DNA 접기에서 바이오 응답 로봇의 폴딩 및 특성화

Chemistry
 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

DNA의 나노 로봇은 내부 압수 특정 자극과 현재화물에 대한 응답으로 열 수 있도록 설계 중공 육각형 나노 장치이다. 모두 자극 및화물 특정 필요에 따라 맞출 수 있습니다. 여기에서 우리는 DNA 종이 접기 기술을 이용하여, DNA의 나노 로봇 제조 프로토콜을 설명합니다. 절차는 폴딩 완충액의 존재하에 긴 원형의 단일 가닥 DNA 골격에 첨가 스톡 혼합물에 짧은 단일 가닥 DNA 스테이플을 혼합함으로써 개시한다. 표준 열 사이 클러 서서히 나노 로봇의 폴딩 뒤에 안내 힘 스테이플 간 지지체 소둔을 용이하게하기 위해 혼합 반응 온도를 낮추기 위해 프로그래밍된다. 60 시간 폴딩 반응이 완료되면, 과량의 스테이플은 아가 로스 겔 전기 영동 (AGE)을 통해 가시화 하였다 원심 필터를 이용하여 폐기된다. 마지막으로, 나노 로봇의 성공적인 제조는 (TEM) 투과 전자 현미경에 의해 확인되고,부정적인 얼룩 등의 우라 닐 - 메이트의 사용과.

Introduction

핵산 나노 기술의 사용은 놀라운 있습니다. 왓슨 - 크릭 염기 쌍의 취급 용이성뿐만 아니라 주문품 올리고 2의 대규모 합성의 용이성 및 상대적 저비용 DNA 나노 기술의 분야에서 응용 프로그램 (3)의 폭발 및 연구를 생성했다. 기본적인 빌딩 블록으로 움직이지 시먼 접합 4,5에 기반 구조의 DNA 나노 기술은 임의의 모양 6-8의 건설을위한 자기 조립 초 단위로 DNA를 사용합니다.

스캐 폴딩 DNA 종이 접기 (9) 기술의 최근 개발은 나노 미터 이하의 정밀도와 복잡한 2D / 3D 나노 구조 10-12의 건설을 허용하고 증가하는 복잡성과 놀라운 다양성과 새로운 기능 객체를 구축하기위한 효율적인 경로입니다. 건조 공정이 긴 골격 단일 가닥 DNA에 기초하고, 일반적으로 바이러스로부터 유래 genom짧은 단일 가닥 DNA를 올리고 수백의 교잡을 통해 접을 수있는 전자는 스테이플 불린다. 제조의 재현성을 달성 할 수있는 최대의 수소 결합 상보성을 용이하게하기 위해 짧은 단일 가닥 스테이플 서열 원단의 결과 동안이 기술에 의해 얻어진 높은 구조적 해상도, DNA 이중 나선의 천연 치수의 직접적인 결과이다. 느린 어닐링 온도를 사용하여 열역학적으로 바람직한 나노 구조물을 고 수율 및 정확도에 도달 할 때 설계는 낮은 에너지를, 램프. 컴퓨터 코드의 접합부 설계 규칙의 구현은 매우 쉽게 연결 접합부 수백 함유 크고 복잡한 구조물을 설계하는 등의 작업을 단순화 caDNAno 13 CAD 도구의 개발을 활성화.

우리는 이전에 caDNAno 공구 14,15의 도움으로 DNA의 나노 로봇의 디자인을 설명했다. 여기에 우리가 제작을 묘사하고투과 전자 현미경 (TEM)을 통해 시각화의 차원 나노 로봇, 3 차원 중공 육방 나노 소자의 소정의 자극과 본 구체적인화물에 응답 주요 형태 변화를 겪게하도록 설계된 35 X 35 X 50 내지 3, 이러한 단백질 또는 핵산으로 올리고, 안쪽 압수. 로딩 스테이션 (12)은 중공 내부 섀시 사용할 수 있지만, 바인딩화물의 실제 수는화물의 크기와 다르다. 화물 분자는 작은 DNA 분자에서 효소, 항체 및 5 ~ 10 nm의 금 나노 입자에 이르기까지 다양합니다. 각각의 나노 로봇은 다른 분자의 혼합물을 함유하도록, 균일 또는 불균일 될 Cargocan 하나. 감지는 aptasensor 16, 17 또는 DNA 가닥 변위 (18) 기술 중 하나, 단백질, 핵산 또는 다른 화학 물질을 감지하는 두 개의 더블 헬리컬 잠금 게이트 디자인을 통해 달성을 기반으로합니다. 앱 타머 선택 프로토콜 19-21에서 최근의 발전 응답 나노 로봇의 디자인을 사용분자 및 세포 유형의 범위도 증가한다.

초기 연구는 항원에 결합하는 억제 성 또는 혼합 된 세포 집단 (15)의 특정 세포 유형의 내부에 다작 신호를 릴레이 할 때 특이 적 항체를 운반 나노 로봇을 보였다. 이러한 나노의 흥미로운 기능은 하나의 집단에서 서로 다른 나노 로봇 하위 유형의 도입으로 더욱 복잡한 작업 및 로직 제어를 수행 할 수있는 능력이다. 최근에 우리는 활성화물 분자 (22)를 포함하는 이펙터 인구를 제어, 양 또는 음의 규제 중 하나로 수행하는 나노 로봇의 특정 아형을 보여 주었다.

여기에 제시된 프로토콜은 나노 로봇 15, 22의 개방을 용이하게하기 위해 선택적으로 결합 PDGF 앱 타머 센서 서열 게이팅 나노 로봇의 제조, 정제 및 이미지를 설명한다. 설명 된 제조 공정과 유사한 N정제 수율 및 속도를 증가시키면서 anorobot 제작 공정은 먼저, 더글라스 외. 전체 공정 시간을 줄이기위한 변화 (15)에 의해 도시.

Protocol

스테이플 풀 혼합물 1. 준비

  1. 표 1에 열거 된 96 웰 플레이트에 주문 동결 건조 된 DNA 나노 로봇 스테이플 (자료 참조) 10 nmol의 정상화. DNA의 나노 로봇의 설계 및 아키텍처에 대한 자세한 설명은 벤 Ishay 등. (14)와 더글라스 등의 알을 참조하십시오. 15).
  2. 100 μM의 농도로 각 주식 잘와 DNase의 /의 RNase없는 초순수를 복원합니다. 스테이플 10 nmol의 정규화를 들어, 초순수 100 ㎕로 재구성한다.
  3. 풀 멀티 채널 피펫과 멸균 55 ㎖의 솔루션 유역을 사용하여 각 단의 함께 20 μL.
    참고 : 나노 로봇 모양, 스테이플 풀의 스테이플 각각의 농도 (코어, 가장자리, 핸들 및 가이드 서열 표 1 포함) 254 스테이플 가닥으로 구성되어 있기 때문에 394 ㎚이다. 스테이플 풀에서 스테이플을 제거, 또는 다른 권에 몇 가지를 추가을 메 상당히 수율을 감소 시키거나 그렇지 않으면 펼쳐진 집계 될 수 있습니다.

제조 된 반응 혼합물의 제조 (2)

  1. 표준 반응 혼합물은 (자료 참조, 100 nm의 원액) 발판 DNA의 4 pmol의에 해당하는 M13mp18 바이러스 게놈 원형의 단일 가닥 DNA의 40 μl를 사용합니다. 제조 혼합물에 비계의 최종 농도는 20 nM의 최종 볼륨 200 μl를합니다.
    1. 특정 요구에 따라, 골격 DNA의 양을 조절; 그러나, 20 nm에서 일정한 반응 혼합물에 DNA 골격의 최종 농도를 유지한다.
  2. 각각 1-10의 스테이플 비율 발판에 도달 스테이플을 추가합니다. 20 ㎚ 골격 DNA 농도를 들어, 스테이플 (254) '의 최종 농도는 각각 200 ㎚이다. 200 μl의 최종 반응 볼륨에 대한 스테이플 풀 혼합물 (1.2 절)의 102 μl를 추가합니다.
    1. 토륨 별도로 특정 게이트 시퀀스를 추가이때 E 폴딩 반응 혼합물. 이러한 올리고 별도로 주문 및 HPLC 정제를 필요로한다. 20 나노 지지체의 농도에 대한 각 올리고의 즉, 200 nm의, 게이트 올리고는 1:10 발판 게이트에 시퀀스 비율에 있는지 확인합니다. 200 μL 접는 반응 부피를 들어, 100 μm의 재고 농도에있는 4 개의 게이트 올리고 각 0.4 μl를 추가합니다.
  3. 1X TAE (40 mM 트리스 - 아세테이트, 1mM의 EDTA)의 최종 농도에 도달하는 10 배 스톡 TAE 버퍼를 추가한다. 200 μL 접는 반응 볼륨의 경우, 10 배 TAE의 20 μl를 추가합니다.
  4. 10 mM의 최종 농도는 1 M의 MgCl 2를 추가한다. 200 μL 접는 반응 볼륨의 경우, 1 M의 MgCl 2의 2 μl를 추가합니다.
  5. 200 μL의 최종 볼륨에 도달에 DNase의 /의 RNase 무료 초순수의 36 μl를 추가합니다.
  6. PCR 튜브에 소용돌이와 나누어지는 100 μL 샘플.
    참고 : 사용할 수있는 최대 반응 볼륨에 대한 열 자전거 타는 사람 사양을 참조하십시오.이러한 제한 사항을 충족하기 위해 볼륨을 줄이면 얻어진 수율을 감소하지 않습니다. 수율을 위태롭게 지정된 최대 상기 반응 볼륨.

제조 반응의 3 어닐링 온도 경사로

  1. 프로그램 열 자전거 타는 사람은 다음과 같습니다 :
    1. 5 분 / ° C의 속도로 60 ° C에 85 ° C를 램프.
    2. 램프 60 ℃ 75 분 / ° C의 속도로 4 ° C까지.
    3. 무기한 4 ° C에서 잡으십시오.
  2. 후 제조는 -20 ° C에서 저장 샘플을 종료되었습니다.

초과 스테이플 4. 제거

  1. 100 kDa의의 MWCO와 0.5 ml의 원심 필터에 접는 반응 혼합물을 100 μl를 추가합니다. 나중에 분석을위한 나노 로봇 사전 정화의 10 μL 샘플을 저장합니다.
  2. 9,600 X g에서 10 분 동안 원심 분리기.
  3. 접는 버퍼 400 μL (1X TAE, 10 밀리미터의 MgCl 2)를 추가합니다.
  4. 반복 두 번 더 4.2 및 4.3 단계를 반복합니다.
  5. 9,600 X g에서 5 분 동안 원심 분리기.
  6. 9,600 × g으로 1 분간 클린 microcentrifuge 관과 스핀 거꾸로 필터를 배치하여 농축 물을 회수. 최종 부피는 필터에 넣고 제조 반응 혼합물의 초기 양에 따라 변할 수있다. 전형적으로 농축 된 나노 로봇 샘플 25-60 ㎕의 최종 부피를 얻을 수있다.
  7. 260 nm에서 분광 광도계를 통해 시료에서 DNA의 농도를 측정한다. 나노 로봇 샘플의 몰 농도를 계산할 때 5.3 μg의 / pmol의 분자량을 사용합니다.
    참고 : dsDNA의 몰 흡광 계수, 50 μg의 / OD (260)는, 대부분의 응용 프로그램에 충분합니다. 48 μg의 / OD (260)는 가장자리 스테이플에서 계정에 ssDNA를 뻗어 폴리 티민 걸립니다.

접이식 나노 로봇 5. 아가로 오스 젤 전기 영동 분석

  1. 0.5X TBE에 (45 mM 트리스 - 보레이트, 1 mM의 EDTA), 2 % 아가 로즈 겔의 제조 된 10 mM의 MgCl 2 보충 등의 알에서 적응 21.) :
    1. DDH 2 O의 118.75 ml의 10 배 TBE 스톡 버퍼의 6.25 mL로 희석하여 0.5 배의 TBE 버퍼를 준비
    2. 0.5 배의 TBE 버퍼의 125 ㎖에 아가로 오스의 2.5 g을 녹인다.
    3. 아가로 오스가 완전히 녹을 때까지 마이크로파에 끓인다.
    4. 10 mm의 최종 농도 1 M의 MgCl 2의 1.25 ML을 추가합니다.
    5. 10 mg을 7 μl를 추가 / ㎖ 에티 디움 브로마이드.
    6. 약간 냉각 솔루션을 기다린 아가 로스 젤 응고 전에 젤 트레이를 입력합니다. 즉시 원하는 빗를 설치합니다.
    7. DDH 2 O의 940 ml의 0.5 배의 TBE의 MgCl 2 배 TBE 스톡 버퍼 50 ㎖와 1 M 10 ㎖를 추가하여 버퍼를 실행 한 L 준비
    8. 겔을 빙욕에서 전기 영동 장치에 넣어 버퍼 장치를 실행 고체가 추가되면.
  2. 비계와 함께 나노 로봇 사전 정화의 부하 1 μg의 전체 DNA (3.2 단계), 사후 정화 (단계 4.7),DNA 샘플 겔 상 1킬로바이트의 DNA 마커. 예를 그림 2에 제시되어있다. 샘플의 실제 볼륨은 정제 후의 농도에 따라 달라집니다. (6) 최종 부피 비율 : 각각의 샘플은 1에서 로딩 완충액으로 로딩된다.
  3. 80 V에 전원을 설정하고 3 시간 동안 젤을 실행합니다. 얼음과 물이 가득 욕조에 젤을 실행합니다. 나노 로봇이 전개와 아가로 오스 겔 전기 영동 동안 가열하면 얼룩으로 표시됩니다. 전기 영동 동안 가열에서 장치를 유지하기 위해 추가로 얼음을 추가합니다.
  4. 자외선 테이블에보기 젤 (그림 2).

우라 닐 - 메이트와 나노 로봇의 6 부정적 얼룩

  1. 2 % 우라 닐 - 메이트 원액의 제조 (카스트로 등의 알에서 적응 23.) :
    1. 15 ML 튜브에 우라 닐 - 메이트 분말 100 mg의 무게.
    2. 3 분 동안 삶아의 DNase /의 RNase 무료 초순수는 탈 산소 물을 수 있습니다.
    3. 환원 된 뜨거운 물 5 mL를 추가 (~ 60 ° C)(이전 단계) 우라 닐 포르 메이트를 함유하는 분말을 15 ㎖의 튜브에. 단단히 가까운 뚜껑, (소용돌이에 고정시킵니다 튜브) 엄격하게 10 분 동안 알루미늄 호일과 소용돌이에서 랩. 솔루션 노란색 컬러와 함께 혼탁 나타납니다.
    4. 0.2 μm의 주사기 여과한다을 통해 필터 솔루션입니다. 해결 방법은 명확하게해야한다.
    5. 분취 액을 마이크로 원심 튜브에 용액 200 μL.
    6. 튜브의 하단에 풀 샘플 테이블 탑 원심 분리기에서 5 분 동안 최대 속도로 원심 분리기.
  2. 그리드 및 음의 염색에 샘플의로드 :
    1. 2 % 우라 닐 - 메이트 용액 (6.1 절에서 제조)의 200 μL 나누어지는 해동. 3 분 동안 엄격 0.5 M NaOH 용액과 소용돌이의 10 μl를 추가합니다. 테이블 탑 원심 분리기를 이용하여 5 분 동안 최대 속도로 원심 분리기.
    2. 한편, 글로우 방전 그리드는 0.2 mbar에서 실내 공기를 사용하여 25mA 30 초.
    3. 정화 후 2 나노 미터 나노 로봇 샘플의 15 μl를 추가합니다 (섹션에 ì그리드의 위쪽 상 4.7)에 (집게 개최) 1 분 동안 흡수 할 수 있습니다. 여과지 위에 그리드를 배치하여 여분의 액체를 배출 여과지를 사용합니다. 그리드 표면을 만지지 마십시오.
    4. 그리드의 위쪽에 (단계 6.2.1에서) 2 % 우라 닐 - 메이트의 10 μl를 추가 (집게 개최).
    5. 신속 여과지 위에 그리드를 배치하여 여분의 액체를 배출 여과지를 사용합니다. 그리드 표면을 만지지 마십시오.
    6. 반복 6.2.4와 6.2.5 단계를 반복합니다.
    7. 그리드의 위쪽에 (단계 6.2.1에서) 2 % 우라 닐 - 메이트의 10 μl를 추가 (집게 개최). 염색 용액을 30 초 동안 흡수 보자.
    8. 여과지 위에 그리드를 배치하여 여분의 액체를 배출 여과지를 사용합니다. 그리드 표면을 만지지 마십시오.
    9. 그리드, 적어도 30 분 동안 완전히 건조 TEM에 주입하기 전에, 필터 종이에까지 직면하자.

Representative Results

대표적인 결과는도 2a에 도시된다. 모든 차선은 분광 광도계 (OD 260)를 통해 측정 된 총 DNA의 1 μg의가 포함되어 있습니다. 원형의 단일 가닥 DNA의 골격 (레인 2)과 비교하여, 나노 로봇이 그들의 높은 분자량 겔에 방해된다, 발판의 DNA에 스테이플 하이브리드의 결과 (레인 3 빨간색 화살표). 레인 3의 저 분자량 밴드는 발판의 DNA (녹색 화살표)에 결합하지 않은 초과 스테이플을 나타냅니다. 원심 여과를 통해 정화 한 후 초과 스테이플의 대부분은 (레인 4-6) 제거하고, 나노 로봇은 핸들 보완 가닥 14,15,22에 복합화물 분자와로드 할 준비가 된 것입니다. 레인 4-6 나노 로봇의 이량 체 (파란색 화살표), 함께 결합 나노 로봇의 인구를 대표하는 고 분자량의 밴드가 포함되어 있습니다. 잠재적 redu (5 또는 10 중 nm의) 제조 과정에서 비계의 농도를 수 감소이러한 고분자 구조의 상대적인 양 세륨. 설명 정화 프로토콜에 약간의 차이와 사후 정화 레인 4-6 쇼 나노 로봇 즉 제조 된 나노 로봇의 초기 볼륨이 스핀 필터 (4.1 단계에 추가 레인 4 :. 50 μl를, 레인 5 : 100 μL, 레인 6 : 100 μL), 및 버퍼가 필터에 첨가 횟수 (단계 4.4 레인 4 : 2 회; 레인 5 :. 2 회; 레인 6 : 5 회).

프로토콜 (도 2c)에 대한 다른 유사 사이 수율 및 정제의 결과의 비교는 원심 필터에게로드 제조 로봇 (4.1 공정)의 초기 양을 줄이는 것이 수율 및 정제 속도에 거의 영향을 보여준다. 수율을 상당히 감소시키면서 또한, 완충액을 교환하고 원심 스핀 (단계 4.4)에 나노 로봇 순도에 영향을 미치는 한계의 수를 증가시킨다. 따라서 설명한 프로토콜은 100 μL에 대응초기 볼륨과 2 버퍼 추가 (레인 5), 최적의 간주됩니다.

수익률 추정은 분광 광도계 (OD 260) 각 샘플 후 정화의 측정에 기초하여 각각의 원심 필터에로드 된 초기 금액을 기준으로 계산됩니다. 정제는 정제 중에 세척하지 않았다 나노 로봇 과잉 스테이플에 대응하는 샘플 DNA로부터 전체 나노 로봇의 중량 %에 기초한다. 정화 추정은 초과 스테이플의 그것과 나노 로봇 (그림 2A 빨간색과 파란색 화살표) (그림 2B에서 녹색 화살표)의 상대 강도로부터 계산된다. 상대 나노 로봇 / 스테이플 강도는 ~ 스테이플 (초록색 화살표)의 전체 DNA의 중량 인 정제 전 샘플 (레인 3), 정규화 된 초기 대응 미정 나노 로봇 (적색 화살표)의 4.5 배 10 : 1 발판제조 프로토콜에 스테이플 몰비.

구조적 무결성의 검증은 최종 음극 얼룩으로 2 % 우라 닐 포르 메이트를 사용하여, 투과형 전자 현미경을 통해 달성된다. 사진은 그림 3에 제시되어있다.

그림 1
그림 1 : 나노 로봇의 설계도를 디자인 폐쇄 나노 로봇의 (A)의 측면보기.. 앱 타머 서열과 상보적인 가닥에 의해 생성 된 게이트 이중 나선은 녹색 화살표로 표시됩니다. (B) 내부 결합 단백질화물을 보여주는 폐쇄 나노 로봇의 전면 뷰입니다. (C) 생산 폐쇄 나노 로봇의 단면 개략도. 처리 스테이플은 빨간색 화살표로 강조 표시됩니다. 녹색 동그라미 일측에 힌지와 반대측 게이트 시퀀스를 포함 나선을 나타낸다. 의 (D) 청사진사이드 뷰에서 나노 로봇. 핸들은 빨간색 화살표로 표시됩니다. 게이트 시퀀스는 녹색 화살표로 표시됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2. 아가로 스겔 전기 영동 결과 (A) 레인 1 : 마커 1킬로바이트. 레인 2 : M13mp18 원형의 단일 가닥 발판. 레인 3 : 나노 로봇 전처리 정제. 레인 4-6 : 나노 로봇은 정제를 게시 할 수 있습니다. 레인 4 : 50 μL 초기 볼륨을; 2 버퍼 추가. 레인 5 : 100 μL 초기 볼륨을; 2 버퍼 추가. 레인 6 : 100 μL 초기 볼륨을; 5 버퍼 추가. 초과 스테이플를 제조 나노 로봇은 빨간색 화살표로 표시됩니다 녹색 화살표로 표시됩니다. 파란색 화살표는 나노 로봇의 이량 체를 지적했다. (B), 아가 로스에 밴드의 상대 강도의 3D 뷰젤라틴. (C)을 수득하고 정제 추정.

그림 3
그림 3 : 여러 날조 / 염색 절차에서 찍은 DNA의 나노 로봇의 TEM 사진.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> 코어 (141) 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
번호 지정 순서
1 핵심 AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
(2) 핵심 GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 핵심 TACGATATAGATAATCGAACAACA
4 핵심 CTTTTGCTTAAGCAATAAAGCGAGTAGA
(5) 핵심 GTCTGAAATAACATCGGTACGGCCGCGCACGG
(6) 핵심 GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 핵심 AAAATCACCGGAAGCAAACTCTGTAGCT
8 핵심 CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 핵심 CATGTAAAAAGGTAAAGTAATAAGAACG
(10) 핵심 ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
(11) 핵심 ATAGTCGTCTTTTGCGGTAATGCC
(12) 핵심 AGTCATGGTCATAGCTGAACTCACTGCCAGT
(13) 핵심 AACTATTGACGGAAATTTGAGGGAATATAAA
(14) 핵심 ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
(15) 핵심 AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
(16) 핵심 GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
(17) 핵심 GCACCGCGACGACGCTAATGAACAGCTG
(18) 핵심 AACTTCATTTTAGAATCGCAAATC
(19) 핵심 CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
(20) 핵심 CCAATCAAAGGCTTATCCGGTTGCTATT
(21) 핵심 AGAGGCGATATAATCCTGATTCATCATA
(22) 핵심 CCGTAATCCCTGAATAATAACGGAATACTACG
(23) 핵심 AAATGGTATACAGGGCAAGGAAATC
(24) 핵심 TCCTCATCGTAACCAAGACCGACA
(25) 핵심 CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
(26) 핵심 ACCCGCCCAATCATTCCTCTGTCC
(27) 핵심 CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
(28) 핵심 CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
(29) 핵심 TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
(30) 핵심
(31) 핵심 AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
(32) 핵심 ACATTCAGATAGCGTCCAATATTCAGAA
(33) 핵심 AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
(34) 핵심 GAGATGACCCTAATGCCAGGCTATTTTT
(35) 핵심 TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
(36) 핵심 GCCGAAAAATCTAAAGCCAATCAAGGAAATA
(37) 핵심 AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
(38) 핵심 ACCAATCGATTAAATTGCGCCATTATTA D>
(39) 핵심 ATCTTACTTATTTTCAGCGCCGACAGGATTCA
(40) 핵심 CCCTAAAAGAACCCAGTCACA
(41) 핵심 GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
(42) 핵심 CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
(43) 핵심 TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
(44) 핵심 TTCCTTATAGCAAGCAAATCAAATTTTA
(45) 핵심 ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
(46) 핵심 AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
(48) 핵심 TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 핵심 AAAGAAACAAGAGAAGATCCGGCT
(50) 핵심 TTGAGGGTTCTGGTCAGGCTGTATAAGC
(51) 핵심 TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
(52) 핵심 ACGAGCGCCCAATCCAAATAAAATTGAGCACC
(53) 핵심 AATAAGTCGAAGCCCAATAATTATTTATTCTT
(54) 핵심 ACGAAATATCATAGATTAAGAAACAATGGAACTGA
(55) 핵심 TTTCATAGTTGTACCGTAACACTGGGGTTTT
(56) 핵심 AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
(57) 핵심 CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
(58) 핵심 TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 핵심 ATAACGCAATAGTAAAATGTTTAAATCA
(60) 핵심 ACGAATCAACCTTCATCTTATACCGAGG
(61) 핵심 TAATGGTTTGAAATACGCCAA
(62) 핵심 CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
(63) 핵심 ATTAAAGGTGAATTATCAAAGGGCACCACGG
(64) GGCAACCCATAGCGTAAGCAGCGACCATTAA
(65) 핵심 AGAAACGTAAGCAGCCACAAGGAAACGATCTT
(66) 핵심 AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 핵심 GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
(68) 핵심 TTTTAGAACATCCAATAAATCCAATAAC
69 핵심 AAATGTGGTAGATGGCCCGCTTGGGCGC
(70) 핵심 ACGGATCGTCACCCTCACGATCTAGAATTTT
(71) 핵심 CGCCATAAGACGACGACAATAGCTGTCT
(72) 핵심 GCGTATTAGTCTTTAATCGTAAGAATTTAC에이
73 핵심 AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
(74) 핵심 AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
(75) 핵심 TAATTTAGAACGCGAGGCGTTAAGCCTT
(76) 핵심 ACCAGGCGTGCATCATTAATTTTTTCAC
77 핵심 CAGCCTGACGACAGATGTCGCCTGAAAT
(78) 핵심 ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 핵심 CTCGAATGCTCACTGGCGCAT
(80) 핵심 GGGCAGTCACGACGTTGAATAATTAACAACC
(81) 핵심
(82) 핵심 TCAACCCTCAGCGCCGAATATATTAAGAATA
(83) 핵심 ATTATACGTGATAATACACATTATCATATCAGAGA
(84) 핵심 GCAAATCTGCAACAGGAAAAATTGC
(85) 핵심 ATAATTACTAGAAATTCTTAC
(86) 핵심 TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 핵심 AAGTAGGGTTAACGCGCTGCCAGCTGCA
(88) 핵심 CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 핵심 TGGCGAAGTTGGGACTTTCCG
(90) CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
(91) 핵심 AAATCAAAGAGAATAACATAACTGAACACAGT
(92) 핵심 CTGTATGACAACTAGTGTCGA
93 핵심 ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
(94) 핵심 TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
(95) 핵심 ATAAGAATAAACACCGCTCAA
(96) 핵심 CGTTGTAATTCACCTTCTGACAAGTATTTTAA
(97) 핵심 AACCGCCTCATAATTCGGCATAGCAGCA
(98) 핵심 AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
(99) 핵심 CAGTATAGCCTGTTTATCAACCCCATCC
(100) 핵심 TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
(101) 핵심 CGTCGGAAATGGGACCTGTCGGGGGAGA
(102) 핵심 AAGAAACTAGAAGATTGCGCAACTAGGG
(103) 핵심 CCAGAACCTGGCTCATTATACAATTACG
(104) 핵심 ACGGGTAATAAATTAAGGAATTGCGAATAGTA
(105) 핵심 CCACGCTGGCCGATTCAAACTATCGGCCCGCT
(106) 핵심 GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
(107) CAGCATTAAAGACAACCGTCAAAAATCA
(108) 핵심 ACATCGGAAATTATTTGCACGTAAAAGT
(109) 핵심 CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
(110) 핵심 AAATCGTACAGTACATAAATCAGATGAA
(111) 핵심 TTAACACACAGGAACACTTGCCTGAGTATTTG
(112) 핵심 AGGCATAAGAAGTTTTGCCAGACCCTGA
(113) 핵심 GACGACATTCACCAGAGATTAAAGCCTATTAACCA
(114) 핵심 AGCTGCTCGTTAATAAAACGAGAATACC
(115) 핵심 CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
(116) 핵심 CACCCTCTAATTAGCGTTTGCTACATAC
117 핵심 GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
(118) 핵심 GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 핵심 ATGAAACAATTGAGAAGGAAACCGAGGATAGA
(120) 핵심 GGATGTGAAATTGTTATGGGGTGCACAGTAT
(121) 핵심 GGCTTGCGACGTTGGGAAGAACAGATAC
(122) 핵심 TAAATGCCTACTAATAGTAGTTTTCATT
(123) 핵심 TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
(124) 핵심 TGACCATAGCAAAAGGGAGAACAAC
(125) 핵심 CGAGCCAGACGTTAATAATTTGTATCA
(126) 핵심 GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 핵심 AGACGCTACATCAAGAAAACACTTTGAA
(128) 핵심 AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 핵심 GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
(130) 핵심 GGTATTAAGGAATCATTACCGAACGCTA
(131) 핵심 GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
(132) 핵심
(133) 핵심 ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
(134) 핵심 AACGAGATCAGGATTAGAGAGCTTAATT
(135) 핵심 TACCAAGTTATACTTCTGAATCACCAGA
(136) 핵심 CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 핵심 AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
(138) 핵심 TTTCAACCAAGGCAAAGAATTTAGATAC
139 핵심 TTGAAATTAAGATAGCTTAACTAT
(140) 핵심 CTATTATCGAGCTTCAAAGCGTATGCAA
핵심 CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
(142) 핵심 GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 핵심 CGAACGTTAACCACCACACCCCCAGAATTGAG
(144) 핵심 GTGTGATAAATAAGTGAGAAT
(145) 핵심 GCTATATAGCATTAACCCTCAGAGA
(146) 핵심 AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 핵심 CGGCCTCCAGCCAGAGGGCGAGCCCCAA
(148) 핵심 CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 핵심
(150) 핵심 ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
(151) 핵심 ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
(152) 핵심 TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
(153) 핵심 AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
(154) 가장자리 TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
(155) 가장자리 TTTTTTTTTTTTTTTTAATAAGAGAATA
(156) 가장자리 TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 가장자리
(158) 가장자리 TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 가장자리 TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
(160) 가장자리 TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
(161) 가장자리 TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
(162) 가장자리 TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
(163) 가장자리 TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
(164) 가장자리 TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
(165) 가장자리 TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
(166) 가장자리 TTTTTTTTTTTTTTTACCGGATATTCA
167 가장자리 TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
(168) 가장자리 TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 가장자리 CTGAGAGAGTTGTTTTTTTTTTTTTTT
(170) 가장자리 CAATGACAACAACCATTTTTTTTTTTTTTTT
(171) 가장자리 TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
(172) 가장자리 TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 가장자리
(174) 가장자리 TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
(175) 가장자리 TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
(176) 가장자리 TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 가장자리 CCACACAACATACGTTTTTTTTTTTTT
178 가장자리 TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 가장자리 TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
(180) 가장자리 TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 가장자리 TTTTTTTTTTTTTTTACGGCGGAT
(182) 가장자리 TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 가장자리 TTTTTTTTTTTTTTTACGATTGGCCTTGATA
(184) 가장자리 TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 가장자리 TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
(186) 가장자리 TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 가장자리 TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 가장자리 ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 가장자리
(190) 가장자리 TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
(191) 가장자리 GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
(192) 가장자리 GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 가장자리 ATAACGTGCTTTTTTTTTTTTTTTTTT
(194) 가장자리 TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
(195) 가장자리 TTTTTTTTTTTTTTTACAAAATAAACA
(196) 가장자리 TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 가장자리
(198) 가장자리 TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 가장자리 GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
(200) 가장자리 TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
(201) 가장자리 CACTAAAACACTTTTTTTTTTTTTTTT
(202) 가장자리 TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
(203) 가장자리 TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
(204) 가장자리 TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
(205) 가장자리 TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
(206) 가장자리 TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
(207) 가장자리 CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
(208) 가장자리 TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
(209) 가장자리 AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
(210) 가장자리 ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
(211) 가장자리 TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
(212) 가장자리 TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
(213) CAGAACAATATTTTTTTTTTTTTTTTT
(214) 가장자리 TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
(215) 가장자리 TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
(216) 가장자리 TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
(217) 가장자리 TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
(218) 가장자리 TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 가장자리 AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
(220) 가장자리 CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
(221) TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
(222) 가장자리 TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
(223) 가장자리 TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
(224) 가장자리 TTTTTTTTTTTTTTTCGCCCACGCATAACCG
(225) 가장자리 AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
(226) 가장자리 CAAGTTTTTTGGTTTTTTTTTTTTTTT
(227) 가장자리 TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
(228) 가장자리 TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 가장자리 TTTTTTTTTTTTTCATCTTTGACCC
(230) 가장자리 TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
(231) 가장자리 GATACAGGAGTGTACTTTTTTTTTTTTTTTT
(232) 가장자리 TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
(233) 가장자리 GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
(234) 가장자리 TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
(235) 가장자리 TTTTTTTTTTTTTTTATAGCAATAGCT
(236) 핸들 AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 핸들 ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
(238) 핸들 CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 핸들 CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
(240) 핸들 CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
(241) 핸들 CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
(242) 핸들 AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 핸들 CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
(244) 핸들 CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
(245) 핸들 TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
(246) 핸들 AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 핸들 GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
(248) 가이드 AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 가이드 ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
(250) 가이드 CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
(251) 가이드 GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
(252) 가이드 AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
(253) 가이드 TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
(254) 가이드 TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
(255) 가이드 제거 GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
(256) 가이드 제거 GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 가이드 제거 TAAAACACCGTACTTTAGAACTAAATTGCTACG
(258) 가이드 제거 AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 가이드 제거 CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
(260) 구이데스 제거 GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
(261) 가이드 제거 ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
(262) 게이츠 Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
(263) 게이츠 Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
(264) 게이츠 Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
(265) 게이츠 Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

표 1 : 주식 서열 목록나노 로봇을 구성하는 데 사용됩니다. 스테이플 1-153 코어를 지정하고 구조의 대부분을 구성하고 있습니다. 스테이플 154-235 가장자리를 지정하고 구조의 61 나선의 끝 부분에 각각 위치하고 있습니다. 에지 스테이플 나노 로봇의 응집을 방지하기 위해 설계된 폴리 티민 꼬리가 포함되어 있습니다. 스테이플 236-247 핸들을 지정하고화물 도킹 사이트를 만들 수 있습니다. 스테이플 특정 구조의 위치 및화물 분자 도킹 위치로서 사용된다 컨센서스 서열 영역에 접속, 고유 시퀀스 영역을 처리한다. 스테이플 2백48부터 2백54까지는 가이드를 지정하고 어닐링 프로세스 동안 디바이스의 두 부분을 연결한다. 제조 후 가이드 나노 로봇의 두 개의 센서에 의해 고정 장치를두고, 가이드 제거 스테이플 255-261 (6 단계)의 추가로 제거됩니다. 센서 서열은 빌 게이츠를 지정됩니다. 2 개의 센서들 각각은 PDGF 앱 타머와 상보 가닥으로 구성된다. 자세한 expla위한국가는 벤 Ishay 등. (14)와 더글라스 등. (15). 스테이플 세 96 웰 플레이트 (깊은 둥근 바닥)에 상업적으로 정렬을 참조하십시오. 각 주식 금액은 10 nmol의 정규화된다. HPLC 정제를 필요 게이트 시퀀스를 제외 스테이플은 특별한 정제 과정을 필요로하지 않는다.

Discussion

우리는 DNA의 나노 로봇의 제조, 정제 및 시각화를 설명했다. 장치의 육방 섀시의 제작 후, 나노 로봇의 기능을 용이하게 때문에 가능한 단일 가닥 도킹 위치 (14)와 수소 결합 상보성에 그 지정 위치를 찾을 로봇 특정화물의 간단한 소개와 감지 가닥 프로그래밍 , 15, 22.

기재된 제조 프로토콜은 일반적으로 접기 광범위한 형상 폴드 연구실에서 사용되는 느린 램프 어닐을 사용한다. 생산 시간은 Sobczak 동부 등에 의해 설명 된 빠른 폴딩 프로토콜 같은 다른 프로토콜의 핵심 요소를지면. (24)가 사용될 수있다. 이 프로토콜은, 그러나 그것은 각각의 종이 접기 모양 교정을 필요로 높은 수율의 종이 접기 접는을 달성 할 것으로보고있다.

스핀 여과 초과 스테이플로부터 로봇을 정화하는데 사용된다. S를로드 할 때샘플 완충액으로 또는 컬럼 핀은,주의가 피펫 팁으로 멤브레인을 손상시키지 않도록주의해야한다. 멤브레인은 극적으로 감소 된 수율을 잠재적으로 초래 파열있다. 그것은 나노 로봇이 나이까지 가시화 될 때까지 흐름을 통해 폐기하지 않는 것이 좋습니다.

특정 애플리케이션에 대한 높은 정화 율이 요구된다; 이것은 원래의 스핀 컬럼을 사용하여 여과를 반복함으로써 달성 될 수있다. 더 높은 순도를 들어, 새로운 스핀 열 그러나이 항복 요금에 큰 부정적인 영향을 미칠 것이다, 사용할 수 있습니다. 정화의 DNA 종이 접기 구조하기위한 다른 방법은, 예를 전기 영동 및 초과 스테이플의 투석 이후에 아가 로스 겔에서 절단으로, 시험 하였다. 이러한 방법은 가난한 수율 또는 설명 프로토콜에 비해 가난한 정화 율 중 하나의 결과. 이러한 PEG 계 (25) 및 정화 율 띠 26 초 원심 분리 등의 다른 방법, 테스트되지 않았다. 이러한 방법은 아치 것으로보고되고있다이브 높은 정화 율은, 그러나 그들은 가난한 수익률 (금리 띠 초 원심 분리)가 발생하거나 잠재적으로 중공 나노 로봇 모양을 해칠 수있는 (PEG가 기반) 침전이 필요 하나.

나노 로봇은 제조 yeilds 15을 증가시키기 위해 폐쇄 위치에서 잠금 형상 가이드 스테이플 제조된다. 그것은 (설명 프로토콜에 PDGF)를 설계 자극에 응답하여 효과적으로 개방 나노 로봇에 대한 가이드 제거 스테이플을 추가하여 이러한 스테이플을 제거하는 것이 중요하다. 과량의 정제 끝에 1 몰비 : 가이드 스테이플 18 .These 스테이플 (10)에 추가되어야 나선 치환하는 과정을 통해 가이드 스테이플 해제 가이드 제거 스테이플 도킹 위해 발붙일 단일 가닥 영역과 설계 스테이플 '단계 (단계 4.7) 및 최종 쉐이커 위에 단부에 실온에서 2 시간 동안 인큐베이션.

TEM으로 시각화는 includi을 설명했다NG의 우라 닐 - 메이트 2 % 마이너스 염색. 우라 닐 아세테이트에 비해 우라 닐 - 메이트는 DNA 종이 접기 디자인의 더 나은 해상도를 허용 미세한 입자 구조를 생성합니다. 케어 분취 량은 장기간 동결 경우 고체화 우라 닐 포르 메이트로서 취해 져야한다. 그것은 염색 새로 제조 된 2 % 우라 닐 - 메이트 솔루션을 사용하는 것이 좋습니다. 더 나은 해상도를 알아내는-TEM (27)의 사용으로 달성 할 수있다.

DNA의 나노 로봇의 기본 건축 설계 및 제조 프로토콜은 궁극적으로 균일하고 간단합니다. 그러나, 폭 넓은 유연성 특정화물 혼합물 및 감지 가닥의 형태로 제공된다. 또한, 하나의 집단에서 많은 하위 유형이 도입 될 수 있으며, 상대적 화학 양론은 프로그램 및 특정 요구에 맞게 최적화. 각각의 속도 제한 단계에서 특정 동력학의 더욱 미세 조정은 두 가닥 또는 혼성화의 길이를 감소 / 증가 달성특정 키 위치에서 불일치의 소개. 시공의 용이성과 유연성이 높은 수준은 생물학적 환경에서 매우 중요한 다양한 복잡한 작업을 수행 할 수있는 나노 소자 기술을 허용한다.

Disclosures

저자가 공개하는 게 없다.

Acknowledgments

저자는 매우 가치있는 토론과 조언, 도움이 토론과 작업 바첼 레트 연구소의 모든 구성원에 대한 S. 더글러스을 감사드립니다. 이 작품은 바 - 일란 대학의 생명 과학 학부 및 나노 기술 및 신소재 연구소에서 보조금에 의해 지원됩니다.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics