DNA Origami bir Bio-duyarlı Robot katlanması ve Karakterizasyonu

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

DNA nanorobot içinde münzevi belirli uyaranlara ve mevcut kargo yanıt açmak için tasarlanmış bir oyuk altıgen nanometrik cihazdır. Her iki uyaranlara ve kargo özel ihtiyaçlarına göre uyarlanabilir. Burada DNA origami tekniği ile, bir DNA nanorobot imalat protokol açıklar. Prosedür daha sonra bir katlama tampon maddesinin mevcudiyetinde, uzun dairesel, tek sarmal bir DNA iskele eklenir stok karışımı içine kısa tek kordonlu bir DNA zımba karıştırılmasıyla başlatır. Standart termo cycler giderek nanorobot katlanması arkasındaki temel güçtür zımba-to-iskele tavlama, kolaylaştırmak için karıştırma reaksiyon sıcaklığını düşürmek için programlanmıştır. 60 saat katlama Reaksiyon tamamlandıktan sonra, fazla zımba agaroz-jel elektroforezi (AGE) ile görselleştirme, ardından bir santrifüj filtre kullanılarak atılır. Son olarak, nanorobot başarılı imalat (TEM) transmisyon elektron mikroskobu ile doğrulanır,Negatif bir boya olarak uranil-format kullanılarak.

Introduction

Nükleik asitler nanoteknoloji için kullandığı şaşırtıcı. Watson-Crick baz eşleştirme tractability olarak ısmarlama oligoların 2 büyük ölçekli sentezi kolaylığı ve nispeten düşük maliyetli bir DNA nanoteknoloji alanında uygulamalar 3 patlamasını ve araştırma üretti. Temel yapı taşı olarak hareketsiz Seeman kavşak 4,5'ten dayalı yapısal DNA nanoteknoloji, keyfi şekilleri 6-8 inşası için bir öz-montaj ilköğretim ünite olarak DNA kullanımını kolaylaştırır.

Desteksiz DNA origami 9 tekniğin son gelişme alt nanometre hassasiyetle karmaşık 2D / 3D nano mimarileri 10-12 inşası için izin verir ve artan karmaşıklığı ve şaşırtıcı çeşitliliği ile yeni işlevsel nesneler oluşturmak için etkili bir yoldur. Inşaat süreci uzun skafold, tek iplikli DNA dayanır, genellikle viral genom türetilmişKısa tek iplikli DNA oligo yüzlerce melezleşme yoluyla katlanabilir, e zımba denilen. Fabrikasyon tekrarlanabilirliği elde maksimum hidrojen bağlayıcı tamamlayıcılık kolaylaştırmak için kısa, tek iplikli zımba dizileri terzilik sonucu ise bu teknikle elde edilen yüksek çözünürlüklü yapısal, DNA çift sarmal doğal boyutlarının doğrudan bir sonucudur. Yavaş sıcaklık tavlama kullanımı ile termodinamik tercih nanoyapı yüksek verim ve sadakat ulaşılır tasarlanmış düşük-enerji, rampa. Bir bilgisayar kodu kavşak tasarım kurallarının uygulanması son derece kolay bağlanan kavşaklar yüzlerce içeren büyük, karmaşık yapıların tasarlama görevi kolaylaştırmak gibi caDNAno 13 olarak CAD araçları, gelişmesini, etkin.

Daha önce caDNAno aracı 14,15 yardımıyla bir DNA nanorobot tasarımını tarif. Burada imalat tasvir vetransmisyon elektron mikroskobu (TEM) ile görselleştirme, boyutları nanorobot 3B, içi boş altıgen nanodevice, önceden tespit edilmiş bir uyarım ve mevcut spesifik yük, yanıt olarak büyük bir uygun bir değişiklik geçiren için tasarlanmış 35 x 35 x 50 mil 3, örneğin protein ya da nükleik asit oligo olarak içeri birikir. 12 yükleme istasyonu boş kasanın içinde mevcut olmakla birlikte, bağlı yüklerin gerçek sayısı kargo boyutu ile değişir. Kargo molekülleri küçük DNA moleküllerinden enzimler, antikorlar ve 5-10 nm altın nanopartiküller değişir. Her nanorobot farklı moleküllerin bir karışımını ihtiva ettiği şekilde, muntazam ya da heterojen Cargocan ya. Algılama aptasensor 16,17 veya DNA zincir yerinden 18 teknolojiler üzerinde ya, proteinler, nükleik asitleri ve diğer kimyasalları anlamda iki çift sarmal kilitleme kapıları tasarım yoluyla elde dayanmaktadır. Aptamer seçimi protokolleri 19-21 son gelişmeler yanıt nanorobots tasarımını sağlayanmoleküller ve hücre tipleri artan aralığı.

Daha önce eser, antijene bağlanma önleyici bir ya da karma hücre grubunun 15 belirli hücre tipleri içine verimli bir sinyal, ya geçirebilmesi üzerine spesifik bir antikor, bir taşıma nanorobot göstermiştir. Bu nanocihazların bir heyecan verici özelliği, tek bir popülasyonda farklı nanorobot alt tiplerinin tanıtımıyla daha karmaşık görevleri ve mantık kontrolü gerçekleştirmek için yeteneğidir. Son zamanlarda aktif kargo molekülü 22 içeren bir efektör nüfus kontrol pozitif veya negatif düzenleyiciler ya da performans nanorobots belirli alt tipleri gösterdi.

Burada sunulan protokol nanorobot 15,22 açılmasını kolaylaştırmak için PDGF'ye seçici olarak bağlanan aptamer sensör dizileri ile işlenir bir nanorobot imalatı, saflaştırma ve görüntüleme açıklanmaktadır. Açıklanan imalat süreci n benzerverim ve arıtma oranlarını artırırken anorobot fabrikasyon süreci başlangıçta, Douglas ve arkadaşları ark., genel işlem süresini azaltmaya yönelik değişikliklerle 15 ile tasvir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Staples Havuz karışımının hazırlanması 1.

  1. Tablo 1'de listelenen 96-kuyu plakalar üzerinde sipariş liyofilize DNA nanorobot zımba (Malzeme) ve 10 nmol kadar normalleştirmek. DNA nanorobot tasarımı ve mimarisi ayrıntılı bilgi için Ben-Ishay ve ark., 14 ve Douglas ve ark bakın. 15).
  2. 100 uM bir konsantrasyonda her bir zımba de sahip DNase / RNase içermeyen ultra-saf sulandırın. Zımba, 10 nmol normalize için, ultra-saf su 100 ul ile sulandırın.
  3. Havuz çok kanallı pipet ve steril bir 55 ml solüsyon havzası kullanarak her elyaf birlikte 20 ul.
    Not: nanorobot şekil, zımba havuzda zımba her birinin konsantrasyonu (Çekirdek, Kenarlar, Kolları ve Kılavuzlar dizileri Tablo 1 de dahil olmak üzere) 254 zımba şeritlerinin oluşur beri 394 nM. Zımba havuzundan zımba çıkarma, ya da farklı vol bazı ekleyerekumes ölçüde veriminin azalmasına veya başka bir şekilde katlanmamış agrega neden olabilir.

Fabrikasyon Reaksiyon Karışımının 2. Hazırlık

  1. Standart bir reaksiyon karışımı için (Malzeme, 100 nM stok çözeltisi) iskele DNA 4 pmol karşılık, M13mp18 viral genomun dairesel tek iplikli DNA 40 ul kullanın. Imalat karışımında skafoldun nihai konsantrasyonu 20 nM, nihai hacim 200 ul'dir.
    1. Özel ihtiyaçlarına göre iskele DNA miktarını ayarlayın; Bununla birlikte, sabit bir 20 nM'de, reaksiyon karışımı içinde çatgı DNA nihai konsantrasyon tutun.
  2. Sırasıyla 1 ila 10 arasında zımba oranı bir iskele ulaşmak için zımba ekleyin. 20 nM skafold, DNA konsantrasyonu için, 254 Staples'in nihai konsantrasyona sahip her 200 nM'dir. 200 ul son reaksiyon hacmi için zımba havuz karışımı (bölüm 1.2) 102 ul ekleyin.
    1. Inci ayrı ayrı belirli Gate dizileri ekleŞu anda e katlama reaksiyon karışımı. Bu oligolar ayrı sipariş ve HPLC saflaştırma gerektirir. 20 nM skafold konsantrasyonu için her oligodan yani 200 nM, Kapı oligolar 1:10 skafold Gate sekansı oranında mevcut olduğundan emin olun. 200 ul katlanır reaksiyon hacmi için 100 uM stok konsantrasyonunda dört Kapısı oligo her biri için 0.4 ul ekleyin.
  3. 1x TAE (40 mM Tris-asetat, 1 mM EDTA) nihai konsantrasyona ulaşmak için 10x TAE tamponu hazır ekleyin. 200 ul katlanır reaksiyon hacmi için, 10x TAE 20 ul ekleyin.
  4. 10 mM'lik nihai bir konsantrasyona kadar 1 M MgCI2 ekleyin. 200 ul katlanır reaksiyon hacmi için 1 M MgCl2 2 ul ekleyin.
  5. 200 ul bir son hacme ulaşmak bir DNaz / RNazsız ultra saf su 36 ul ekle.
  6. PCR şişelere vorteksleyin ve kısım 100 ul örnekler.
    Not: Kullanılacak maksimum reaksiyon hacimleri ile ilgili termal döngü şartname danışın.Bu sınırları karşılamak için hacim azaltılması elde verimleri azaltmak olmaz. Verimleri tehlikeye atacaktır belirtilen maksimum yukarıdaki Reaksiyon hacimleri.

Fabrikasyon Reaksiyon 3. Sıcaklık Tavlama Rampa

  1. Program termal cycler takip gibidir:
    1. 5 dakika / ° C arasında bir oranda 60 ° C'ye kadar 85 ° C Rampa.
    2. Rampa 60 ° C 75 dak / ° C arasında bir oranda 4 ° C arasındadır.
    3. Belirsiz bir süre 4 ° C'de tutun.
  2. Sonra fabrikasyon -20 ° C'de mağaza örnekleri sona erdi.

Aşırı Staples 4. Kaldırma

  1. 100 kDa MWCO bir ile 0,5 ml santrifüj filtre katlama reaksiyon karışımına 100 ul ekle. Daha sonra analiz için nanorobots ön arıtma bir 10 ul örnek kaydedin.
  2. 9600 x g'de 10 dakika boyunca santrifüj.
  3. Katlama tamponu içinde 400 ul (1 x TAE, 10 mM MgCI2) ekleyin.
  4. Tekrarlayın iki kez daha 4.2 ve 4.3 adımları tekrarlayın.
  5. 9600 x g'de 5 dakika boyunca santrifüje.
  6. 9600 x g'de 1 dakika boyunca temiz bir mikrosantrifüj tüp ve spin ters filtreyi koyarak konsantre kurtarın. Nihai hacmi filtre konulmuştur üretim tepkime karışımının başlangıç ​​hacmine bağlı olarak değişebilir. Tipik haliyle, konsantre nanorobot numunenin bir 25-60 ul nihai hacim elde edilir.
  7. 260 nm'de spektrofotometre aracılığıyla örneklerde DNA konsantrasyonu ölçülür. Nanorobot örneklerinin mol konsantrasyonları hesaplanırken 5,3 ug / pmol moleküler ağırlığa kullanın.
    Not: dsDNA molar sönüm katsayısı, 50 ug / OD 260, bir çok uygulama için yeterli olmaktadır. 48 ug / OD 260 Kenarları zımba de dikkate ssDNA uzanan poli timin alır.

Katlanmış Nanorobots 5. Jel Elektroforez Analizi Agaroz

  1. 0.5x TBE (45 mM Tris-Borate, 1mM EDTA),% 2 agaroz jel Preparasyon 10 mM MgCl2 ile desteklenmiş ve ark uyarlanmış 21.):
    1. GKD 2 O. 118.75 ml 10x TBE hisse tamponu 6.25 ml seyreltilmesi ile 0.5x TBE tamponu hazırlayın
    2. 0.5x TBE tamponu 125 ml agaroz 2.5 g çözündürülür.
    3. Agaroz tamamen eriyene kadar mikrodalga kaynatın.
    4. 10 mM'lik nihai bir konsantrasyona kadar 1 M MgCI2, 1.25 ml ilave edilir.
    5. 10 mg 7 ul ekle / ml etidyum bromür.
    6. Biraz serin çözümü için bekleyin ve agaroz jel katılaşır önce jel tepsisi doldurun. Hemen istenen tarak takın.
    7. GKD 2 O 940 ml 0.5x TBE MgCl2 10x TBE tamponu hazır 50 ml, 1 M, 10 ml ilave etmek suretiyle tampon çalışan 1 L hazırlayın
    8. Jel buz banyosu içinde elektroforez cihazına tampon ve koyun cihazı çalıştıran katı eklenti sonra.
  2. Bir iskele yanında nanorobots öncesi arınma Yük 1 ug toplam DNA (adım 3.2) ve sonrası saflaştırma (adım 4.7),DNA numunesi ve jel üzerine, bir 1 kb DNA marker ile etiketlenebilir. Bir örnek, Şekil 2'de verilmiştir. Numunelerin fiili hacim saflaştırmadan sonra elde edilen konsantrasyonları bağlıdır. 6 nihai hacim oranı: Her numune, bir 1, yükleme tamponu ile yüklenir.
  3. 80 V güç kaynağı olarak ayarlayın ve 3 saat jel çalıştırın. Buz ve su ile doldurulmuş bir küvet jel çalıştırın. Nanorobots açılmak ve agaroz jel elektroforez sırasında ısınır eğer smear olarak görünecektir. Elektroforez sırasında ısıtma cihazı tutmak için ek buz ekleyin.
  4. UV masaya gör jel (Şekil 2).

Uranil-format ile Nanorobot 6. Negatif Leke

  1. % 2'lik üranil-format stok solüsyonunun hazırlanması (Castro et al uyarlanmış 23).:
    1. 15 ml'lik bir tüp içine uranil-format tozun 100 mg tartılır.
    2. 3 dakika kaynatın DNaz / RNaz ücretsiz ultra saf su de-oksijenatı için.
    3. Deoksijene sıcak su 5 ml (~ 60 ° C)(önceki aşamadan) uranil-format ihtiva eden bir toz 15 ml tüp içine. Sıkıca kapağı kapatın, (bir girdaba tutturmak tüp) titizlikle 10 dakika süreyle alüminyum folyo ve vorteks olarak sarın. Çözüm sarı renk ile bulanık görünmelidir.
    4. 0.2 mikron şırınga fi ltre ile Filtre çözümü. Çözüm açık hale gelmelidir.
    5. Kısım mikrosantrifüj tüpleri içine çözeltisi 200 ul.
    6. Tüpün dibinde havuz örnekleri masa üstü santrifüj 5 dakika boyunca maksimum hızda santrifüj.
  2. Izgara ve negatif boyama numunenin yükleme:
    1. % 2'lik üranil-format çözeltisi (6.1 bölümünde tarif edilmiş) bir 200 ul tablet çözülmesini sağlayın. 3 dakika boyunca dikkatli bir 0.5 M NaOH çözeltisi ve girdap 10 ul ekle. Bir masa üstü santrifüj kullanılarak 5 dakika süreyle maksimum hızda santrifüj.
    2. Bu arada, kızdırma deşarj ızgara 0,2 mbar oda havasını kullanarak ve 25 mA 30 sn.
    3. Saflaştırmadan sonra 2 nM nanorobot örnek 15 ul ekle (sectiızgara üst tarafında üzerine 4.7) üzerine (forseps ile düzenlenen) ve 1 dakika boyunca absorbe edelim. Filtre kağıdının üstüne ızgara koyarak fazla sıvıyı boşaltmak için fi ltresi kağıdı kullanın. Izgara yüzeyine dokunmayın.
    4. Izgara üst tarafında üzerine (adım 6.2.1 itibaren)% 2 uranil-format 10 ul ekleyin (forseps ile yapılan).
    5. Hızla filtre kağıdının üstüne ızgara koyarak fazla sıvıyı boşaltmak için fi ltresi kağıdı kullanın. Izgara yüzeyine dokunmayın.
    6. Tekrarlayın 6.2.4 ve 6.2.5 numaralı adımları.
    7. Izgara üst tarafında üzerine (adım 6.2.1 itibaren)% 2 uranil-format 10 ul ekleyin (forseps ile yapılan). Boyama çözeltisi 30 saniye boyunca absorbe olsun.
    8. Filtre kağıdının üstüne ızgara koyarak fazla sıvıyı boşaltmak için fi ltresi kağıdı kullanın. Izgara yüzeyine dokunmayın.
    9. Izgara, en az 30 dakika süreyle tamamen kurumaya TEM içine enjekte önce, bir filtre kağıdı üzerinde edelim.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Örnek sonuçlar Şekil 2A'da gösterilmiştir. Tüm yolları spektrofotometre (OD 260) üzerinden ölçülen toplam DNA'nın 1 ug içerir. Dairesel tek iplikli DNA iskele (Şerit 2) ile karşılaştırıldığında, nanorobots nedeniyle daha yüksek bir moleküler ağırlığa jelde engellenmektedir, skafold DNA zımba hibridizasyon sonucu (Şerit 3. Kırmızı ok). Şerit 3'te düşük moleküler ağırlık şeridinin skafold DNA (yeşil ok) bağlanmazken, fazla zımba temsil eder. Santrifüj süzme yoluyla saflaştırma sonrası aşırı zımba çoğu (Lanes 4-6) çıkarılır ve nanorobots Kolları tamamlayıcı şeridine 14,15,22 konjuge kargo molekülleri ile yüklenecek hazırız. Şerit 4-6 nanorobot dimerleri (Mavi ok), birbirine bağlı olan nanorobots nüfusu temsil eden yüksek molekül ağırlıklı bantları içermektedir. Potansiyel olarak Kır (5 ya da 10 ya da nM'ye) fabrikasyon prosedürde skafoldun konsantrasyonu olabilir azaltılmasıBu yüksek molekül ağırlıklı yapılarının nispi miktarını ce. Açıklanan arıtma protokolü, hafif varyasyonlar sonrası arıtma şerit 4-6 gösteri nanorobots yani fabrikasyon nanorobots ilk hacmi dönüş filtresi (4.1 Adım eklendi Lane 4:. 50 ul; Lane 5: 100 ul; Lane 6: 100 | il) ve tampon filtreye ilave edildi sayısı (4.4 Aşama Şerit 4: 2; Yol 5:. 2 kez, Şerit 6: 5 kez).

Protokolü (Şekil 2C) farklı varyasyonlar arasında verim ve arıtma sonuçlarının karşılaştırılması santrifüj filtre dediler yüklenen fabrikasyon robotlar (4.1 Adım) ilk hacmini azaltarak verimi ve arıtma oranları üzerinde çok az etkiye sahip olduğunu göstermektedir. Önemli ölçüde verim düşer Dahası, tampon değiştirmeyi ve merkezkaç spin (4.4 adımları) nanorobots püritesi marjinal bir etkiye sahip sayısının artırılması. Bu nedenle tarif edilen protokol 100 ul karşılık gelenilk birim ve 2 tamponu ilave (Şerit 5), en iyi olarak kabul edilir.

Verim tahminleri spektrofotometre (OD 260) Her numune sonrası arınma ölçümlerine dayanan ve her santrifüj filtre yüklenen ilk miktarına göre hesaplanır. Saflaştırma saflaştırılması sırasında çıkmamıştır nanorobots ve fazla zımba karşılık gelen örnekte, tüm DNA nanorobots ağırlık yüzdesi dayanmaktadır. Saflaştırma tahminler fazla zımba edilene nanorobots (Şekil 2A'da, kırmızı ve mavi oklar) (Şekil 2B'de yeşil ok) nispi yoğunluğu hesaplanır. Görece nanorobots / zımba yoğunlukları ~ zımba (yeşil ok) toplam DNA ağırlığı olan ön-saflaştırılmıştır örnek (Şerit 3) ile normalize edilmiştir, ilk tekabül saflaştırılmamış nanorobots (kırmızı ok), 4.5 kat daha fazla 10: 1 iskelefabrikasyon protokolünde zımbalar molar oranı.

Yapısal bütünlük Final doğrulama olumsuz leke olarak% 2 uranil-format kullanarak transmisyon elektron mikroskobu ile elde edilir. Resimler, Şekil 3'te sunulmuştur.

figür 1
Şekil 1: nanorobot ve şematik Tasarım kapalı nanorobot (A) Side view.. Bir aptamer sekansı ile tamamlayıcı bir kordon ile üretilen kapı çift sarmal, bir üçgen ile gösterilmektedir. (B) içinde bağlı protein kargo gösteren kapalı nanorobot önden görünüşü. (C) üretilen kapalı nanorobot kesiti şematik. Kolları zımbalar kırmızı ok ile vurgulanır. Yeşil çevreler bir tarafında bir menteşe ve karşı tarafında bir kapı sekansı ihtiva sarmallar gösterir. (D) Planlaryan görünüm bir nanorobot. Kolları kırmızı oklarla gösterilir. Kapı dizileri yeşil oklarla gösterilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 2,
Şekil 2:. Agaroz jel elektroforez sonuçları (A) Şerit 1: 1kb Marker. Şerit 2: M13mp18, yuvarlak tek iplikli iskelesi. Şerit 3: nanorobots ön arıtma. Şerit 4-6: nanorobots saflaştırma sonrası. Şerit 4: 50 ul ilk hacmi; 2 tampon eklemeler. Yol 5: 100 ul ilk birim; 2 tampon eklemeler. Şerit 6: 100 ul ilk birim; 5 tampon eklemeler. Aşırı zımba Fabrikasyon nanorobots kırmızı okla gösterilmiştir yeşil bir ok ile gösterilir. Mavi ok nanorobot dimerleri göstermektedir. (B) agaroz bandın nispi yoğunluğu 3D görünümüjel. (C) Verim ve saflaştırma tahminleri.

Şekil 3,
Şekil 3: Birden fazla imalatlar / boyama işlemlerinden alınan DNA nanorobots TEM fotoğraf.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Çekirdek 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Numara Atama Sekans
1 Göbek AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Göbek GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Göbek TACGATATAGATAATCGAACAACA
4 Göbek CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Göbek GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Göbek GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Göbek AAAATCACCGGAAGCAAACTCTGTAGCT
8 Göbek CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Göbek CATGTAAAAAGGTAAAGTAATAAGAACG
10 Göbek ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Göbek ATAGTCGTCTTTTGCGGTAATGCC
12 Göbek AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Göbek AACTATTGACGGAAATTTGAGGGAATATAAA
14 Göbek ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Göbek AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Göbek GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Göbek GCACCGCGACGACGCTAATGAACAGCTG
18 Göbek AACTTCATTTTAGAATCGCAAATC
19 Göbek CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Göbek CCAATCAAAGGCTTATCCGGTTGCTATT
21 Göbek AGAGGCGATATAATCCTGATTCATCATA
22 Göbek CCGTAATCCCTGAATAATAACGGAATACTACG
23 Göbek AAATGGTATACAGGGCAAGGAAATC
24 Göbek TCCTCATCGTAACCAAGACCGACA
25 Göbek CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Göbek ACCCGCCCAATCATTCCTCTGTCC
27 Göbek CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Göbek CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Göbek TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Göbek
31 Göbek AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Göbek ACATTCAGATAGCGTCCAATATTCAGAA
33 Göbek AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Göbek GAGATGACCCTAATGCCAGGCTATTTTT
35 Göbek TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Göbek GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Göbek AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Göbek ACCAATCGATTAAATTGCGCCATTATTA d>
39 Göbek ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Göbek CCCTAAAAGAACCCAGTCACA
41 Göbek GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Göbek CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Göbek TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Göbek TTCCTTATAGCAAGCAAATCAAATTTTA
45 Göbek ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Göbek AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Göbek TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Göbek AAAGAAACAAGAGAAGATCCGGCT
50 Göbek TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Göbek TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Göbek ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Göbek AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Göbek ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Göbek TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Göbek AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Göbek CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Göbek TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Göbek ATAACGCAATAGTAAAATGTTTAAATCA
60 Göbek ACGAATCAACCTTCATCTTATACCGAGG
61 Göbek TAATGGTTTGAAATACGCCAA
62 Göbek CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Göbek ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Göbek AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Göbek AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Göbek GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Göbek TTTTAGAACATCCAATAAATCCAATAAC
69 Göbek AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Göbek ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Göbek CGCCATAAGACGACGACAATAGCTGTCT
72 Göbek GCGTATTAGTCTTTAATCGTAAGAATTTACA
73 Göbek AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Göbek AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Göbek TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Göbek ACCAGGCGTGCATCATTAATTTTTTCAC
77 Göbek CAGCCTGACGACAGATGTCGCCTGAAAT
78 Göbek ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Göbek CTCGAATGCTCACTGGCGCAT
80 Göbek GGGCAGTCACGACGTTGAATAATTAACAACC
81 Göbek
82 Göbek TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Göbek ATTATACGTGATAATACACATTATCATATCAGAGA
84 Göbek GCAAATCTGCAACAGGAAAAATTGC
85 Göbek ATAATTACTAGAAATTCTTAC
86 Göbek TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Göbek AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Göbek CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Göbek TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Göbek AAATCAAAGAGAATAACATAACTGAACACAGT
92 Göbek CTGTATGACAACTAGTGTCGA
93 Göbek ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Göbek TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Göbek ATAAGAATAAACACCGCTCAA
96 Göbek CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Göbek AACCGCCTCATAATTCGGCATAGCAGCA
98 Göbek AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Göbek CAGTATAGCCTGTTTATCAACCCCATCC
100 Göbek TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Göbek CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Göbek AAGAAACTAGAAGATTGCGCAACTAGGG
103 Göbek CCAGAACCTGGCTCATTATACAATTACG
104 Göbek ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Göbek CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Göbek GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Göbek ACATCGGAAATTATTTGCACGTAAAAGT
109 Göbek CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Göbek AAATCGTACAGTACATAAATCAGATGAA
111 Göbek TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Göbek AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Göbek GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Göbek AGCTGCTCGTTAATAAAACGAGAATACC
115 Göbek CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Göbek CACCCTCTAATTAGCGTTTGCTACATAC
117 Göbek GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Göbek GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Göbek ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Göbek GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Göbek GGCTTGCGACGTTGGGAAGAACAGATAC
122 Göbek TAAATGCCTACTAATAGTAGTTTTCATT
123 Göbek TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Göbek TGACCATAGCAAAAGGGAGAACAAC
125 Göbek CGAGCCAGACGTTAATAATTTGTATCA
126 Göbek GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Göbek AGACGCTACATCAAGAAAACACTTTGAA
128 Göbek AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Göbek GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Göbek GGTATTAAGGAATCATTACCGAACGCTA
131 Göbek GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Göbek
133 Göbek ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Göbek AACGAGATCAGGATTAGAGAGCTTAATT
135 Göbek TACCAAGTTATACTTCTGAATCACCAGA
136 Göbek CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Göbek AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Göbek TTTCAACCAAGGCAAAGAATTTAGATAC
139 Göbek TTGAAATTAAGATAGCTTAACTAT
140 Göbek CTATTATCGAGCTTCAAAGCGTATGCAA
Göbek CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Göbek GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Göbek CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Göbek GTGTGATAAATAAGTGAGAAT
145 Göbek GCTATATAGCATTAACCCTCAGAGA
146 Göbek AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Göbek CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Göbek CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Göbek
150 Göbek ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Göbek ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Göbek TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Göbek AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Kenar TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Kenar TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Kenar TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Kenar
158 Kenar TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Kenar TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Kenar TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Kenar TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Kenar TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Kenar TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Kenar TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Kenar TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Kenar TTTTTTTTTTTTTTTACCGGATATTCA
167 Kenar TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Kenar TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Kenar CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Kenar CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Kenar TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Kenar TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Kenar
174 Kenar TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Kenar TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Kenar TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Kenar CCACACAACATACGTTTTTTTTTTTTT
178 Kenar TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Kenar TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Kenar TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Kenar TTTTTTTTTTTTTTTACGGCGGAT
182 Kenar TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Kenar TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Kenar TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Kenar TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Kenar TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Kenar TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Kenar ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Kenar
190 Kenar TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Kenar GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Kenar GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Kenar ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Kenar TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Kenar TTTTTTTTTTTTTTTACAAAATAAACA
196 Kenar TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Kenar
198 Kenar TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Kenar GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Kenar TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Kenar CACTAAAACACTTTTTTTTTTTTTTTT
202 Kenar TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Kenar TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Kenar TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Kenar TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Kenar TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Kenar CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Kenar TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Kenar AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Kenar ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Kenar TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Kenar TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Kenar TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Kenar TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Kenar TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Kenar TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Kenar TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Kenar AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Kenar CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Kenar TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Kenar TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Kenar TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Kenar AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Kenar CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Kenar TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Kenar TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Kenar TTTTTTTTTTTTTCATCTTTGACCC
230 Kenar TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Kenar GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Kenar TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Kenar GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Kenar TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Kenar TTTTTTTTTTTTTTTATAGCAATAGCT
236 Kolları AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Kolları ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Kolları CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Kolları CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Kolları CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Kolları CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Kolları AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Kolları CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Kolları CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Kolları TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Kolları AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Kolları GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Kılavuzlar AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Kılavuzlar ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Kılavuzlar CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Kılavuzlar GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Kılavuzlar AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Kılavuzlar TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Kılavuzlar TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Kılavuzlar Kaldırma GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Kılavuzlar Kaldırma GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Kılavuzlar Kaldırma TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Kılavuzlar Kaldırma AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Kılavuzlar Kaldırma CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Kaldırma GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Kılavuzlar Kaldırma ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Gates, Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Gates, Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Gates, Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Gates, Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tablo 1: Zımba dizilerinin listesinanorobot oluşturmak için kullanılır. Staples 1-153 Çekirdek belirlenmiş ve yapının toplu makyaj vardır. Zımba 154-235 Kenarları belirlenmiş ve yapının 61 sarmallarda uçlarının her birinde yer alır. Kenar zımbalar nanorobots agregasyonunu önlemek için tasarlanmış bir poli timin kuyruk içerir. Staples 236-247 Kolları belirlenmiş ve kargo yerleştirme siteleri makyaj vardır. Zımbalar, belirli bir yapıya konumu, ve yük molekülleri için yerleştirme alanı olarak kullanılan bir konsensüs dizisi bölgeye bağlayarak, tek bir sekans bölgesine sahip yönetir. Staples 248-254 Kılavuzları belirlenmiş ve tavlama işlemi sırasında cihazın iki yarısını eklemek vardır. Imalat sonrası Bilgileri nanorobot iki sensör tarafından kilitlenmiş cihazı terk Kılavuz Temizleme zımba 255-261 (aşama 6) eklenmesi ile giderilir. Sensör dizileri Gates'i belirlenir. Iki sensör her biri PDGF aptamer ve tamamlayıcı bir kordon oluşur. Daha ayrıntılı bir expla içinUlus Ben-Ishay ve ark., 14 ve Douglas ve ark., 15. Zımba, üç 96-yuvalı plakalar (derinlik yuvarlak tabanlı) ticari olarak sıralanır bkz. Her bir zımba miktarı, 10 nmol normalize edilir. HPLC saflaştırma gerektirir kapı dizileri hariç, zımbalar özel saflaştırma prosedürü gerektirmez.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Biz DNA nanorobot imalatı, arıtma, ve görselleştirme nitelendirdi. Cihazın altıgen şasi imalatı takiben, nanorobot fonksiyonu kolayca nedeniyle mevcut tek iplikli yerleştirme siteleri 14 ile hidrojen bağlayıcı tamamlayıcılık onların belirlenen pozisyon bulmak robot özgü kargo basit giriş ve algılama ipliklerini ile programlanır , 15,22.

Tarif edilen imalat protokolü, genellikle origami şekilleri geniş bir katlama laboratuarımızda kullanılmıştır yavaş tavlama rampa kullanmaktadır. Üretim süresi, Sobczak ve arkadaşları tarafından tarif edilen hızlı bölme kuralı olarak önemli bir faktör, diğer protokoller olursa. 24 kullanılabilir. Bu protokol, ancak her origami şekli için ayarlanması gerekir, yüksek verimlerle Origami elde etmek için rapor edilmiştir.

Spin filtrasyon aşırı zımba robotlar arındırmak için kullanılır. S yüklerkennumune veya tampon ile pim kolon, bakım pipet ile zara zarar verilmemesine dikkat edilmelidir. Membran potansiyel önemli ölçüde azalır verimleri sonuçlanan bozulabilir. Bu nanorobots YAŞ tarafından görüntülenmiştir kadar flow-through atmak değil tavsiye edilir.

Belirli bir uygulama için daha yüksek bir arıtma oranı isteniyorsa; Bu orijinal bir spin kolon kullanılarak süzme tekrarlanarak elde edilebilir. Daha da yüksek saflıkta, yeni bir spin kolon, ancak bu verim oranları üzerinde önemli bir olumsuz etkiye sahip olacaktır, kullanılabilir. Arıtma DNA origami yapılar için diğer yöntemler, elektroforez ve fazla zımba diyalize akabinde agaroz jelinden eksizyon olarak test edilmiştir. Bu yöntemler, düşük verim veya tarif edilen protokol ile karşılaştırıldığında düşük saflaştırma oranları ya elde edilmiştir. Örneğin PEG-bazlı arıtma için 25 ve oranlarda bölgeli ultrasantrifügasyon 26 gibi diğer yöntemler, test edilmedi. Bu yöntemler achi bildirilmektedirarife yüksek arıtma oranları, ancak onlar fakir verimleri (oran bölgeli Ultrasantrifügasyon) neden veya potansiyel oyuk nanorobot şeklini zarar verebilecek olan (PEG bazlı) yağış gerektiren ya.

Nanorobots üretim yeilds 15 arttırmak için kapalı konumda şekil kilit Kılavuz zımba ile imal edilir. Bu (anlatılan protokolde, PDGF) tasarlanmıştır uyarıcıya tepki olarak etkili bir şekilde açmak nanorobots için Kılavuz Temizleme zımba ekleyerek bu zımbaları kaldırmak için önemlidir. Aşırı saflaştırılması sonunda 1 molar oranda: Kılavuz Zımba 18 .Bu zımba 10 ilave edilmelidir şerit değiştirme sürecinden Kılavuzu Zımba serbest Kılavuzu Temizleme zımba yerleştirme için toehold tek iplikli bölgesi ile tasarlanmıştır Staples'in evre (aşama 4,7) ve son çalkalayıcı üzerinde ucunda, oda sıcaklığında 2 saat süre ile inkübe edildi.

TEM ile görselleştirme, includi tanımlanmıştırng uranil-format% 2 negatif boyama. Uranil-asetat ile karşılaştırıldığında, uranil-format DNA origami tasarımları daha iyi çözünürlük için izin ince taneli yapılar üretir. Bakım alikotları zaman uzun süreler için dondurulur halinde katılaşacağı uranil-format alınmalıdır. Bu boyama için yeni hazırlanmış bir% 2 uranil-format çözeltisi kullanılması tavsiye edilir. Daha iyi çözünürlükleri Cryo-TEM 27 kullanımı ile elde edilebilir.

DNA nanorobot temel mimari tasarım ve imalat protokolü sonuçta üniforma ve açıktır. Bununla birlikte, bir esneklik ile belirli yük karışımları ve algılama şeritler biçiminde sunulmaktadır. Ayrıca, tek bir popülasyonda birçok alt tipi dahil edilebilir ve onların göreceli stoikiometri programlanmış ve özel ihtiyaçlarına uyacak şekilde optimize edilmiş. Her hız sınırlayıcı bir aşama olarak, belirli kinetikleri daha da büyük ince ayar çift sarmal hibridizasyon veya uzunluğunu azaltmak / artan elde edilebilirbelirli anahtar pozisyonlarda uyumsuzlukları tanıtımı. Inşaat kolaylığı ile esneklik bu yüksek derecede biyolojik ilgili ortamda son derece değişik karmaşık görevleri yürütebilecek nano cihazların mühendislik sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgments

Yazarlar son derece değerli tartışmalar ve tavsiyeler ve yararlı tartışmalar ve iş için Bachelet laboratuarında tüm üyeleri S. Douglas teşekkür etmek istiyorum. Bu çalışma Bar-Ilan Üniversitesi Yaşam Bilimleri Fakültesi ve Nanoteknoloji ve İleri Malzeme Enstitüsü hibe tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics