8.

הפיתוח האחרון של טכניקת אוריגמי 9 DNA הפיגומים מאפשר לבניית ננו-ארכיטקטורות 2D / 3D המורכבות 10-12 עם דיוק תת-ננומטר והוא מסלול יעיל לבניית אובייקטים פונקציונליים חדשים עם מורכבות גוברים וגיוון מדהים. תהליך הבנייה מבוסס על ה- DNA חד גדילי פיגום ארוך, בדרך כלל נגזר מgenom נגיפידואר, אשר יכול להיות מקופל באמצעות ההכלאה של מאות oligos DNA הגדיל הבודד הקצר כינה סיכות. הרזולוציה הגבוהה המבנית מתקבלת על ידי טכניקה זו היא התוצאה הישירה של הממדים הטבעיים של סליל הדנ"א הכפול, תוך שחזור של ייצור הוא התוצאה של התאמת רצפי מצרך יחיד גדיל הקצר כדי להקל על השלמת מימן מליטה המרבית השגה. עם השימוש של חישול בטמפרטורה איטי רמפה הנמוכה ביותר באנרגיה המיועדת, thermodynamically ננו-המבנה העדיף הוא הגיע בתשואות ונאמנות גבוהות. היישום קל של כללי עיצוב צומת בקוד מחשב אפשר הפיתוח של כלים CAD, כגון 13 caDNAno, שמאוד לפשט את המשימה של תכנון מבנים גדולים, מורכבים המכילים מאות צמתים מחוברות.

בעבר תאר את העיצוב של nanorobot DNA בעזרת כלי 14,15 caDNAno. כאן אנו מציגים את הייצור והדמיה, באמצעות מיקרוסקופ אלקטרונים הילוכים (TEM), של nanorobot, nanodevice משושה החלול 3D, עם ממדים של 35 x 35 x 50 3 ננומטר, שנועדו לעבור שינוי קונפורמציה גדול בתגובה לגירויים שנקבעו מראש ומטען ספציפי נוכחי, כגון חלבונים או oligos חומצות גרעין, מוחרם בפנים. בעוד 12 תחנות טעינה זמינות בתוך המארז החלול, המספר האמיתי של מטען קשור שונה עם גודל מטען. מולקולות מטען נעות בין מולקולות DNA קטנות לאנזימים, נוגדנים ו5-10 חלקיקי זהב ננומטר. Cargocan או להיות אחיד או הטרוגנית, כך שכל nanorobot מכיל תערובת של מולקולות שונות. חישה מושגת באמצעות שני עיצוב שערי נעילת סליל כפול לחוש חלבונים, חומצות גרעין או כימיקלים אחרים, המבוססת גם על aptasensor עקירת 16,17 או גדיל DNA 18 טכנולוגיות. ההתפתחויות אחרונות בפרוטוקולי בחירת aptamer 19-21 לאפשר העיצוב של nanorobots להגיבלמגוון הולך וגדל של מולקולות ותאים מסוגים.

העבודה קודמת הראתה nanorobot נושא נוגדנים ספציפיים, אשר על הכריכה לאנטיגן שלה יכולה להעביר גם אות פורה לחלק הפנימי של סוגי תאים מסוימים באוכלוסיית תאים מעורבת 15 מעכבת או. תכונה מרגשת של ננו-התקנים אלה היא היכולת שלהם לבצע אפילו יותר משימות מורכבות ושליטה היגיון עם ההקדמה של תת nanorobot שונה באוכלוסייה אחת. לאחרונה הפגינו תת-סוגים ספציפיים של nanorobots ביצוע כמו גם רגולטורים חיוביים או שליליים, השליטה אוכלוסיית מפעיל המכילה מולקולת מטען פעילה 22.

הפרוטוקול המובא כאן מתאר את הייצור, טיהור והדמיה של nanorobot מגודר עם רצפי חיישן aptamer המחייבים באופן סלקטיבי לPDGF כדי להקל על פתיחת nanorobot 15,22. תהליך הייצור המתואר דומה לnתהליך ייצור anorobot תחילה מתואר על ידי דאגלס et al. 15 עם שינויים שמטרתה צמצום משך תהליך כולל, תוך הגדלת שיעורי התשואה וטיהור.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. הכנת תערובת סטייפלס בריכה

  1. סיכות להזמין lyophilized DNA nanorobot על 96-גם צלחות כמפורט בטבלה 1 (ראה חומרים) ולנרמל עד 10 ננומול. לתיאור מפורט של העיצוב והאדריכלות של nanorobot DNA לראות אל בן-ישי ואח '. 14 ודאגלס et. 15).
  2. מחדש כל מצרך היטב עם DNase / ultrapure RNase ללא בריכוז של 100 מיקרומטר. לסיכות מנורמלות 10 ננומול, מחדש עם המים ultrapure 100 μl.
  3. בריכה יחד 20 μl של כל מצרך באמצעות pipettor רב ערוצי ואגן פתרון סטרילי 55 מיליליטר.
    הערה: מאחר שצורת nanorobot מורכבת של 254 גדילי מצרך (כולל Core, קצוות, ידיות ורצפי מדריכים, טבלת 1), הריכוז של כל אחד מהסיכות בבריכת הסיכות הוא 394 ננומטר. הסרת סיכות מבריכת מצרך, או להוסיף כמה בכרך שונהumes, עשויים להפחית את התשואה משמעותית, או בדרך אחרת לגרום לאגרגטים פרש.

2. הכנת תערובת תגובת ייצור

  1. לתערובת תגובה סטנדרטית להשתמש 40 μl של ה- DNA הנגיפי M13mp18 הגנום מעגלי אחת גדיל, מתאים ל4 pmol של DNA פיגום (פתרון 100 מניות ננומטר, ראה חומרים). ריכוז סופי של פיגום בתערובת הייצור הוא 20 ננומטר, נפח סופי 200 μl.
    1. התאם את כמות ה- DNA פיגום בהתאם לצרכים ספציפיים; עם זאת, לשמור על הריכוז הסופי של ה- DNA פיגום בתערובת התגובה ב20 ננומטר קבועים.
  2. להוסיף סיכות להגיע פיגום ליחס סיכות של 1 עד 10, בהתאמה. לריכוז ה- DNA 20 הפיגום ננומטר, כל אחד מהריכוז הסופי של הסיכות 254 הוא 200 ננומטר. לμl 200 סופי נפח תגובה להוסיף 102 μl של תערובת בריכת סיכות (סעיף 1.2).
    1. להוסיף רצפי שער ספציפיים בנפרד התערובת תגובה מתקפלת דואר בשלב זה. oligos אלה הורה בנפרד ודורשת טיהור HPLC. ודא שoligos השער נמצא ב01:10 פיגום לשער יחס רצף, כלומר 200 ננומטר של כל אוליגו לריכוז של 20 ננומטר פיגום. לμl 200 מתקפל נפח תגובה, להוסיף 0.4 μl לכל אחת מהארבעה אוליגו השער בריכוז מניית 100 מיקרומטר.
  3. להוסיף 10x חיץ מניית טה להגיע לריכוז סופי של 1X טה (40 מ"מ טריס-אצטט, 1 mM EDTA). לμl 200 מתקפל נפח תגובה, להוסיף 20 μl של 10x טה.
  4. הוסף 1 M MgCl 2 לריכוז סופי של 10 מ"מ. לμl 200 מתקפל נפח תגובה, להוסיף 2 μl של 1 M MgCl 2.
  5. להוסיף 36 μl מים ultrapure החופשי DNase / RNase ליגיע נפח סופי של 200 μl.
  6. וורטקס וaliquot 100 μl דגימות לתוך צלוחיות PCR.
    הערה: התייעץ עם מפרט Cycler תרמית לגבי כמויות תגובה המרביות לשימוש.הקטנת הנפח לעמוד במגבלות אלה לא תפחית את התשואות שהשיגו. כרכי תגובה מעל המרבי שצוינו יסכן את התשואות.

רמפה חישול 3. טמפרטורה של תגובת ייצור

  1. Cycler תרמית תכנית אחריו כמו:
    1. רמפה 85 מעלות צלזיוס עד 60 מעלות צלזיוס בשיעור של 5 דקות / מעלות צלזיוס.
    2. רמפה 60 ° C ל- C ° 4 בשיעור של 75 דק '/ מעלות צלזיוס.
    3. להחזיק ב 4 ° C ללא הגבלת זמן.
  2. לאחר הייצור הסתיים דגימות חנות ב -20 ° C.

4. ההסרה של סטייפלס העודף

  1. להוסיף לתערובת תגובה מתקפלת 100 μl למסנן צנטריפוגלי 0.5 מיליליטר עם MWCO של 100 kDa. להציל את מדגם 10 μl של nanorobots מראש טיהור לניתוח מאוחר יותר.
  2. צנטריפוגה למשך 10 דקות ב 9,600 x גרם.
  3. להוסיף 400 μl של חיץ מתקפל (1x טה, 10 מ"מ MgCl 2).
  4. חזור על שלבים 4.2 ו -4.3 פעמיים יותר.
  5. צנטריפוגה במשך 5 דקות ב9,600 x גרם.
  6. לשחזר את התרכיז על ידי הצבת המסנן הפוכה בצינור microcentrifuge נקי וספין 1 דקות ב9,600 x גרם. כרכים סופיים עשויים להשתנות בהתאם לכמות הראשונית של תערובת תגובת ייצור שהוכנסה למסנן. בדרך כלל נפח סופי 25-60 μl של מדגם nanorobot המרוכז מתקבל.
  7. למדוד ריכוז של ה- DNA בדגימות באמצעות ספקטרופוטומטר ב 260 ננומטר. השתמש במשקל מולקולרי של 5.3 מיקרוגרם / pmol בעת חישוב ריכוזים טוחנות של דגימות nanorobot.
    הערה: מקדם טוחנת ההכחדה לdsDNA, 50 מיקרוגרם / OD 260, מספיק עבור רוב היישומים. 48 מיקרוגרם / OD 260 לוקח בחשבון את תימין פולי ssDNA משתרע בסיכות קצוות.

5. Agarose ג'ל אלקטרופורזה ניתוח של nanorobots המקופל

  1. הכנת TBE 0.5x (45 מ"מ טריס-Borate, 1 mM EDTA), 2% agarose ג'ל בתוספת 10 מ"מ MgCl 2 מאל ארנסטו קסטרו et 21.):
    1. הכן מאגר TBE 0.5x על ידי דילול 6.25 מיליליטר של חיץ מניות 10x TBE ב118.75 מיליליטר של DDH 2 O.
    2. ממיסים 2.5 גרם של agarose ב125 מיליליטר של חיץ TBE 0.5x.
    3. מרתיחים במיקרוגל עד agarose הוא נמס לגמרי.
    4. להוסיף 1.25 מיליליטר של 1 M MgCl 2 לריכוז סופי של 10 מ"מ.
    5. להוסיף 7 μl של 10 מ"ג / מיליליטר ethidium ברומיד.
    6. חכה לפתרון למעט קריר ולמלא את מגש ג'ל לפני מתמצק agarose ג'ל. התקן מסרק הרצוי באופן מיידי.
    7. הכן L 1 TBE 0.5x הפעלת מאגר על ידי הוספת 50 מיליליטר של חיץ מניות 10x TBE ו -10 מיליליטר של 1 M MgCl 2-940 מיליליטר של DDH 2 O.
    8. ברגע ג'ל הוא תוספת מוצקה הפעלת מאגר למכשיר אלקטרופורזה ומכשיר לשים באמבט קרח.
  2. ה- DNA 1 מיקרוגרם העומס הכולל של טרום טיהור nanorobots (שלב 3.2), ולאחר טיהור (שלב 4.7), לצד פיגוםדגימת DNA וסמן ה- DNA 1 KB, על ג'ל. דוגמא ניתנת באיור 2. כרכים בפועל של דגימות תלויות בריכוזים המתקבלים לאחר טיהור. כל דגימות טעונה עם חיץ טעינה של 1: יחס נפח סופי 6.
  3. הגדר מקור כוח 80 V ולהפעיל ג'ל למשך 3 שעות. הפעל את הג'ל באמבט מלא בקרח ומים. Nanorobots יתפתח ויופיע ככתם אם agarose ג'ל מתחמם במהלך אלקטרופורזה. במהלך אלקטרופורזה להוסיף קרח נוסף כדי לשמור על מכשיר מהחימום.
  4. צפה בג'ל על שולחן UV (איור 2).

6. כתמים שליליים של Nanorobot עם Uranyl-formate

  1. הכנה של 2% מניות פתרון uranyl-formate (מותאמת מאל קסטרו et 23.):
    1. שוקל של אבקת uranyl-formate 100 מ"ג לתוך צינור 15 מיליליטר.
    2. המים ultrapure החופשי הרתיחה DNase / RNase 3 דקות לדה-חמצן.
    3. הוסף 5 מיליליטר של מים חמים deoxygenated (~ 60 מעלות צלזיוס)לתוך הצינור המכיל 15 מיליליטר אבקת uranyl-formate (מהשלב קודם). מהדקת את המכסה, לעטוף בנייר אלומיניום ומערבולת בקפדנות במשך 10 דקות (צינור להדק מערבולת). פתרון צריך להופיע עכור עם צבע צהוב.
    4. פתרון סינון באמצעות ניטור ארוך טווח אלחוטי מזרק 0.2 מיקרומטר. פתרון צריך להיות ברור.
    5. Aliquot 200 μl של הפתרון לתוך צינורות microcentrifuge.
    6. צנטריפוגה במהירות מקסימלית של 5 דקות בצנטריפוגה בראש הטבלה לדגימות בריכה בחלק התחתון של הצינור.
  2. טעינה של מדגם לרשת ומכתים שלילי:
    1. להפשיר aliquot 200 μl של 2% פתרון uranyl-formate (מוכן בסעיף 6.1). הוסף 10 μl של 0.5 פתרון M NaOH ומערבולת בקפדנות במשך 3 דקות. צנטריפוגה במהירות מקסימלית במשך 5 דקות באמצעות צנטריפוגות בראש הטבלה.
    2. בינתיים, רשת זוהר פריקה באמצעות אוויר חדר בmbar 0.2 ו -25 mA למשך 30 שניות.
    3. הוסף 15 μl של 2 מדגם nanorobot ננומטר לאחר טיהור (sectiעל 4.7) על גבי רשת של למעלה (שנערך עם מלקחיים) ולתת לספוג דקות 1. השתמש בנייר אקולוגי ארוך טווח אלחוטי לניקוז הנוזל העודף על ידי הצבת הרשת על גבי נייר הסינון. אל תיגע במשטח הרשת.
    4. הוסף 10 μl של 2% uranyl-formate (משלב 6.2.1) על גבי רשת של למעלה (שנערך עם מלקחיים).
    5. במהירות להשתמש בנייר אקולוגי ארוך טווח אלחוטי לניקוז הנוזל העודף על ידי הצבת הרשת על גבי נייר הסינון. אל תיגע במשטח הרשת.
    6. חזור על שלבים 6.2.4 ו6.2.5.
    7. הוסף 10 μl של 2% uranyl-formate (משלב 6.2.1) על גבי רשת של למעלה (שנערך עם מלקחיים). בואו פתרון מכתים לספוג למשך 30 שניות.
    8. השתמש בנייר אקולוגי ארוך טווח אלחוטי לניקוז הנוזל העודף על ידי הצבת הרשת על גבי נייר הסינון. אל תיגע במשטח הרשת.
    9. בואו הרשת להתייבש לחלוטין לפחות 30 דקות, עם פנים כלפי מעלה על נייר סינון, לפני הזרקה לתוך TEM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

נציגי תוצאות מוצגות באיור 2 א. כל הנתיבים מכילים 1 מיקרוגרם של ה- DNA הכולל, נמדד באמצעות ספקטרופוטומטר (OD 260). בהשוואה לפיגום DNA חד-גדיל העגול (ליין 2), nanorobots הם הפריעו בג'ל בשל המשקל המולקולרי גבוה יותר שלהם, התוצאה של הכלאת סיכות ל- DNA הפיגום (ליין 3. חץ אדום). להקת המשקל המולקולרית הנמוכה בליין 3 מייצגת סיכות עודפות שלא להיקשר ל- DNA הפיגום (חץ ירוק). לאחר טיהור באמצעות סינון צנטריפוגלי ביותר של הסיכות העודפות יוסרו (Lanes 4-6) וnanorobots מוכן להיות טעון עם מולקולות מטען מצומדת לידיות גדיל משלים 14,15,22. נתיבים 4-6 לכלול להקות משקל מולקולריות גבוהות המייצגות הדימרים nanorobot (חץ הכחול), אוכלוסייה של nanorobots שכרוכים יחד. הפחתת הריכוז של הפיגום בהליך הייצור (לאו 5 או 10 ננומטר) עלול reduהספירה הכמות היחסית של מבני משקל המולקולריים הגבוהים אלה. נתיבי 4-6 nanorobots תכנית פוסט-טיהור עם שינויים קלים בפרוטוקול הטיהור תאר, כלומר הנפח הראשוני של nanorobots המפוברק הוסיף למסנן הספין (שלב 4.1 ליין 4:. Μl 50; ליין 5: μl 100; ליין 6: 100 μl), ואת מספר הפעמים החיץ נוסף למסנן (שלב 4.4 ליין 4: 2 פעמים; ליין 5:. 2 פעמים; ליין 6: 5 פעמים).

השוואה של תוצאות התשואה והטיהור בין הווריאציות השונות לפרוטוקול (איור 2 ג) מראה כי יש לצמצם את ההיקף הראשוני של רובוטים מפוברקים הטעונים אל מסנן צנטריפוגלי (שלב 4.1) השפעה מועטת על שיעורי התשואה וטיהור. יתר על כן, להגדיל את מספר חילופי חיץ וספיני צנטריפוגלי (שלבים 4.4) יש השפעה שולית על טוהר על nanorobots, תוך הפחתת התשואה משמעותית. לפיכך הפרוטוקול המתואר, מתאים ל -100 μlנפח ראשוני ו -2 תוספות חיץ (מסלול 5), נחשבים אופטימליים.

הערכות תשואה מתבססות על ספקטרופוטומטר (OD 260) מדידות של כל דגימה לאחר טיהור ומחושבות ביחס לכמות הראשונית נטענת לכל מסנן צנטריפוגלי. טיהור מבוססת על אחוזים במשקל של nanorobots מכל ה- DNA במדגם, המקביל לnanorobots והסיכות עודפות שלא לשטוף את במהלך טיהור. ערכות טיהור מחושבות מהעצמה היחסית של nanorobots (חיצים אדומים והכחולים באיור 2 א) לזה של הסיכות העודפות (חץ ירוק באיור 2). Nanorobots / סיכות העוצמות יחסי היו מנורמלות עם המדגם מטוהר מראש (Lane 3), שבו המשקל הכולל של ה- DNA הסיכות (חץ ירוק) הוא ~ 4.5 פעמים כי nanorobots הקנה בלתי (החץ אדום), מתאים לראשוני 10: 1 לפיגוםיחס טוחנת סיכות בפרוטוקול הייצור.

אימות סופית של שלמות מבנית מושגת באמצעות מיקרוסקופ אלקטרונים הילוכים באמצעות 2% uranyl-formate ככתם שלילי. תמונות מוצגות באיור 3.

איור 1
איור 1: עיצוב סכמטי של nanorobot מבט צד (א) לnanorobot סגור.. סליל כפול שער, המיוצר על ידי רצף aptamer וגדיל משלים, הוא הצביע על ידי חץ ירוק. מבט מלפנים של nanorobot סגור מראה מטען חלבון קשור בתוך (ב '). (ג) שרטוטי חתך של nanorobot הסגור מיוצר. ידיות סיכות מודגשות על ידי חץ אדום. עיגולים ירוקים מצביעים סלילים המכילים ציר בצד אחד ורצף שער בצד השני. שרטוטים (ד ') שלnanorobot במבט מהצד. ידיות מסומנות על ידי חצים אדומים. רצפי שער מסומנים על ידי חצים ירוקים. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2:. תוצאות ג'ל אלקטרופורזה agarose () ליין 1: דה מרקר 1kb. מסלול 2: פיגום אחד הגדיל מעגלי M13mp18. ליין 3: nanorobots מראש טיהור. נתיבים 4-6: nanorobots לפרסם purifications. מסלול 4: 50 μl נפח ראשוני; 2 תוספות חיץ. ליין 5: 100 μl נפח ראשוני; 2 תוספות חיץ. ליין 6: 100 μl נפח ראשוני; 5 תוספות חיץ. סיכות עודפות מסומנות על ידי חץ ירוק nanorobots מפוברק מסומן על ידי חץ אדום. חץ כחול מצביע הדימרים nanorobot. תצוגת 3D של העצמה היחסית של הלהקות בagarose (ב)לְהַגלִיד. הערכות תשואה (C) וטיהור.

איור 3
איור 3: תמונה TEM של nanorobots DNA שנלקח מהמצאות / נהלים מכתים מרובים.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> ליבה 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
מִספָּר יִעוּד סדר פעולות
1 ליבה AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 ליבה GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 ליבה TACGATATAGATAATCGAACAACA
4 ליבה CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 ליבה GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 ליבה GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 ליבה AAAATCACCGGAAGCAAACTCTGTAGCT
8 ליבה CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 ליבה CATGTAAAAAGGTAAAGTAATAAGAACG
10 ליבה ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 ליבה ATAGTCGTCTTTTGCGGTAATGCC
12 ליבה AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 ליבה AACTATTGACGGAAATTTGAGGGAATATAAA
14 ליבה ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 ליבה AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 ליבה GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 ליבה GCACCGCGACGACGCTAATGAACAGCTG
18 ליבה AACTTCATTTTAGAATCGCAAATC
19 ליבה CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 ליבה CCAATCAAAGGCTTATCCGGTTGCTATT
21 ליבה AGAGGCGATATAATCCTGATTCATCATA
22 ליבה CCGTAATCCCTGAATAATAACGGAATACTACG
23 ליבה AAATGGTATACAGGGCAAGGAAATC
24 ליבה TCCTCATCGTAACCAAGACCGACA
25 ליבה CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 ליבה ACCCGCCCAATCATTCCTCTGTCC
27 ליבה CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 ליבה CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 ליבה TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 ליבה
31 ליבה AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 ליבה ACATTCAGATAGCGTCCAATATTCAGAA
33 ליבה AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 ליבה GAGATGACCCTAATGCCAGGCTATTTTT
35 ליבה TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 ליבה GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 ליבה AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 ליבה ACCAATCGATTAAATTGCGCCATTATTA ד>
39 ליבה ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 ליבה CCCTAAAAGAACCCAGTCACA
41 ליבה GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 ליבה CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 ליבה TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 ליבה TTCCTTATAGCAAGCAAATCAAATTTTA
45 ליבה ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 ליבה AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 ליבה TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 ליבה AAAGAAACAAGAGAAGATCCGGCT
50 ליבה TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 ליבה TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 ליבה ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 ליבה AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 ליבה ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 ליבה TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 ליבה AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 ליבה CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 ליבה TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 ליבה ATAACGCAATAGTAAAATGTTTAAATCA
60 ליבה ACGAATCAACCTTCATCTTATACCGAGG
61 ליבה TAATGGTTTGAAATACGCCAA
62 ליבה CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 ליבה ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 ליבה AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 ליבה AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 ליבה GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 ליבה TTTTAGAACATCCAATAAATCCAATAAC
69 ליבה AAATGTGGTAGATGGCCCGCTTGGGCGC
70 ליבה ACGGATCGTCACCCTCACGATCTAGAATTTT
71 ליבה CGCCATAAGACGACGACAATAGCTGTCT
72 ליבה GCGTATTAGTCTTTAATCGTAAGAATTTACא
73 ליבה AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 ליבה AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 ליבה TAATTTAGAACGCGAGGCGTTAAGCCTT
76 ליבה ACCAGGCGTGCATCATTAATTTTTTCAC
77 ליבה CAGCCTGACGACAGATGTCGCCTGAAAT
78 ליבה ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 ליבה CTCGAATGCTCACTGGCGCAT
80 ליבה GGGCAGTCACGACGTTGAATAATTAACAACC
81 ליבה
82 ליבה TCAACCCTCAGCGCCGAATATATTAAGAATA
83 ליבה ATTATACGTGATAATACACATTATCATATCAGAGA
84 ליבה GCAAATCTGCAACAGGAAAAATTGC
85 ליבה ATAATTACTAGAAATTCTTAC
86 ליבה TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 ליבה AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 ליבה CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 ליבה TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 ליבה AAATCAAAGAGAATAACATAACTGAACACAGT
92 ליבה CTGTATGACAACTAGTGTCGA
93 ליבה ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 ליבה TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 ליבה ATAAGAATAAACACCGCTCAA
96 ליבה CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 ליבה AACCGCCTCATAATTCGGCATAGCAGCA
98 ליבה AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 ליבה CAGTATAGCCTGTTTATCAACCCCATCC
100 ליבה TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 ליבה CGTCGGAAATGGGACCTGTCGGGGGAGA
102 ליבה AAGAAACTAGAAGATTGCGCAACTAGGG
103 ליבה CCAGAACCTGGCTCATTATACAATTACG
104 ליבה ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 ליבה CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 ליבה GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 ליבה ACATCGGAAATTATTTGCACGTAAAAGT
109 ליבה CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 ליבה AAATCGTACAGTACATAAATCAGATGAA
111 ליבה TTAACACACAGGAACACTTGCCTGAGTATTTG
112 ליבה AGGCATAAGAAGTTTTGCCAGACCCTGA
113 ליבה GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 ליבה AGCTGCTCGTTAATAAAACGAGAATACC
115 ליבה CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 ליבה CACCCTCTAATTAGCGTTTGCTACATAC
117 ליבה GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 ליבה GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 ליבה ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 ליבה GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 ליבה GGCTTGCGACGTTGGGAAGAACAGATAC
122 ליבה TAAATGCCTACTAATAGTAGTTTTCATT
123 ליבה TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 ליבה TGACCATAGCAAAAGGGAGAACAAC
125 ליבה CGAGCCAGACGTTAATAATTTGTATCA
126 ליבה GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 ליבה AGACGCTACATCAAGAAAACACTTTGAA
128 ליבה AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 ליבה GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 ליבה GGTATTAAGGAATCATTACCGAACGCTA
131 ליבה GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 ליבה
133 ליבה ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 ליבה AACGAGATCAGGATTAGAGAGCTTAATT
135 ליבה TACCAAGTTATACTTCTGAATCACCAGA
136 ליבה CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 ליבה AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 ליבה TTTCAACCAAGGCAAAGAATTTAGATAC
139 ליבה TTGAAATTAAGATAGCTTAACTAT
140 ליבה CTATTATCGAGCTTCAAAGCGTATGCAA
ליבה CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 ליבה GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 ליבה CGAACGTTAACCACCACACCCCCAGAATTGAG
144 ליבה GTGTGATAAATAAGTGAGAAT
145 ליבה GCTATATAGCATTAACCCTCAGAGA
146 ליבה AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 ליבה CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 ליבה CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 ליבה
150 ליבה ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 ליבה ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 ליבה TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 ליבה AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 קָצֶה TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 קָצֶה TTTTTTTTTTTTTTTTAATAAGAGAATA
156 קָצֶה TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 קָצֶה
158 קָצֶה TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 קָצֶה TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 קָצֶה TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 קָצֶה TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 קָצֶה TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 קָצֶה TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 קָצֶה TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 קָצֶה TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 קָצֶה TTTTTTTTTTTTTTTACCGGATATTCA
167 קָצֶה TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 קָצֶה TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 קָצֶה CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 קָצֶה CAATGACAACAACCATTTTTTTTTTTTTTTT
171 קָצֶה TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 קָצֶה TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 קָצֶה
174 קָצֶה TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 קָצֶה TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 קָצֶה TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 קָצֶה CCACACAACATACGTTTTTTTTTTTTT
178 קָצֶה TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 קָצֶה TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 קָצֶה TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 קָצֶה TTTTTTTTTTTTTTTACGGCGGAT
182 קָצֶה TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 קָצֶה TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 קָצֶה TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 קָצֶה TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 קָצֶה TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 קָצֶה TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 קָצֶה ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 קָצֶה
190 קָצֶה TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 קָצֶה GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 קָצֶה GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 קָצֶה ATAACGTGCTTTTTTTTTTTTTTTTTT
194 קָצֶה TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 קָצֶה TTTTTTTTTTTTTTTACAAAATAAACA
196 קָצֶה TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 קָצֶה
198 קָצֶה TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 קָצֶה GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 קָצֶה TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 קָצֶה CACTAAAACACTTTTTTTTTTTTTTTT
202 קָצֶה TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 קָצֶה TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 קָצֶה TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 קָצֶה TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 קָצֶה TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 קָצֶה CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 קָצֶה TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 קָצֶה AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 קָצֶה ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 קָצֶה TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 קָצֶה TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 קָצֶה TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 קָצֶה TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 קָצֶה TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 קָצֶה TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 קָצֶה TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 קָצֶה AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 קָצֶה CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 קָצֶה TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 קָצֶה TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 קָצֶה TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 קָצֶה AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 קָצֶה CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 קָצֶה TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 קָצֶה TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 קָצֶה TTTTTTTTTTTTTCATCTTTGACCC
230 קָצֶה TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 קָצֶה GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 קָצֶה TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 קָצֶה GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 קָצֶה TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 קָצֶה TTTTTTTTTTTTTTTATAGCAATAGCT
236 ידיות AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 ידיות ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 ידיות CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 ידיות CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 ידיות CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 ידיות CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 ידיות AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 ידיות CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 ידיות CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 ידיות TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 ידיות AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 ידיות GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 מדריכים AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 מדריכים ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 מדריכים CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 מדריכים GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 מדריכים AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 מדריכים TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 מדריכים TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 הסרת מדריכים GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 הסרת מדריכים GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 הסרת מדריכים TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 הסרת מדריכים AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 הסרת מדריכים CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 גואיהסרת des GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 הסרת מדריכים ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 גייטס Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 גייטס Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 גייטס Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 גייטס Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

טבלת 1: רשימה של רצפי מצרךמשמש לבניית nanorobot. סטייפלס 1-153 מיועד Core ומרכיב את חלק הארי של המבנה. סטייפלס 154-235 מיועדים קצוות ונמצאים בכל אחד מהקצוות של 61 סלילים של המבנה. סיכות קצה מכילות זנב תימין פולי נועד למנוע הצטברות של nanorobots. סטייפלס 236-247 מיועדים ידיות ומרכיבים את אתרי עגינה מטענים. ידיות יש סיכות אזור רצף ייחודי, הקושרות אותם למיקומם הספציפי של המבנה, ואזור רצף קונסנסוס המשמש כאתר עגינה למולקולות המטען. סטייפלס 248-254 מיועדים מדריכים ולצרף את שני החצאים של המכשיר במהלך תהליך חישול. לאחר ייצור המדריכים יוסרו עם התוספת של סיכות להסרת מדריך 255-261 (שלב 6), שעזבו את המכשיר הנעול על ידי שני החיישנים של nanorobot. רצפי חיישן מיועדים גייטס. כל אחד משני החיישנים מורכב מaptamer PDGF וגדיל משלים. לexpla מפורט יותראומה רואה בן-ישי ואח '. 14 ודאגלס et al. 15. סטייפלס מסודרות מסחרי בשלוש צלחות 96-היטב (תחתון עגול עמוק). כל סכום מצרך מנורמל 10 ננומול. פרט לרצפי שער, הדורשים טיהור HPLC, סיכות אינן דורשות הליך טיהור מיוחד.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

תארנו את הייצור, טיהור, ויזואליזציה של nanorobot DNA. בעקבות ייצור של מארז המשושה של המכשיר, הפונקציה של nanorobot מתוכנת עם ההקדמה הפשוטה של מטען ספציפי וגדילי חישה לרובוט שבקלות למצוא את המיקום המיועד שלהם עקב השלמת מימן מליטה עם אתרי עגינה אחת הגדיל זמין 14 , 15,22.

פרוטוקול הייצור המתואר משתמש רמפת חישול איטית, המשמשת בדרך כלל במעבדה שלנו לקפל מגוון רחב של צורות אוריגמי. אם זמן ייצור הופך מפתח פרוטוקולים אחרים גורם, כגון פרוטוקול הקיפול המהיר שתואר על ידי אל Sobczak et. 24 ניתן להשתמש. פרוטוקול זה דיווח להשיג קיפול אוריגמי בתשואות גבוהות, אבל זה דורש כיול עבור כל צורת אוריגמי.

סינון ספין משמש לטהר את הרובוטים מסיכות עודפות. בעת הטעינה שלטור סיכה עם דוגמאות או חיץ, יש להיזהר שלא לפגוע בקרום עם קצה פיפטה. הקרום עלול להיקרע וכתוצאה מכך תשואות מופחתות באופן דרמטי. רצוי לא להשליך את הזרימה דרך עד nanorobots הם דמיינו לפי גיל.

ליישום מסוים שיעור טיהור גבוה יותר הוא רצוי; זו יכולה להיות מושגת על ידי חזרה על הסינון באמצעות טור הספין המקורי. לטוהר גבוה אף יותר, ניתן להשתמש בטור ספין חדש, אולם זה יהיה השפעה שלילית דרמטית על שיעורי התשואה. שיטות אחרות למבני אוריגמי DNA הטיהור נבדקו, כגון כריתה מagarose ג'ל לאחר אלקטרופורזה ודיאליזה של סיכות עודפות. שיטות אלה הביאו גם תשואה גרועה או שיעורי טיהור עניים בהשוואה לפרוטוקול המתואר. שיטות אחרות, כגון טיהור מבוססת PEG 25 ושיעור-אֵזוֹרִי ultracentrifugation 26 לא נבדקו. שיטות אלה דיווחו לאחישיעורים גבוהות טיהור ערב, אולם הם גם לגרום לתשואות עלובות (ultracentrifugation שיעור-אֵזוֹרִי) או לדרוש ממטרים (מבוסס PEG) שעלול לפגוע בצורת nanorobot החלולה.

Nanorobots מיוצרים עם סיכות מדריך שלנעול את הצורה במצב הסגור על מנת להגדיל yeilds הייצור 15. חשוב להסיר את הסיכות אלה על ידי הוספת סיכות להסרת מדריך לnanorobots ליעילות פתוחה בתגובה לגירויים שנועדו (PDGF בפרוטוקול המתואר). סיכות מדריך נועדו עם אזור גדיל בודד דריסת רגל לעגינה של סיכות להסרת המדריך ששחררו את סיכות המדריך באמצעות תהליך של עקירת גדיל יש להוסיף 18 .These סיכות ב- 10: 1 טוחנת בסוף הטיהור של עודף שלב 'הסיכות (שלב 4.7) וטופחו במשך 2 שעות בטמפרטורת חדר בסוף על שייקר הסוף.

הדמיה על ידי TEM תוארה, including uranyl-formate 2% מכתים שלילי. לעומת uranyl-אצטט, uranyl-formate מייצר מבני תבואה עדינים המאפשרים לרזולוציה טובה יותר של עיצובי אוריגמי DNA. יש להקפיד כuranyl-formate יהיה לגבש אם aliquots קפואים במשך פרקי זמן ארוכים. מומלץ להשתמש בפתרון של 2% uranyl-formate מוכן טרי לצביעה. החלטות טובות יותר הן ברות השגה עם השימוש של קריו TEM 27.

פרוטוקול העיצוב וייצור האדריכלי הבסיסי של nanorobot DNA הוא סופו של דבר אחיד וברורים. עם זאת, מגוון רחב של גמישות מוצע בצורה של תערובות מטען ספציפיות וגדילי חישה. יתר על כן, באוכלוסייה אחת יכול להיות הציגו תת רבים וההרכב היחסי שלהם מתוכנת ומותאם כדי להתאים לצרכימים ספציפיים. אפילו יותר כוונון עדין של קינטיקה הספציפית בכל שלב שער הגבלה הוא בר השגה עם הגדלת / הקטנת האורך של הכלאת גדיל כפולה אוכניסתה של חוסר התאמה בעמדות מפתח ספציפיים. רמה גבוהה זו של גמישות בקלות הבנייה מאפשרת להנדסה של התקני ננו מסוגלים לבצע משימות מורכבות מגוונות ביותר בסביבה רלוונטית ביולוגית.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

יש המחברים אין לחשוף.

Acknowledgments

המחברים מבקשים להודות ס דאגלס לדיונים בעלי ערך רבים ועצות, וכל החברים של המעבדה באשל לדיונים מועילים ועבודה. עבודה זו נתמכת על ידי מענקים מהפקולטה למדעי חיים והמכון לננוטכנולוגיה והחומרים מתקדמים באוניברסיטת בר-אילן.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics