डीएनए origami से एक जैव संवेदनशील रोबोट की तह और विशेषता

Chemistry
 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

डीएनए nanorobot अंदर तनहा विशिष्ट उत्तेजनाओं और वर्तमान माल के जवाब में खोलने के लिए बनाया गया एक खोखला हेक्सागोनल nanometric युक्ति है। दोनों उत्तेजनाओं और कार्गो विशिष्ट आवश्यकताओं के अनुसार अनुकूलित किया जा सकता है। यहाँ हम डीएनए origami तकनीक के उपयोग के साथ, डीएनए nanorobot निर्माण प्रोटोकॉल का वर्णन है। प्रक्रिया तो एक तह बफर की उपस्थिति में एक लंबा, परिपत्र, एकल कतरा डीएनए पाड़ के लिए जोड़ा है जो एक शेयर मिश्रण में लघु एकल कतरा डीएनए स्टेपल के मिश्रण से शुरू की। एक मानक थर्मो साइक्लर धीरे-धीरे nanorobot की तह पीछे मार्गदर्शक ताकत है जो स्टेपल करने वाली पाड़ annealing, की सुविधा के लिए मिश्रण प्रतिक्रिया तापमान कम करने के लिए प्रोग्राम किया जाता है। 60 घंटा तह प्रतिक्रिया पूरा हो गया है एक बार, अतिरिक्त स्टेपल agarose जेल वैद्युतकणसंचलन (उम्र) के माध्यम से दृश्य के बाद एक केन्द्रापसारक फिल्टर का उपयोग करते हुए खारिज कर रहे हैं। अंत में, nanorobot के सफल निर्माण (मंदिर) संचरण इलेक्ट्रॉन माइक्रोस्कोपी द्वारा सत्यापित किया जाता है,नकारात्मक दाग के रूप में uranyl-स्वरूप के उपयोग के साथ।

Introduction

न्यूक्लिक एसिड नैनो के लिए उपयोग करता है अद्भुत हैं। वाटसन-क्रिक आधार बाँधना की शिक्षणीयता के साथ ही कस्टम बनाया ओलिगोस 2 की बड़े पैमाने पर संश्लेषण की आसानी और रिश्तेदार कम लागत वाली डीएनए नैनो के क्षेत्र में एक आवेदन 3 के विस्फोट और अनुसंधान उत्पन्न किया है। एक मौलिक निर्माण खंड के रूप में स्थिर सीमैन जंक्शन 4,5 पर आधारित स्ट्रक्चरल डीएनए नैनो, मनमाने ढंग से आकार 6-8 के निर्माण के लिए एक स्वयं कोडांतरण प्राथमिक इकाई के रूप में डीएनए का इस्तेमाल करता है।

scaffolded डीएनए origami 9 तकनीक की हाल ही में विकास उप नैनोमीटर परिशुद्धता के साथ जटिल 2D / 3D नैनो आर्किटेक्चर 10-12 के निर्माण के लिए अनुमति देता है और बढ़ती जटिलता और आश्चर्यजनक विविधता के साथ नए कार्यात्मक वस्तुओं के निर्माण के लिए एक कुशल मार्ग है। निर्माण प्रक्रिया में लंबा पाड़ एकल असहाय डीएनए पर आधारित है, आम तौर पर एक वायरल जीनोम से निकाली गईलघु भी कतरा डीएनए ओलिगोस के सैकड़ों के संकरण के माध्यम से तह किया जा सकता है, जो ई, स्टेपल करार दिया। निर्माण के reproducibility प्राप्त अधिकतम हाइड्रोजन संबंध पूरकता की सुविधा के लिए लघु एकल कतरा प्रधान दृश्यों सिलाई का परिणाम है, जबकि इस तकनीक के द्वारा प्राप्त उच्च संरचनात्मक संकल्प, डीएनए डबल हेलिक्स की प्राकृतिक आयामों का प्रत्यक्ष परिणाम है। एक धीमी गति से तापमान annealing के उपयोग के साथ thermodynamically वरीय nanostructure उच्च पैदावार और निष्ठा में पहुँच जाता है डिज़ाइन किया गया सबसे कम ऊर्जा, रैंप। एक कंप्यूटर कोड में जंक्शन डिजाइन के नियमों के आसान कार्यान्वयन अत्यंत जुड़ा जंक्शनों के सैकड़ों युक्त बड़े, जटिल संरचनाओं डिजाइनिंग के काम को आसान है कि इस तरह caDNAno 13 के रूप में सीएडी उपकरण के विकास, सक्षम होना चाहिए।

पहले हम caDNAno उपकरण 14,15 की सहायता से एक डीएनए nanorobot के डिजाइन का वर्णन किया। यहाँ हम निर्माण को दर्शाती है औरसंचरण इलेक्ट्रॉन माइक्रोस्कोपी (मंदिर) के माध्यम से दृश्य, के आयामों के साथ nanorobot, एक 3 डी खोखले हेक्सागोनल nanodevice, के एक पूर्व निर्धारित उत्तेजनाओं और वर्तमान विशिष्ट माल, के जवाब में एक प्रमुख गठनात्मक परिवर्तन से गुजरना करने के लिए तैयार 35 x 35 x 50 एनएम 3, इस तरह प्रोटीन या न्यूक्लिक एसिड ओलिगोस के रूप में, अंदर तनहा। 12 लोडिंग स्टेशनों खोखला चेसिस के अंदर उपलब्ध हैं, बाध्य माल की वास्तविक संख्या कार्गो आकार के साथ अलग है। कार्गो अणुओं छोटे डीएनए अणु से एंजाइमों, एंटीबॉडी और 5-10 एनएम सोने के नैनोकणों को लेकर। प्रत्येक nanorobot अलग अणुओं का मिश्रण होता है, जैसे कि वर्दी या विषम हो Cargocan हैं या तो। सेंसिंग aptasensor 16,17 या डीएनए किनारा विस्थापन 18 प्रौद्योगिकियों पर या तो, प्रोटीन, न्यूक्लिक एसिड या अन्य रसायनों भावना के लिए दो डबल पेचदार लॉकिंग फाटकों डिजाइन के माध्यम से हासिल आधारित है। Aptamer चयन प्रोटोकॉल 19-21 में हाल के घटनाक्रम जवाब nanorobots के डिजाइन सक्षमअणुओं और प्रकार की कोशिकाओं के एक बढ़ती दूरी के लिए।

इससे पहले काम अपने प्रतिजन के लिए बाध्यकारी एक निरोधात्मक या एक मिश्रित सेल की आबादी 15 में विशिष्ट प्रकार की कोशिकाओं के अंदर करने के लिए एक विपुल संकेत या तो रिले कर सकते हैं पर जो एक विशिष्ट एंटीबॉडी, ले जाने के एक nanorobot दिखाया। इन nanodevices के एक रोमांचक सुविधा एक ही जनसंख्या में विभिन्न nanorobot उपप्रकार की शुरूआत के साथ और भी अधिक जटिल कार्यों और तर्क नियंत्रण प्रदर्शन करने की क्षमता है। हाल ही में हमने एक सक्रिय माल अणु 22 से युक्त एक प्रेरक जनसंख्या को नियंत्रित करने, सकारात्मक या नकारात्मक नियामकों या तो के रूप में प्रदर्शन nanorobots के विशिष्ट उपप्रकार का प्रदर्शन किया।

यहाँ प्रस्तुत प्रोटोकॉल nanorobot 15,22 के उद्घाटन की सुविधा के लिए PDGF के लिए चुनिंदा जो बाँध aptamer सेंसर दृश्यों के साथ gated एक nanorobot का निर्माण, शोधन और इमेजिंग का वर्णन है। वर्णित निर्माण की प्रक्रिया n करने के लिए इसी तरह की हैउपज और शुद्धि की दरों में वृद्धि करते हुए anorobot निर्माण की प्रक्रिया शुरू में, डगलस एट अल। समग्र प्रक्रिया की अवधि कम करने के उद्देश्य से बदलाव के साथ 15 से दर्शाया।

Protocol

स्टेपल्स पूल मिश्रण के 1. तैयारी

  1. 1 टेबल में सूचीबद्ध के रूप में 96 अच्छी तरह से प्लेटों पर आदेश lyophilized डीएनए nanorobot स्टेपल (सामग्री देखें) और 10 nmol को मानक के अनुसार। डीएनए nanorobot के डिजाइन और वास्तुकला का एक विस्तृत विवरण के लिए बेन-Ishay एट अल। 14 और डगलस एट अल देखते हैं। 15)।
  2. 100 माइक्रोन की एकाग्रता के लिए प्रत्येक प्रधान अच्छी तरह से साथ DNase / RNase मुक्त ultrapure Reconstitute। स्टेपल 10 nmol के लिए सामान्यीकृत के लिए, ultrapure पानी के 100 μl साथ पुनर्गठित।
  3. पूल एक multichannel pipettor और एक बाँझ 55 मिलीलीटर समाधान बेसिन का उपयोग कर प्रत्येक प्रधान के साथ 20 μl।
    नोट: nanorobot आकार, स्टेपल पूल में स्टेपल में से प्रत्येक की एकाग्रता (कोर, किनारों, संभालती है और गाइड दृश्यों, 1 टेबल सहित) 254 प्रधान किस्में के शामिल है के बाद से 394 एनएम है। प्रधान पूल से स्टेपल निकाल रहा है, या अलग खंड में कुछ जोड़नेumes काफी उपज कम हो, या अन्यथा सामने आया समुच्चय में हो सकता है।

नकली प्रतिक्रिया मिश्रण की 2. तैयारी

  1. एक मानक प्रतिक्रिया मिश्रण के लिए (सामग्री को देखने के, 100 एनएम शेयर समाधान) पाड़ डीएनए के 4 pmol करने के लिए इसी M13mp18 वायरल जीनोम परिपत्र भी कतरा डीएनए के 40 μl का उपयोग करें। निर्माण के मिश्रण में पाड़ के अंतिम एकाग्रता 20 एनएम, अंतिम मात्रा 200 μl है।
    1. विशिष्ट जरूरतों के हिसाब से पाड़ डीएनए की मात्रा समायोजित; हालांकि, एक निरंतर 20 एनएम पर प्रतिक्रिया मिश्रण में पाड़ डीएनए के अंतिम एकाग्रता रखने के लिए।
  2. क्रमश: 1 से 10 के स्टेपल अनुपात करने के लिए एक पाड़ तक पहुंचने के लिए स्टेपल जोड़ें। एक 20 एनएम पाड़ डीएनए एकाग्रता के लिए, 254 स्टेपल 'अंतिम एकाग्रता के प्रत्येक 200 एनएम है। एक 200 μl अंतिम प्रतिक्रिया मात्रा के लिए स्टेपल पूल मिश्रण (खंड 1.2) के 102 μl जोड़ें।
    1. वें करने के लिए अलग से विशेष गेट दृश्यों जोड़ेंइस समय ई तह प्रतिक्रिया मिश्रण। ये ओलिगोस अलग से आदेश दिया और एचपीएलसी शुद्धि की आवश्यकता होती है। एक 20 एनएम पाड़ एकाग्रता के लिए प्रत्येक oligo के यानी 200 एनएम, गेट ओलिगोस 1:10 पाड़ गेट के अनुक्रम अनुपात में मौजूद हैं कि सुनिश्चित करें। एक 200 μl तह प्रतिक्रिया मात्रा के लिए, एक 100 माइक्रोन के शेयर एकाग्रता में चार गेट oligo से प्रत्येक के लिए 0.4 μl जोड़ें।
  3. 1x TAE (40 मिमी Tris-एसीटेट, 1 मिमी EDTA) के अंतिम एकाग्रता तक पहुँचने के लिए 10x TAE स्टॉक बफर जोड़ें। एक 200 μl तह प्रतिक्रिया मात्रा के लिए, 10x TAE के 20 μl जोड़ें।
  4. 10 मिमी की एक अंतिम एकाग्रता के लिए 1 एम 2 MgCl जोड़ें। एक 200 μl तह प्रतिक्रिया मात्रा के लिए, 1 एम 2 MgCl के 2 μl जोड़ें।
  5. 200 μl के अंतिम मात्रा तक पहुँचने के एक करने के लिए DNase / RNase मुक्त ultrapure पानी के 36 μl जोड़ें।
  6. पीसीआर शीशियों में भंवर और विभाज्य 100 μl नमूने हैं।
    नोट: प्रयोग की जाने वाली अधिकतम प्रतिक्रिया की मात्रा के बारे में थर्मल cycler विनिर्देश से परामर्श करें।इन सीमाओं को पूरा करने के लिए मात्रा को कम करना प्राप्त पैदावार कम नहीं होगा। पैदावार ख़तरे में डालना होगा निर्दिष्ट अधिकतम ऊपर प्रतिक्रिया संस्करणों।

निर्माण रिएक्शन की 3. तापमान एनीलिंग रैंप

  1. कार्यक्रम थर्मल cycler पालन के रूप में:
    1. 5 मिनट / डिग्री सेल्सियस की दर से 60 डिग्री सेल्सियस से 85 डिग्री सेल्सियस रैंप।
    2. रैंप 60 डिग्री सेल्सियस 75 मिनट / डिग्री सेल्सियस की दर से 4 डिग्री सेल्सियस तक।
    3. अनिश्चित काल के लिए 4 डिग्री सेल्सियस पर पकड़ो।
  2. बाद निर्माण -20 डिग्री सेल्सियस पर स्टोर नमूने समाप्त हो गया है।

अतिरिक्त स्टेपल्स 4. निकालना

  1. 100 केडीए के एक MWCO के साथ एक 0.5 मिलीलीटर केन्द्रापसारक फिल्टर करने के लिए तह प्रतिक्रिया मिश्रण के 100 μl जोड़ें। बाद में विश्लेषण के लिए nanorobots पूर्व शुद्धि की एक 10 μl नमूना बचाओ।
  2. 9600 x जी पर 10 मिनट के लिए अपकेंद्रित्र।
  3. तह बफर के 400 μl (1x TAE, 10 मिमी 2 MgCl) जोड़ें।
  4. दोहराएँ दो बार अधिक 4.2 और 4.3 कदम।
  5. 9600 x जी पर 5 मिनट के लिए अपकेंद्रित्र।
  6. 9600 x जी पर 1 मिनट के लिए एक साफ microcentrifuge ट्यूब और स्पिन में उल्टा फिल्टर रखकर ध्यान केंद्रित करने की वसूली। अंतिम संस्करणों फिल्टर में डाल दिया था कि निर्माण प्रतिक्रिया मिश्रण की प्रारंभिक मात्रा के आधार पर भिन्न हो सकते हैं। आमतौर पर केंद्रित nanorobot नमूने के एक 25-60 μl अंतिम मात्रा प्राप्त की है।
  7. 260 एनएम पर स्पेक्ट्रोफोटोमीटर के माध्यम से नमूने में डीएनए की एकाग्रता को मापने। Nanorobot नमूनों की दाढ़ सांद्रता की गणना करते समय 5.3 माइक्रोग्राम / pmol की आणविक वजन का प्रयोग करें।
    नोट: dsDNA के लिए दाढ़ विलुप्त होने के गुणांक, 50 माइक्रोग्राम / 260 आयुध डिपो, सबसे अनुप्रयोगों के लिए पर्याप्त है। 48 माइक्रोग्राम / 260 आयुध डिपो किनारों स्टेपल पर खाते में ssDNA फैला पाली थाइमिन लेता है।

तह nanorobots 5. agarose जेल वैद्युतकणसंचलन विश्लेषण

  1. 0.5x TBE (45 मिमी Tris-borate, 1 मिमी EDTA), 2% agarose जेल की तैयारी 10 मिमी 2 MgCl के साथ पूरक एट अल से अनुकूलित 21।):
    1. DDH 2 ओ के 118.75 मिलीलीटर में 10x TBE स्टॉक बफर के 6.25 मिलीलीटर गिराए द्वारा 0.5x TBE बफर तैयार
    2. 0.5x TBE बफर के 125 मिलीलीटर में agarose के 2.5 ग्राम भंग।
    3. Agarose पूरी तरह भंग कर रहा है जब तक माइक्रोवेव में उबाल लें।
    4. 10 मिमी के अंतिम एकाग्रता के लिए 1 एम 2 MgCl के 1.25 मिलीलीटर जोड़ें।
    5. 10 मिलीग्राम के 7 μl जोड़ें / एमएल ethidium ब्रोमाइड।
    6. थोड़ा शांत करने के लिए समाधान के लिए प्रतीक्षा करें और agarose जेल solidifies से पहले जेल ट्रे भरें। तुरंत वांछित कंघी स्थापित करें।
    7. DDH 2 ओ की 940 मिलीलीटर 0.5x TBE 2 MgCl 10x TBE स्टॉक बफर के 50 मिलीग्राम और 1 एम के 10 मिलीलीटर जोड़कर चल बफर 1 एल तैयार
    8. जेल एक बर्फ स्नान में वैद्युतकणसंचलन डिवाइस के लिए बफर और डाल डिवाइस चल ठोस जोड़ने के लिए है एक बार।
  2. एक पाड़ के साथ nanorobots पूर्व शुद्धि का लोड 1 ग्राम के कुल डीएनए (3.2 कदम), और बाद शुद्धि (कदम 4.7),डीएनए नमूने और जेल पर एक 1 केबी डीएनए मार्कर,। एक उदाहरण चित्रा 2 में दी गई है। नमूनों की वास्तविक संस्करणों शुद्धि के बाद प्राप्त सांद्रता पर निर्भर करते हैं। 6 अंतिम मात्रा अनुपात: प्रत्येक नमूने एक 1 पर लोड हो रहा है बफर के साथ भरी हुई है।
  3. 80 वी करने के लिए शक्ति का स्रोत सेट और 3 घंटे के लिए जेल चला रहे हैं। बर्फ और पानी से भरे एक स्नान में जेल चला। Nanorobots प्रकट करना और agarose जेल वैद्युतकणसंचलन दौरान गरमा यदि एक धब्बा के रूप में दिखाई देगा। वैद्युतकणसंचलन के दौरान गर्म करने से डिवाइस रखने के लिए अतिरिक्त बर्फ जोड़ें।
  4. एक यूवी मेज पर देखें जेल (चित्रा 2)।

Uranyl-स्वरूप के साथ nanorobot 6. नकारात्मक दाग

  1. 2% uranyl-स्वरूप स्टॉक समाधान की तैयारी (कास्त्रो एट अल से अनुकूलित 23।):
    1. एक 15 मिलीलीटर ट्यूब में uranyl-स्वरूप पाउडर के 100 मिलीग्राम वजन।
    2. 3 मिनट के लिए उबाल लें DNase / RNase मुक्त ultrapure पानी डी-आक्सीजन के साथ।
    3. ऑक्सीजन रहित गर्म पानी के 5 मिलीलीटर जोड़ें (~ 60 डिग्री सेल्सियस)(पिछले चरण से) uranyl-स्वरूप पाउडर युक्त 15 मिलीलीटर ट्यूब में। कसकर बंद ढक्कन, (एक भंवर से जकड़ना ट्यूब) कड़ाई से 10 मिनट के लिए एल्यूमीनियम पन्नी और भंवर में लपेटें। समाधान के लिए एक पीले रंग के साथ परेशान दिखाई देनी चाहिए।
    4. 0.2 माइक्रोन सिरिंज फाई lter के माध्यम से फिल्टर समाधान। समाधान स्पष्ट हो जाना चाहिए।
    5. अशेष microcentrifuge ट्यूबों में समाधान के 200 μl।
    6. ट्यूब के नीचे पूल के नमूने के लिए एक तालिका के शीर्ष अपकेंद्रित्र में 5 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र।
  2. ग्रिड और नकारात्मक धुंधला करने के लिए नमूने के लोड हो रहा है:
    1. 2% uranyl-स्वरूप समाधान (धारा 6.1 में तैयार) की एक 200 μl विभाज्य Defrost। 3 मिनट के लिए कड़ाई से 0.5 एम NaOH समाधान और भंवर के 10 μl जोड़ें। एक तालिका के शीर्ष सेंट्रीफ्यूज का उपयोग कर 5 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र।
    2. इस बीच, चमक-मुक्ति ग्रिड 0.2 मिलीबार पर कमरे में हवा का उपयोग और 25 मा 30 सेकंड के लिए।
    3. शुद्धिकरण के बाद 2 एनएम nanorobot नमूना के 15 μl जोड़ें (sectiग्रिड के जहाज़ की छत पर 4.7) पर (संदंश के साथ आयोजित) और 1 मिनट के लिए अवशोषित करते हैं। फिल्टर पेपर के शीर्ष पर ग्रिड रखकर अतिरिक्त तरल निकास के लिए फाई lter कागज का प्रयोग करें। ग्रिड सतह पर नहीं टिकते।
    4. ग्रिड के जहाज़ की छत पर (कदम 6.2.1 से) 2% uranyl-स्वरूप के 10 μl जोड़ें (संदंश के साथ आयोजित)।
    5. जल्दी से फिल्टर पेपर के शीर्ष पर ग्रिड रखकर अतिरिक्त तरल निकास के लिए फाई lter कागज का उपयोग करें। ग्रिड सतह पर नहीं टिकते।
    6. दोहराएँ 6.2.4 और 6.2.5 कदम।
    7. ग्रिड के जहाज़ की छत पर (कदम 6.2.1 से) 2% uranyl-स्वरूप के 10 μl जोड़ें (संदंश के साथ आयोजित)। धुंधला समाधान 30 सेकंड के लिए अवशोषित करते हैं।
    8. फिल्टर पेपर के शीर्ष पर ग्रिड रखकर अतिरिक्त तरल निकास के लिए फाई lter कागज का प्रयोग करें। ग्रिड सतह पर नहीं टिकते।
    9. ग्रिड, कम से कम 30 मिनट के लिए पूरी तरह से सूखे मंदिर में इंजेक्शन लगाने से पहले, एक फिल्टर पेपर पर सामना करते हैं।

Representative Results

प्रतिनिधि परिणाम चित्रा 2A में दिखाया जाता है। सभी गलियों स्पेक्ट्रोफोटोमीटर (आयुध डिपो 260) के माध्यम से मापा कुल डीएनए के एक ग्राम, होते हैं। परिपत्र एकल कतरा डीएनए पाड़ (2 लेन) के साथ तुलना में, nanorobots की वजह से उनके उच्च आणविक वजन करने के लिए जेल में रोक दिए जाते हैं पाड़ डीएनए के लिए स्टेपल संकरण का परिणाम (लेन 3. लाल तीर)। लेन 3 में कम आणविक भार बैंड पाड़ डीएनए (हरा तीर) के लिए बाध्य नहीं किया है, जो अतिरिक्त स्टेपल का प्रतिनिधित्व करता है। केन्द्रापसारक निस्पंदन के माध्यम से शोधन करने के बाद अतिरिक्त स्टेपल के सबसे (गलियों 4-6) को हटा रहे हैं और nanorobots हैंडल पूरक किनारा 14,15,22 संयुग्मित माल अणुओं के साथ लोड किया जा करने के लिए तैयार कर रहे हैं। गलियों 4-6 nanorobot dimers (नीले तीर), एक साथ बंधे हुए हैं जो nanorobots की आबादी का प्रतिनिधित्व करने के लिए उच्च आणविक भार बैंड होते हैं। संभवतः Redu (5 या 10 या तो एनएम) निर्माण प्रक्रिया में पाड़ की एकाग्रता सकते हैं कम करनाइन उच्च आणविक भार संरचनाओं के रिश्तेदार राशि सीई। वर्णित शुद्धि प्रोटोकॉल को मामूली बदलाव के साथ पोस्ट-शुद्धि लेन 4-6 शो nanorobots अर्थात् गढ़े nanorobots की प्रारंभिक मात्रा स्पिन फिल्टर (4.1 चरण में जोड़ा लेन 4:। 50 μl; लेन 5: 100 μl; लेन 6: 100 μl), और बफर फिल्टर करने के लिए जोड़ा गया है समय की संख्या (4.4 कदम लेन 4: 2 बार; लेन 5:। 2 बार; लेन 6: 5 बार)।

प्रोटोकॉल (चित्रा -2) के लिए अलग अलग रूपों के बीच उपज और शुद्धि परिणामों की तुलना केन्द्रापसारक फिल्टर पर्यत भरा हुआ गढ़े रोबोट (4.1 चरण) के प्रारंभिक मात्रा को कम उपज और शुद्धि दरों पर थोड़ा प्रभाव है कि पता चलता है। काफी उपज को कम करते हुए इसके अलावा, बफर आदान-प्रदान और केन्द्रापसारक स्पिन (4.4 कदम) nanorobots पर पवित्रता पर सीमांत प्रभाव है की संख्या बढ़ रही है। इसलिए वर्णित प्रोटोकॉल, 100 μl के लिए इसीप्रारंभिक मात्रा और 2 बफर जोड़ (लेन 5), इष्टतम माना जाता है।

यील्ड अनुमानों स्पेक्ट्रोफोटोमीटर (आयुध डिपो 260) प्रत्येक नमूना पोस्ट-शुद्धि की माप पर आधारित है और प्रत्येक केन्द्रापसारक फिल्टर में लोड प्रारंभिक राशि के सापेक्ष गणना कर रहे हैं। शोधन शुद्धि के दौरान बाहर साफ़ नहीं हुआ जो nanorobots और अतिरिक्त स्टेपल करने के लिए इसी नमूने में पूरे डीएनए से nanorobots का वजन प्रतिशत पर आधारित है। शुद्धीकरण अनुमानों अतिरिक्त स्टेपल की है कि nanorobots (2A चित्रा में लाल और नीले तीर) (चित्रा 2 बी में हरा तीर) के रिश्तेदार तीव्रता से गणना कर रहे हैं। रिश्तेदार nanorobots / स्टेपल तीव्रता ~ स्टेपल (हरा तीर) के कुल डीएनए वजन है जिसमें पूर्व शुद्ध नमूना (3 लेन), के साथ सामान्यीकृत थे प्रारंभिक करने के लिए इसी unpurified nanorobots (लाल तीर) के 4.5 गुना है कि 10: के लिए एक पाड़निर्माण प्रोटोकॉल में स्टेपल दाढ़ अनुपात।

संरचनात्मक अखंडता के अंतिम सत्यापन एक नकारात्मक दाग के रूप में 2% uranyl-स्वरूप का उपयोग कर संचरण इलेक्ट्रॉन माइक्रोस्कोपी के माध्यम से हासिल की है। तस्वीरें चित्रा 3 में प्रस्तुत कर रहे हैं।

आकृति 1
चित्रा 1: nanorobot की योजनाबद्ध डिजाइन एक बंद nanorobot (ए) की ओर देखें।। एक aptamer अनुक्रम और एक पूरक किनारा द्वारा उत्पादित गेट डबल हेलिक्स, एक हरे तीर द्वारा संकेत दिया है। (बी) के अंदर बाध्य प्रोटीन माल दिखा एक बंद nanorobot के सामने देखने। (सी) का उत्पादन closed nanorobot के पार अनुभाग schematics। हैंडल स्टेपल एक लाल तीर से डाला जाता है। हरी हलकों एक तरफ एक काज और विपरीत दिशा में एक गेट अनुक्रम होते हैं, जो helixes संकेत मिलता है। (डी) ब्लूप्रिंटकी ओर देखने पर एक nanorobot। हैंडल लाल तीर द्वारा संकेत कर रहे हैं। गेट दृश्यों हरी तीर द्वारा संकेत कर रहे हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्रा 2:। Agarose जेल वैद्युतकणसंचलन परिणाम (ए) लेन 1: 1kb मार्कर। 2 लेन: M13mp18 परिपत्र एकल कतरा पाड़। लेन 3: nanorobots पूर्व शुद्धि। गलियों 4-6: nanorobots purifications पोस्ट। लेन 4: 50 μl प्रारंभिक मात्रा; 2 बफर जोड़ रहे हैं। लेन 5: 100 μl प्रारंभिक मात्रा; 2 बफर जोड़ रहे हैं। 6 लेन: 100 μl प्रारंभिक मात्रा; 5 बफर जोड़ रहे हैं। अतिरिक्त स्टेपल गढ़े nanorobots एक लाल तीर द्वारा संकेत कर रहे हैं एक हरे तीर द्वारा संकेत कर रहे हैं। ब्लू तीर nanorobot dimers संकेत दिया। (बी) agarose में बैंड के रिश्तेदार तीव्रता का 3 डी दृश्यजेल। (सी) यील्ड और शुद्धि अनुमानों।

चित्र तीन
चित्रा 3: कई fabrications / धुंधला प्रक्रियाओं से लिया डीएनए nanorobots के मंदिर तस्वीर।

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> कोर 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
संख्या पद अनुक्रम
1 कोर AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 कोर GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 कोर TACGATATAGATAATCGAACAACA
4 कोर CTTTTGCTTAAGCAATAAAGCGAGTआगा
5 कोर GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 कोर GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 कोर AAAATCACCGGAAGCAAACTCTGTAGCT
8 कोर CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 कोर CATGTAAAAAGGTAAAGTAATAAGAACG
10 कोर ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
1 1 कोर ATAGTCGTCTTTTGCGGTAATGCC
12 कोर AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 कोर AACTATTGACGGAAATTTGAGGGAATATAAA
14 कोर ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 कोर AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 कोर GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 कोर GCACCGCGACGACGCTAATGAACAGCTG
18 कोर AACTTCATTTTAGAATCGCAAATC
19 कोर CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 कोर CCAATCAAAGGCTTATCCGGTTGCTATT
21 कोर AGAGGCGATATAATCCTGATTCATCATA
22 कोर CCGTAATCCCTGAATAATAACGGAATACTACG
23 कोर AAATGGTATACAGGGCAAGGAAATC
24 कोर TCCTCATCGTAACCAAGACCGACA
25 कोर CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 कोर ACCCGCCCAATCATTCCTCTGTCC
27 कोर CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 कोर CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 कोर TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 कोर
31 कोर AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 कोर ACATTCAGATAGCGTCCAATATTCAGAA
33 कोर AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 कोर GAGATGACCCTAATGCCAGGCTATTTTT
35 कोर TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 कोर GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 कोर AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 कोर ACCAATCGATTAAATTGCGCCATTATTA घ>
39 कोर ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 कोर CCCTAAAAGAACCCAGTCACA
41 कोर GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 कोर CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 कोर TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 कोर TTCCTTATAGCAAGCAAATCAAATTTTA
45 कोर ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 कोर AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 कोर TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 कोर AAAGAAACAAGAGAAGATCCGGCT
50 कोर TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 कोर TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 कोर ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 कोर AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 कोर ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 कोर TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 कोर AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 कोर CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 कोर TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 कोर ATAACGCAATAGTAAAATGTTTAAATCA
60 कोर ACGAATCAACCTTCATCTTATACCGAGG
61 कोर TAATGGTTTGAAATACGCCAA
62 कोर CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 कोर ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 कोर AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 कोर AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 कोर GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 कोर TTTTAGAACATCCAATAAATCCAATAAC
69 कोर AAATGTGGTAGATGGCCCGCTTGGGCGC
70 कोर ACGGATCGTCACCCTCACGATCTAGAATTTT
71 कोर CGCCATAAGACGACGACAATAGCTGTCT
72 कोर GCGTATTAGTCTTTAATCGTAAGAATTTACए
73 कोर AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 कोर AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 कोर TAATTTAGAACGCGAGGCGTTAAGCCTT
76 कोर ACCAGGCGTGCATCATTAATTTTTTCAC
77 कोर CAGCCTGACGACAGATGTCGCCTGAAAT
78 कोर ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 कोर CTCGAATGCTCACTGGCGCAT
80 कोर GGGCAGTCACGACGTTGAATAATTAACAACC
81 कोर
82 कोर TCAACCCTCAGCGCCGAATATATTAAGAATA
83 कोर ATTATACGTGATAATACACATTATCATATCAGAGA
84 कोर GCAAATCTGCAACAGGAAAAATTGC
85 कोर ATAATTACTAGAAATTCTTAC
86 कोर TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 कोर AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 कोर CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 कोर TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 कोर AAATCAAAGAGAATAACATAACTGAACACAGT
92 कोर CTGTATGACAACTAGTGTCGA
93 कोर ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 कोर TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 कोर ATAAGAATAAACACCGCTCAA
96 कोर CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 कोर AACCGCCTCATAATTCGGCATAGCAGCA
98 कोर AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 कोर CAGTATAGCCTGTTTATCAACCCCATCC
100 कोर TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 कोर CGTCGGAAATGGGACCTGTCGGGGGAGA
102 कोर AAGAAACTAGAAGATTGCGCAACTAGGG
103 कोर CCAGAACCTGGCTCATTATACAATTACG
104 कोर ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 कोर CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 कोर GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 कोर ACATCGGAAATTATTTGCACGTAAAAGT
109 कोर CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 कोर AAATCGTACAGTACATAAATCAGATGAA
111 कोर TTAACACACAGGAACACTTGCCTGAGTATTTG
112 कोर AGGCATAAGAAGTTTTGCCAGACCCTGA
113 कोर GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 कोर AGCTGCTCGTTAATAAAACGAGAATACC
115 कोर CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 कोर CACCCTCTAATTAGCGTTTGCTACATAC
117 कोर GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 कोर GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 कोर ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 कोर GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 कोर GGCTTGCGACGTTGGGAAGAACAGATAC
122 कोर TAAATGCCTACTAATAGTAGTTTTCATT
123 कोर TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 कोर TGACCATAGCAAAAGGGAGAACAAC
125 कोर CGAGCCAGACGTTAATAATTTGTATCA
126 कोर GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 कोर AGACGCTACATCAAGAAAACACTTTGAA
128 कोर AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 कोर GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 कोर GGTATTAAGGAATCATTACCGAACGCTA
131 कोर GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 कोर
133 कोर ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 कोर AACGAGATCAGGATTAGAGAGCTTAATT
135 कोर TACCAAGTTATACTTCTGAATCACCAGA
136 कोर CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 कोर AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 कोर TTTCAACCAAGGCAAAGAATTTAGATAC
139 कोर TTGAAATTAAGATAGCTTAACTAT
140 कोर CTATTATCGAGCTTCAAAGCGTATGCAA
कोर CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 कोर GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 कोर CGAACGTTAACCACCACACCCCCAGAATTGAG
144 कोर GTGTGATAAATAAGTGAGAAT
145 कोर GCTATATAGCATTAACCCTCAGAGA
146 कोर AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 कोर CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 कोर CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 कोर
150 कोर ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 कोर ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 कोर TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 कोर AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 धार TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 धार TTTTTTTTTTTTTTTTAATAAGAGAATA
156 धार TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 धार
158 धार TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 धार TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 धार TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 धार TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 धार TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 धार TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 धार TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 धार TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 धार TTTTTTTTTTTTTTTACCGGATATTCA
167 धार TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 धार TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 धार CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 धार CAATGACAACAACCATTTTTTTTTTTTTTTT
171 धार TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 धार TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 धार
174 धार TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 धार TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 धार TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 धार CCACACAACATACGTTTTTTTTTTTTT
178 धार TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 धार TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 धार TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 धार TTTTTTTTTTTTTTTACGGCGGAT
182 धार TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 धार TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 धार TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 धार TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 धार TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 धार TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 धार ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 धार
190 धार TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 धार GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 धार GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 धार ATAACGTGCTTTTTTTTTTTTTTTTTT
194 धार TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 धार TTTTTTTTTTTTTTTACAAAATAAACA
196 धार TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 धार
198 धार TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 धार GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 धार TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 धार CACTAAAACACTTTTTTTTTTTTTTTT
202 धार TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 धार TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 धार TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 धार TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 धार TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 धार CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 धार TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 धार AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 धार ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 धार TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 धार TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 धार TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 धार TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 धार TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 धार TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 धार TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 धार AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 धार CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 धार TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 धार TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 धार TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 धार AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 धार CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 धार TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 धार TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 धार TTTTTTTTTTTTTCATCTTTGACCC
230 धार TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 धार GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 धार TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 धार GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 धार TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 धार TTTTTTTTTTTTTTTATAGCAATAGCT
236 हैंडल AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 हैंडल ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 हैंडल CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 हैंडल CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 हैंडल CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 हैंडल CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 हैंडल AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 हैंडल CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 हैंडल CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 हैंडल TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 हैंडल AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 हैंडल GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 गाइड AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 गाइड ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 गाइड CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 गाइड GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 गाइड AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 गाइड TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 गाइड TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 गाइड निकालना GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 गाइड निकालना GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 गाइड निकालना TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 गाइड निकालना AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 गाइड निकालना CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 गुईदेस निकालना GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 गाइड निकालना ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 गेट्स Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 गेट्स Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 गेट्स Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 गेट्स Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

तालिका 1: प्रधान दृश्यों की सूचीnanorobot निर्माण करने के लिए इस्तेमाल किया। स्टेपल्स 1-153 कोर नामित और संरचना के थोक बना रहे हैं। स्टेपल्स 154-235 किनारों नामित कर रहे हैं और संरचना के 61 helixes के सिरों में से प्रत्येक पर स्थित हैं। एज स्टेपल nanorobots के एकत्रीकरण से बचने के लिए बनाया गया एक पाली थाइमिन पूंछ होते हैं। स्टेपल्स 236-247 हैंडल नामित और कार्गो डॉकिंग साइटों को बनाने के कर रहे हैं। स्टेपल उनकी विशिष्ट संरचना के स्थान, और कार्गो अणुओं के लिए डॉकिंग साइट के रूप में प्रयोग किया जाता है, जो एक आम सहमति अनुक्रम क्षेत्र के लिए उन्हें जोड़ने, एक अद्वितीय अनुक्रम क्षेत्र है संभालती है। स्टेपल्स 248-254 गाइड नामित और annealing प्रक्रिया के दौरान डिवाइस के दो हिस्सों को संलग्न कर रहे हैं। निर्माण के बाद गाइड nanorobot के दो सेंसरों से बंद कर दिया डिवाइस छोड़ने गाइड हटाने स्टेपल 255-261 (चरण 6) के अलावा के साथ हटा रहे हैं। सेंसर दृश्यों गेट्स नामित कर रहे हैं। दो सेंसर से प्रत्येक एक PDGF aptamer और एक पूरक कतरा से बना है। एक अधिक विस्तृत expla के लिएराष्ट्र बेन-Ishay एट अल। 14 और डगलस एट अल। 15। स्टेपल्स तीन 96 अच्छी तरह प्लेटें (गहरी दौर नीचे) पर व्यावसायिक रूप से आदेश दिए हैं देखते हैं। प्रत्येक प्रधान राशि 10 nmol सामान्यीकृत है। एचपीएलसी शुद्धि की आवश्यकता होती है, जो गेट दृश्यों को छोड़कर, स्टेपल एक विशेष शोधन प्रक्रिया की आवश्यकता नहीं है।

Discussion

हम डीएनए nanorobot का निर्माण, शुद्धि, और दृश्य का वर्णन किया। डिवाइस का हेक्सागोनल चेसिस के निर्माण के बाद, nanorobot के समारोह में आसानी से उपलब्ध होने के कारण एक-एक कतरा डॉकिंग साइटों के साथ 14 हाइड्रोजन संबंध पूरकता के लिए उनके नामित स्थिति को खोजने के जो रोबोट के लिए विशिष्ट माल की सरल परिचय और संवेदन किस्में के साथ प्रोग्राम किया जाता है , 15,22।

वर्णित निर्माण प्रोटोकॉल आम तौर पर origami आकार की एक विस्तृत श्रृंखला गुना करने के लिए हमारी प्रयोगशाला में प्रयोग किया जाता है, जो एक धीमी annealing के लिए रैंप का उपयोग करता है। उत्पादन समय में इस तरह के Sobczak एट अल द्वारा वर्णित तेजी से तह प्रोटोकॉल के रूप में एक महत्वपूर्ण कारक अन्य प्रोटोकॉल, हो जाता है। 24 में इस्तेमाल किया जा सकता है। इस प्रोटोकॉल लेकिन यह प्रत्येक origami आकार के लिए अंशांकन की आवश्यकता है, उच्च पैदावार में origami तह को प्राप्त करने की सूचना दी है।

स्पिन निस्पंदन अतिरिक्त स्टेपल से रोबोट को शुद्ध करने के लिए प्रयोग किया जाता है। एस लोड हो रहा हैनमूने या बफर के साथ पिन स्तंभ, देखभाल विंदुक टिप के साथ झिल्ली को नुकसान नहीं लिया जाना चाहिए। झिल्ली संभावित नाटकीय रूप से कम पैदावार में जिसके परिणामस्वरूप टूटना कर सकते हैं। यह nanorobots उम्र से कल्पना कर रहे हैं जब तक प्रवाह के माध्यम से अलग नहीं करने की सलाह दी जाती है।

निश्चित आवेदन के लिए एक उच्च शुद्धि दर वांछित है; इस मूल स्पिन स्तंभ का उपयोग निस्पंदन दोहरा द्वारा प्राप्त किया जा सकता है। यहां तक ​​कि उच्च शुद्धता के लिए, एक नए स्पिन स्तंभ हालांकि इस उपज दर पर एक नाटकीय नकारात्मक प्रभाव पड़ेगा, इस्तेमाल किया जा सकता है। सफ़ाई डीएनए origami संरचनाओं के लिए अन्य तरीकों जैसे वैद्युतकणसंचलन और अतिरिक्त स्टेपल के डायलिसिस के लिए बाद में agarose जेल से छांटना के रूप में परीक्षण किया गया। इन विधियों गरीब उपज या वर्णित प्रोटोकॉल के साथ तुलना में गरीब शुद्धि दरों या तो में हुई। ऐसे खूंटी-आधारित शुद्धि 25 और दर-जोनल ultracentrifugation 26 के रूप में अन्य तरीकों, परीक्षण नहीं किया गया। इन विधियों achi को रिपोर्ट कर रहे हैंपूर्व संध्या उच्च शुद्धि दरों, लेकिन वे गरीब पैदावार (दर-जोनल ultracentrifugation) में परिणाम या संभावित खोखला nanorobot आकार नुकसान पहुँचा सकते हैं (खूंटी-आधारित) वर्षा की आवश्यकता होती है या तो।

Nanorobots निर्माण yeilds 15 को बढ़ाने के लिए बंद की स्थिति में आकार ताला जो गाइड स्टेपल के साथ निर्मित कर रहे हैं। यह (वर्णित प्रोटोकॉल में PDGF) बनाया उत्तेजनाओं के जवाब में प्रभावी रूप से खुला nanorobots करने के लिए गाइड हटाने स्टेपल जोड़कर इन स्टेपल दूर करने के लिए महत्वपूर्ण है। अतिरिक्त की शुद्धि के अंत में एक दाढ़ अनुपात: गाइड स्टेपल 18 ये स्टेपल एक 10 पर जोड़ा जाना चाहिए कतरा विस्थापन की एक प्रक्रिया के माध्यम से गाइड स्टेपल जो रिलीज गाइड हटाने स्टेपल की डॉकिंग के लिए एक toehold भी कतरा क्षेत्र के साथ तैयार कर रहे हैं स्टेपल 'मंच (कदम 4.7) और अंत प्रकार के बरतन के ऊपर एक छोर पर कमरे के तापमान पर 2 घंटे के लिए incubated।

मंदिर से दृश्य, includi में वर्णित किया गयाएनजी uranyl-स्वरूप 2% नकारात्मक धुंधला। Uranyl एसीटेट के साथ तुलना में, uranyl-स्वरूप डीएनए origami डिजाइन की बेहतर समाधान के लिए अनुमति देते हैं जो महीन अनाज संरचनाओं पैदा करता है। देखभाल aliquots के समय की लंबी अवधि के लिए जमे हुए हैं, तो स्थिर करना होगा uranyl-स्वरूप के रूप में लिया जाना चाहिए। यह धुंधला के लिए एक नया तैयार 2% uranyl-स्वरूप समाधान का उपयोग करने की सलाह दी जाती है। बेहतर संकल्प क्रायो मंदिर 27 के उपयोग के साथ प्राप्त कर रहे हैं।

डीएनए nanorobot के बुनियादी वास्तुशिल्प डिजाइन और निर्माण प्रोटोकॉल अंततः वर्दी और सीधा कर रहे हैं। हालांकि, लचीलापन की एक विस्तृत श्रृंखला विशिष्ट माल के मिश्रण और संवेदन किस्में के रूप में की पेशकश की है। इसके अलावा, एक एकल जनसंख्या में कई उपप्रकार पेश किया जा सकता है और उनके रिश्तेदार stoichiometry प्रोग्राम और विशिष्ट जरूरतों को फिट करने के लिए अनुकूलित। प्रत्येक दर सीमित कदम पर विशिष्ट कैनेटीक्स का भी अधिक ठीक ट्यूनिंग डबल कतरा संकरण या की लंबाई कम करने / बढ़ाने के साथ प्राप्त हैविशिष्ट महत्वपूर्ण पदों पर बेमेल की शुरूआत। निर्माण में आसानी के साथ लचीलापन के इस उच्च स्तर एक जैविक प्रासंगिक परिवेश में अत्यधिक विविध जटिल कार्य प्रदर्शन करने में सक्षम nanoscale उपकरणों के इंजीनियरिंग के लिए अनुमति देता है।

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

लेखकों अत्यंत मूल्यवान विचार विमर्श और सलाह है, और उपयोगी विचार विमर्श और काम के लिए Bachelet प्रयोगशाला के सभी सदस्यों के लिए एस डगलस का शुक्रिया अदा करना चाहते हैं। इस काम के बार-इलान विश्वविद्यालय में जीवन विज्ञान के संकाय और नैनो और उन्नत सामग्री के संस्थान से अनुदान द्वारा समर्थित है।

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics