Dobragem e Caracterização de um robô Bio-responsivo a partir de ADN de Origami

Chemistry
 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

O nanorrobô de DNA é um dispositivo nanométrico hexagonal oco, projetado para abrir em resposta a estímulos específicos e presente de carga sequestradas no interior. Ambos os estímulos e carga podem ser adaptados de acordo com necessidades específicas. Aqui descrevemos o protocolo de fabricação nanorobot ADN, com a utilização da técnica de origami de DNA. O procedimento inicia através da mistura de grampos de ADN de cadeia simples curtos em uma mistura da qual é, em seguida, adicionada a uma longa, circular, de cadeia simples andaime ADN na presença de um tampão de renaturação. Um termociclador padrão é programado para baixar gradualmente a temperatura da reacção de mistura para facilitar o emparelhamento-a-grampos de andaime, a qual é a força condutora por detrás da dobragem da nanorobot. Uma vez que a reacção de dobragem 60 HR está completa, o excesso de grampos são desprezados, utilizando um filtro de centrífuga, seguido de visualização por meio de electroforese em gel de agarose (AGE). Finalmente, o fabrico com sucesso do nanorobot é verificada por microscopia electrónica de transmissão (TEM),com a utilização de uranilo-formiato como coloração negativa.

Introduction

Os usos para os ácidos nucleicos nanotecnologia são surpreendentes. A rastreabilidade da base de emparelhamento de Watson-Crick, bem como a facilidade e baixo custo relativo de síntese em larga escala de feitos sob oligos 2 tem gerado uma explosão de aplicações 3 e pesquisas no campo da nanotecnologia de DNA. Nanotecnologia de ADN estrutural, com base no imóvel 4,5 junção Seeman como um bloco de construção fundamental faz uso de DNA como uma unidade elementar de auto-montagem para a construção de formatos arbitrários 6-8.

O desenvolvimento recente do DNA origami scaffolded 9 técnica permite a construção de complexos nano-arquiteturas 2D / 3D 10-12 com precisão sub nanômetros e é uma rota eficiente para a construção de novos objetos funcionais com o aumento da complexidade e diversidade surpreendente. O processo baseia-se na construção de um ADN de cadeia simples de comprimento de andaime, usualmente derivada de um genom viralE, que pode ser dobrada através da hibridação de centenas de oligos simples e curtas de DNA strand denominado grampos. A resolução estrutural alta obtida por esta técnica é o resultado directo das dimensões naturais da dupla hélice de ADN, enquanto que a reprodutibilidade de fabricação é o resultado de adaptar as sequências descontínuas de cadeia simples curtos para facilitar o máximo de complementaridade ligações de hidrogénio realizáveis. Com a utilização de uma temperatura de recozimento a rampa lenta concebidos de menor energia, termodinamicamente nanoestrutura preferido é alcançado com altos rendimentos e fidelidade. A fácil implementação de regras de projeto de junção em um código de computador permitiu o desenvolvimento de ferramentas de CAD, tais como caDNAno 13, que extremamente simplificar a tarefa de projetar estruturas grandes e complexas que contêm centenas de cruzamentos conectados.

Anteriormente tínhamos descrito o desenho de um nanorobot ADN com o auxílio da ferramenta de 14,15 caDNAno. Aqui nós retratam a fabricação evisualização, através de microscopia eletrônica de transmissão (TEM), do nanorrobô, um nanodevice hexagonal oca 3D, com dimensões de 35 x 35 x 50 nm 3, destinado a sofrer uma grande mudança conformacional em resposta a um estímulo pré-determinados e presente de carga específica, tais como proteínas ou ácidos nucleicos oligos, sequestrado dentro. Enquanto 12 estações de carga estão disponíveis dentro do chassi oco, o número real de carga limite é diferente com o tamanho da carga. Moléculas de carga variam de pequenas moléculas de ADN de enzimas, anticorpos e nanopartículas de ouro 5-10 nm. Cargocan quer ser homogéneo ou heterogéneo, de modo a que cada nanorobot contém uma mistura de moléculas diferentes. Sensing é conseguido através de dois duplo helicoidal projeto portões de bloqueio para detectar proteínas, ácidos nucleicos ou outros produtos químicos, tanto baseada aptasensor 16,17 ou fita de DNA deslocamento 18 tecnologias. Desenvolvimentos recentes em protocolos de seleção de aptâmeros 19-21 permitir a concepção de nanorobôs respondera uma gama cada vez maior de moléculas e tipos de células.

Trabalhos anteriores mostraram uma nanorobot transportando um anticorpo específico, o qual após se ligar ao seu antigénio pode transmitir quer um efeito inibitório ou um sinal prolífica para o interior de tipos específicos de células numa população de células misturada 15. Uma característica interessante destes nanodispositivos é a sua capacidade para realizar tarefas mais complexas e até mesmo controle de lógica com a introdução de diferentes subtipos nanorrobôs em uma única população. Recentemente, demonstrou subtipos específicos de nanorrobôs que exercem tanto como reguladores positivos ou negativos, controlando uma população efetoras contendo uma molécula de carga ativa 22.

O protocolo aqui apresentado descreve a fabricação, de purificação e de imagem de um nanorobot fechado com sequências de aptâmero de sensores que se ligam selectivamente a PDGF para facilitar a abertura da nanorobot 15,22. O processo de fabrico descrito é semelhante ao nprocesso de fabricação anorobot inicialmente descrito por Douglas et al. 15, com as alterações que visam reduzir a duração total do processo, ao aumentar as taxas de rendimento e de purificação.

Protocol

1. Preparação de Staples Piscina Mistura

  1. Encomendar liofilizado DNA grampos nanorrobôs em placas de 96 poços como listadas na Tabela 1 (ver Materiais) e normalizar a 10 nmol. Para uma descrição detalhada do projeto e da arquitetura do nanorrobô de DNA ver Ben-Ishay et al. 14 e Douglas et al. 15).
  2. Reconstituir cada agrafo bem com DNase / RNase-ultrapura livre a uma concentração de 100 uM. Para agrafos normalizados para 10 nmol, reconstitua com 100 ul de água ultrapura.
  3. Piscina juntas 20 ul de cada grampo usando um pipetador multicanal e uma bacia de solução estéril de 55 ml.
    Nota: Uma vez que a forma nanorrobô é composta de 254 filamentos descontínuas (incluindo Core, Edges, Puxadores e sequências de Guias, Tabela 1), a concentração de cada um dos grampos na piscina grampos é 394 nM. Retirar os agrafos da piscina grampo, ou adicionando um pouco diferente em volumes, pode reduzir consideravelmente o rendimento, ou de outro modo resultar em agregados não dobradas.

2. Preparação da Mistura de Reacção de Fabricação

  1. Para uma mistura de reação padrão usar 40 ul de M13mp18 viral genoma circular de DNA de cadeia simples, o que corresponde a 4 pmol de ADN andaime (100 de solução estoque nM, ver Materiais). A concentração final de andaime na mistura de fabricação é de 20 nm, volume final de 200 ul.
    1. Ajustar a quantidade de ADN de andaime de acordo com necessidades específicas; no entanto, manter a concentração final do ADN andaime na mistura de reacção a uma temperatura constante de 20 nM.
  2. Adicionar grampos de andaime para atingir uma razão de grampos de 1 a 10, respectivamente. Para uma concentração de 20 nM DNA andaime, cada uma concentração final os 254 grampos 'é de 200 nm. Para um volume de reacção final de 200 uL adicionar 102 uL da mistura de piscina grampos (secção 1.2).
    1. Adicionar sequências Portão específicos separadamente para the mistura reaccional de dobragem neste momento. Estes oligos são ordenados separadamente e necessitam de purificação por HPLC. Assegurar que os oligos porta estão presentes em uma solução 1:10 andaime para Portão relação sequência, isto é, 200 nM de cada oligo para uma concentração de 20 nM de andaime. Para um volume de reacção de dobrar 200 ul, adicionar 0,4 mL para cada um dos quatro oligo porta a uma concentração de caldo de 100 | iM.
  3. Adicionar 10x tampão TAE estoque para atingir uma concentração final de 1x TAE (40 mM Tris-acetato, 1 mM de EDTA). Para um volume de reacção de dobrar 200 ul, adicionar 20 ul de 10 x TAE.
  4. Adicionar 1 M de MgCl2 para uma concentração final de 10 mM. Para um volume de reacção de dobrar 200 ul, adicionar 2 mL de 1 M de MgCl2.
  5. Adicionar 36 ul de DNase / RNase isenta de água ultrapura com uma alcançar um volume final de 200 ul.
  6. Amostras de vórtice e alíquota de 100 uL para tubos de PCR.
    Nota: Consultar especificação termociclador sobre os volumes máximos de reacção a serem utilizadas.Reduzindo o volume para atender a esses limites não vai reduzir os rendimentos obtidos. Os volumes de reacção acima do máximo especificado irá comprometer os rendimentos.

3. Temperatura Annealing Rampa de Reacção Fabrication

  1. Termociclador programa como segue:
    1. Rampa 85 ° C a 60 ° C a uma velocidade de 5 min / ° C.
    2. Rampa 60 ° C a 4 ° C a uma velocidade de 75 min / ° C.
    3. Manter a 4 ° C indefinidamente.
  2. Depois de fabricação terminou armazenar as amostras à temperatura de -20 ° C.

4. A remoção do Staples Excesso

  1. Adiciona-se 100 ul de mistura reaccional de dobragem a um filtro de centrífuga de 0,5 ml com um MWCO de 100 kDa. Guardar a uma amostra de 10 ul de pré-purificação nanorobôs para análise posterior.
  2. Centrifugar durante 10 minutos a 9.600 x g.
  3. Adicionar 400 ul de tampão de dobragem (TAE 1X, MgCl 2 10 mM).
  4. Repita os passos 4.2 e 4.3 vezes mais.
  5. Centrifugar durante 5 minutos a 9.600 x g.
  6. Recuperar o concentrado colocando o filtro de cabeça para baixo num tubo de microcentrífuga limpo e centrifugação durante 1 min a 9600 x g. Volumes finais pode variar dependendo do volume inicial da mistura de reacção de fabricação que foi colocado dentro do filtro. Tipicamente, um volume final de 25-60 ul de amostra concentrada nanorobot é obtido.
  7. Medir a concentração de ADN nas amostras através de espectrofotómetro a 260 nm. Use peso molecular de 5,3 ug / pmol ao calcular as concentrações molares de amostras nanorrobôs.
    Nota: O coeficiente de extinção molar para dsDNA, 50 ug / OD 260, é suficiente para a maioria das aplicações. 48 ug / OD 260 leva em conta a timina poli ssDNA se estende aos grampos bordas.

5. Agarose Gel Eletroforese Análise de Dobrado Nanorobots

  1. Preparação de TBE 0,5x (45 mM Tris-borato, EDTA 1 mM), 2% de gel de agarose suplementada com 10 mM de MgCl2 et al. 21):
    1. Prepare tampão TBE 0,5x por diluição de 6,25 ml de tampão de estoque de 10x TBE em 118,75 ml de DDH 2 O.
    2. Dissolve-se 2,5 g de agarose em 125 ml de tampão TBE 0,5x.
    3. Ferver em microondas até a agarose estar completamente dissolvida.
    4. Adicionar 1,25 ml de 1 M MgCl2 a concentração final de 10 mM.
    5. Adicionar 7 uL de 10 mg / ml de brometo de etídio.
    6. Aguarde solução para um pouco fria e encher a bandeja de gel antes das solidifica gel de agarose. Instale pente desejado imediatamente.
    7. Prepare 1 litro de tampão TBE 0,5x a executar pela adição de 50 ml de tampão de estoque de 10x TBE e 10 ml de 1 M de MgCl2 para 940 ml de ddH 2 O.
    8. Uma vez que é de gel de suplemento sólido tampão de corrida para o dispositivo de electroforese e o dispositivo colocado num banho de gelo.
  2. DNA de carga 1 pg total da nanorobôs pré-purificação (passo 3.2), e pós purificação (passo 4.7), ao lado de um andaimeAmostra de ADN e um marcador de ADN de 1 kb, sobre o gel. Um exemplo é dado na Figura 2. Volumes reais de amostras depende das concentrações obtidas após purificação. Cada uma das amostras é carregado com tampão de carga a uma razão de 1: volume final 6.
  3. Regule a fonte de energia para 80 V e executar gel durante 3 horas. Submeter o gel em um banho cheio de gelo e água. Nanorobots vai se desdobrar e aparecem como uma mancha se o gel de agarose aquece durante a electroforese. Durante a electroforese adicionar gelo adicional para manter dispositivo de aquecimento.
  4. Ver em gel numa mesa de UV (Figura 2).

6. coloração negativa de nanorrobô com uranilo-formato

  1. Preparação da solução de 2% uranyl-formato (adaptado de Castro et al 23.):
    1. Pesar 100 mg de pó de uranilo-formiato para um tubo de 15 ml.
    2. Ferva DNase / RNase água ultrapura livre por 3 min de-oxigenado.
    3. Adicionar 5 ml de água quente deoxygenated (~ 60 ° C)para dentro do tubo de 15 ml que contém o pó de uranilo-formiato (a partir do passo anterior). Feche bem a tampa, embrulhe em folha de alumínio e vortex rigorosamente por 10 min (tubo de fechamento para um vórtice). Solução deve aparecer turva, com cor amarela.
    4. Filtrar a solução através de uma seringa de 0,2 um fi ltro. Solução deve ficar clara.
    5. Alíquota de 200 ul da solução em tubos de microcentrífuga.
    6. Centrifuga-se a velocidade máxima durante 5 minutos numa centrífuga de topo de mesa para agrupar as amostras na parte inferior do tubo.
  2. Carregando de amostra a grade e coloração negativa:
    1. Descongelar uma alíquota de 200 ul de solução de uranilo-formiato de 2% (preparada na secção 6.1). Adicionar 10 ul de solução de NaOH 0,5 M e rigorosamente vortex durante 3 min. Centrifuga-se a velocidade máxima durante 5 minutos, utilizando uma centrífuga de topo de mesa.
    2. Enquanto isso, a grade de descarga luminescente usando ar ambiente a 0,2 mbar e 25 mA durante 30 segundos.
    3. Adicionar 15 ul de 2 nM amostra nanorrobô após purificação (seçem 4.7) para topside da grade (realizada com fórceps) e deixe absorver durante 1 min. Use papel fi ltro para drenar o excesso de líquido através da colocação da grade na parte superior do papel de filtro. Não toque na superfície da grelha.
    4. Adicionar 10 ml de 2% uranyl-formato (do passo 6.2.1) para o topside da grade (realizada com uma pinça).
    5. Rapidamente use papel fi ltro para drenar o excesso de líquido através da colocação da grade na parte superior do papel de filtro. Não toque na superfície da grelha.
    6. Repita os passos 6.2.4 e 6.2.5.
    7. Adicionar 10 ml de 2% uranyl-formato (do passo 6.2.1) para o topside da grade (realizada com uma pinça). Vamos solução de coloração absorver durante 30 segundos.
    8. Use papel fi ltro para drenar o excesso de líquido através da colocação da grade na parte superior do papel de filtro. Não toque na superfície da grelha.
    9. Deixe secar completamente a grade por pelo menos 30 min, viradas para cima em um papel de filtro, antes de injetar na TEM.

Representative Results

Os resultados representativos são mostrados na Figura 2A. Todas as pistas contêm 1 ug de ADN total, medido através de espectrofotómetro (OD 260). Em comparação com a circular andaime de ADN de cadeia simples (pista 2), nanorrobôs são prejudicadas no gel devido ao seu peso molecular mais elevado, o resultado de grampos hibridação com o ADN de andaime (Pista 3. Vermelho seta). A banda de baixo peso molecular na pista 3 representa grampos em excesso que não se ligam ao ADN de andaime (seta verde). Após purificação através de filtração centrífuga maior parte do excesso grampos são removidos (pistas 4-6) e os nanorobôs está pronto para ser carregado com moléculas de carga conjugadas com os identificadores cadeia complementar 14,15,22. Pistas 4-6 contêm bandas de alto peso molecular que representam dímeros nanorrobôs (seta azul), uma população de nanorrobôs que estão unidos. A redução da concentração do andaime no procedimento de fabricação (para 5 ou 10 nM) pode potencialmente Reduce a quantidade relativa de estas estruturas de elevado peso molecular. Pistas 4-6 mostram nanorobôs pós-purificação com ligeiras variações do protocolo de purificação descrito, ou seja, o volume inicial de nanorobôs fabricadas adicionados ao filtro de centrifugação (Passo 4.1 Pista 4:. 50 ul; Pista 5: 100 ul; Pista 6: 100 ul), e o número de vezes que o tampão foi adicionado ao filtro (Passo 4.4 pista 4: 2 vezes; pista 5:. 2 vezes; pista 6: 5 vezes).

Comparação dos resultados de purificação e rendimento entre as diferentes variações do protocolo (Figura 2C) mostram que a redução do volume inicial de robôs fabricados carregados até ao filtro de centrífuga (passo 4.1) tem pouco efeito sobre as taxas de rendimento e purificação. Além disso, o aumento do número de trocas de buffer e spins centrífugas (passos 4.4) tem uma influência marginal sobre a pureza nas nanorobôs, reduzindo consideravelmente o rendimento. Por isso, o protocolo descrito, correspondendo a 100 ulvolume inicial e 2 adições de buffer (pista 5), ​​é considerado ideal.

Rendimento estimativas são baseadas no espectrofotómetro (OD 260) medidas de cada amostra de pós-purificação e calculado em relação à quantidade inicial colocada em cada filtro centrífugo. A purificação é baseado na percentagem em peso dos nanorrobôs de todo o ADN na amostra, correspondendo aos nanorobôs e agrafos em excesso que não lavar durante a purificação. As estimativas de purificação são calculadas a partir da intensidade relativa dos nanorobôs (setas vermelhas e azuis na Figura 2A) para que o excesso de grampos (seta verde na Figura 2B). Os relativos nanorobôs / grampos intensidades foram normalizadas com a amostra pré-purificada (pista 3), em que o peso total DNA dos grampos (seta verde) é de ~ 4,5 vezes maior do que os nanorrobôs não purificados (seta vermelha), correspondentes à inicial 10: 1 para andaimerazão molar grampos no protocolo de fabricação.

Validação final de integridade estrutural é feito através de microscopia eletrônica de transmissão usando 2% uranyl-formato como uma mancha negativa. As fotografias são apresentadas na Figura 3.

figura 1
Figura 1: desenho esquemático do nanorrobô vista (A) lateral de um nanorrobô fechado.. Porta dupla hélice, produzido por uma sequência aptamer e uma cadeia complementar, é indicado por uma seta verde. (B) Vista dianteira de um nanorrobô fechado mostrando carga proteína ligada dentro. (C) esquemas seção transversal de nanorrobô fechado produzido. Cabos grampos são destacadas por uma seta vermelha. Círculos verdes indicam hélices que contêm uma dobradiça de um lado e uma sequência de porta no lado oposto. (D) de Blueprintsum nanorrobô na vista lateral. Alças são indicadas por setas vermelhas. Sequências de portão são indicados por setas verdes. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2:. Agarose resultados de electroforese em gel (A) Pista 1: marcador de 1 kb. Pista 2: M13mp18 circular andaime de cadeia simples. Pista 3: nanorobôs pré-purificação. Lanes 4-6: nanorrobôs postar purificações. Pista 4: 50 ul de volume inicial; 2 adições buffer. Pista 5: 100 ul volume inicial; 2 adições buffer. Pista 6: 100? L de volume inicial; 5 adições buffer. Grampos em excesso são indicados por uma seta verde nanorobôs fabricadas são indicados por uma seta vermelha. Seta azul indicado dímeros nanorrobôs. (B) vista em 3D da intensidade relativa das bandas na agarosegel. (C) O rendimento e purificação estimativas.

Figura 3
Figura 3: Imagem TEM de nanorrobôs de DNA retiradas de fabricações múltiplos / procedimentos de coloração.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Núcleo 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Número Designação Seqüência
1 Testemunho AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Testemunho GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Testemunho TACGATATAGATAATCGAACAACA
4 Testemunho CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Testemunho GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Testemunho GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Testemunho AAAATCACCGGAAGCAAACTCTGTAGCT
8 Testemunho CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Testemunho CATGTAAAAAGGTAAAGTAATAAGAACG
10 Testemunho ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Testemunho ATAGTCGTCTTTTGCGGTAATGCC
12 Testemunho AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Testemunho AACTATTGACGGAAATTTGAGGGAATATAAA
14 Testemunho ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Testemunho AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Testemunho GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Testemunho GCACCGCGACGACGCTAATGAACAGCTG
18 Testemunho AACTTCATTTTAGAATCGCAAATC
19 Testemunho CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Testemunho CCAATCAAAGGCTTATCCGGTTGCTATT
21 Testemunho AGAGGCGATATAATCCTGATTCATCATA
22 Testemunho CCGTAATCCCTGAATAATAACGGAATACTACG
23 Testemunho AAATGGTATACAGGGCAAGGAAATC
24 Testemunho TCCTCATCGTAACCAAGACCGACA
25 Testemunho CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Testemunho ACCCGCCCAATCATTCCTCTGTCC
27 Testemunho CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Testemunho CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Testemunho TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Testemunho
31 Testemunho AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Testemunho ACATTCAGATAGCGTCCAATATTCAGAA
33 Testemunho AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Testemunho GAGATGACCCTAATGCCAGGCTATTTTT
35 Testemunho TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Testemunho GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Testemunho AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Testemunho ACCAATCGATTAAATTGCGCCATTATTA d>
39 Testemunho ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Testemunho CCCTAAAAGAACCCAGTCACA
41 Testemunho GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Testemunho CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Testemunho TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Testemunho TTCCTTATAGCAAGCAAATCAAATTTTA
45 Testemunho ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Testemunho AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Testemunho TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Testemunho AAAGAAACAAGAGAAGATCCGGCT
50 Testemunho TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Testemunho TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Testemunho ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Testemunho AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Testemunho ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Testemunho TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Testemunho AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Testemunho CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Testemunho TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Testemunho ATAACGCAATAGTAAAATGTTTAAATCA
60 Testemunho ACGAATCAACCTTCATCTTATACCGAGG
61 Testemunho TAATGGTTTGAAATACGCCAA
62 Testemunho CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Testemunho ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Testemunho AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Testemunho AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Testemunho GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Testemunho TTTTAGAACATCCAATAAATCCAATAAC
69 Testemunho AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Testemunho ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Testemunho CGCCATAAGACGACGACAATAGCTGTCT
72 Testemunho GCGTATTAGTCTTTAATCGTAAGAATTTACUMA
73 Testemunho AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Testemunho AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Testemunho TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Testemunho ACCAGGCGTGCATCATTAATTTTTTCAC
77 Testemunho CAGCCTGACGACAGATGTCGCCTGAAAT
78 Testemunho ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Testemunho CTCGAATGCTCACTGGCGCAT
80 Testemunho GGGCAGTCACGACGTTGAATAATTAACAACC
81 Testemunho
82 Testemunho TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Testemunho ATTATACGTGATAATACACATTATCATATCAGAGA
84 Testemunho GCAAATCTGCAACAGGAAAAATTGC
85 Testemunho ATAATTACTAGAAATTCTTAC
86 Testemunho TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Testemunho AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Testemunho CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Testemunho TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Testemunho AAATCAAAGAGAATAACATAACTGAACACAGT
92 Testemunho CTGTATGACAACTAGTGTCGA
93 Testemunho ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Testemunho TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Testemunho ATAAGAATAAACACCGCTCAA
96 Testemunho CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Testemunho AACCGCCTCATAATTCGGCATAGCAGCA
98 Testemunho AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Testemunho CAGTATAGCCTGTTTATCAACCCCATCC
100 Testemunho TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Testemunho CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Testemunho AAGAAACTAGAAGATTGCGCAACTAGGG
103 Testemunho CCAGAACCTGGCTCATTATACAATTACG
104 Testemunho ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Testemunho CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Testemunho GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Testemunho ACATCGGAAATTATTTGCACGTAAAAGT
109 Testemunho CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Testemunho AAATCGTACAGTACATAAATCAGATGAA
111 Testemunho TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Testemunho AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Testemunho GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Testemunho AGCTGCTCGTTAATAAAACGAGAATACC
115 Testemunho CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Testemunho CACCCTCTAATTAGCGTTTGCTACATAC
117 Testemunho GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Testemunho GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Testemunho ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Testemunho GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Testemunho GGCTTGCGACGTTGGGAAGAACAGATAC
122 Testemunho TAAATGCCTACTAATAGTAGTTTTCATT
123 Testemunho TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Testemunho TGACCATAGCAAAAGGGAGAACAAC
125 Testemunho CGAGCCAGACGTTAATAATTTGTATCA
126 Testemunho GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Testemunho AGACGCTACATCAAGAAAACACTTTGAA
128 Testemunho AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Testemunho GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Testemunho GGTATTAAGGAATCATTACCGAACGCTA
131 Testemunho GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Testemunho
133 Testemunho ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Testemunho AACGAGATCAGGATTAGAGAGCTTAATT
135 Testemunho TACCAAGTTATACTTCTGAATCACCAGA
136 Testemunho CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Testemunho AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Testemunho TTTCAACCAAGGCAAAGAATTTAGATAC
139 Testemunho TTGAAATTAAGATAGCTTAACTAT
140 Testemunho CTATTATCGAGCTTCAAAGCGTATGCAA
Testemunho CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Testemunho GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Testemunho CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Testemunho GTGTGATAAATAAGTGAGAAT
145 Testemunho GCTATATAGCATTAACCCTCAGAGA
146 Testemunho AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Testemunho CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Testemunho CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Testemunho
150 Testemunho ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Testemunho ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Testemunho TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Testemunho AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Borda TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Borda TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Borda TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Borda
158 Borda TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Borda TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Borda TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Borda TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Borda TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Borda TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Borda TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Borda TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Borda TTTTTTTTTTTTTTTACCGGATATTCA
167 Borda TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Borda TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Borda CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Borda CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Borda TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Borda TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Borda
174 Borda TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Borda TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Borda TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Borda CCACACAACATACGTTTTTTTTTTTTT
178 Borda TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Borda TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Borda TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Borda TTTTTTTTTTTTTTTACGGCGGAT
182 Borda TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Borda TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Borda TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Borda TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Borda TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Borda TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Borda ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Borda
190 Borda TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Borda GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Borda GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Borda ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Borda TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Borda TTTTTTTTTTTTTTTACAAAATAAACA
196 Borda TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Borda
198 Borda TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Borda GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Borda TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Borda CACTAAAACACTTTTTTTTTTTTTTTT
202 Borda TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Borda TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Borda TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Borda TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Borda TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Borda CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Borda TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Borda AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Borda ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Borda TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Borda TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Borda TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Borda TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Borda TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Borda TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Borda TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Borda AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Borda CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Borda TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Borda TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Borda TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Borda AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Borda CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Borda TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Borda TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Borda TTTTTTTTTTTTTCATCTTTGACCC
230 Borda TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Borda GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Borda TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Borda GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Borda TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Borda TTTTTTTTTTTTTTTATAGCAATAGCT
236 Handles AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Handles ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Handles CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Handles CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Handles CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Handles CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Handles AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Handles CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Handles CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Handles TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Handles AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Handles GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guides AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guides ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guides CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guides GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guides AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guides TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guides TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Remoção de guias GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Remoção de guias GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Remoção de guias TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Remoção de guias AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Remoção de guias CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Remoção GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Remoção de guias ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Portões Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Portões Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Portões Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Portões Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabela 1: Lista de sequências de gramposusado para construir o nanorrobô. Staples 1-153 são designados Core e compõem a maior parte da estrutura. Staples 154-235 são designadas bordas e estão situados em cada uma das extremidades das hélices 61 da estrutura. Grampos Borda conter uma cauda poli timina projetado para evitar a agregação de nanorobôs. Staples 236-247 são designadas Handles e compõem os locais de ancoragem de carga. Manipula grampos tem uma região de sequência única, ligando-os ao seu local específico da estrutura, e uma região de sequência de consenso que é utilizado como o local de ancoragem para as moléculas de carga. Staples 248-254 são designadas Guias e anexar as duas metades do dispositivo durante o processo de recozimento. Após a fabricação das guias são removidos, com a adição de um guia de remoção de grampos 255-261 (passo 6), deixando o dispositivo bloqueado pelos dois sensores da nanorobot. Sensor sequências são designados Gates. Cada um dos dois sensores é constituído por um aptâmero PDGF e uma cadeia complementar. Para uma mais detalhada EXPOSIÇÃOnação ver Ben-Ishay et al. 14 e Douglas et al. 15. Staples são ordenados comercialmente em três placas de 96 poços (fundo redondo profunda). Cada quantidade de grampos é normalizado para 10 nmol. Excepto para as sequências de portão, que requerem purificação por HPLC, grampos não requerem um processo de purificação especial.

Discussion

Descrevemos a fabricação, a purificação, e a visualização da nanorobot ADN. Após o fabrico do chassi hexagonal do dispositivo, a função do nanorobot é programado com a simples introdução de carga específica e fios de detecção para o robô que facilmente encontrar a sua posição designada devido à complementaridade ligações de hidrogénio com os locais de ligação disponíveis de cadeia simples 14 , 15,22.

O protocolo de fabricação descrito utiliza uma rampa de recozimento lenta, o que é geralmente utilizado em nosso laboratório para dobrar uma vasta gama de formas origami. Se o tempo de produção torna-se um factor chave outros protocolos, tais como o protocolo descrito por dobragem rápido Sobczak et al. 24 pode ser utilizado. Este protocolo é relatado para conseguir dobrar origami com rendimentos elevados, no entanto, requer calibração para cada forma origami.

Filtração rotação é usado para purificar os robôs de grampos em excesso. Ao carregar as scoluna pino com amostras ou tampão, deve ser tomado cuidado para não danificar a membrana com a ponta da pipeta. A membrana pode potencialmente romper, resultando em rendimentos reduzidos drasticamente. É aconselhável não descartar o flow-through até que os nanorrobôs são visualizados através da AGE.

Por certo aplicação, uma taxa de purificação maior é desejado; isto pode ser conseguido através da repetição da filtração, utilizando a coluna original rotação. Para ainda uma pureza mais elevada, uma nova coluna de rotação pode ser utilizado, no entanto, isto terá um efeito negativo dramático sobre as taxas de rendimento. Outros métodos para purificação de ADN origami estruturas foram testados, tais como a excisão do gel de agarose para electroforese e subsequente diálise dos grampos em excesso. Estes métodos resultou em qualquer fraco rendimento ou pobres taxas de depuração em comparação com o protocolo descrito. Outros métodos, tais como purificação com base PEG-25 e zonal ultracentrifugação 26 não foram testados. Estes métodos são relatados para Achieve altas taxas de purificação, no entanto eles ou resultar em rendimentos baixos (taxa de ultracentrifugação-zonal) ou exigir precipitação (baseado em PEG), que pode potencialmente prejudicar a forma nanorrobô oco.

Nanorobots são fabricados com o Guia de grampos que prendem a forma, na posição fechada, a fim de aumentar a fabricação yeilds 15. É importante remover estes grampos pela adição de grampos para a retirada da guia nanorobôs para eficazmente aberto em resposta aos estímulos personalizados (PDGF no protocolo descrito). Guia de grampos são concebidos com uma região de cordão único ponto de apoio para a ancoragem de grampos retirada da guia que libertam os grampos de guia por meio de um processo de deslocamento de cadeia 18 .Estes grampos deverá ser adicionada a uma proporção de 10: 1 molar, no final da purificação de excesso fase 'grampos (passo 4.7) e incubaram-se durante 2 horas à temperatura ambiente no agitador de uma extremidade sobre extremidade.

Visualization por TEM foi descrito, including uranyl-formato 2% coloração negativa. Comparado com uranyl-acetato, formato uranyl-produz as estruturas do grão mais finas que permitem uma melhor resolução de modelos de origami de DNA. Deve ser tomado cuidado como uranilo-formiato irá solidificar se alíquotas são congelados durante longos períodos de tempo. É aconselhável usar uma solução de formiato de uranilo-preparada de fresco de 2% para a coloração. Melhores resoluções são realizáveis ​​com o uso de Cryo-TEM 27.

O protocolo de projeto e fabricação de arquitetura básica do nanorrobô de DNA são em última análise, uniforme e simples. No entanto, uma vasta gama de flexibilidade é oferecido sob a forma de misturas específicas de carga e cordões de detecção. Além disso, uma única população em muitos subtipos pode ser introduzido e a sua estequiometria relativa programado e optimizado para satisfazer as necessidades específicas. Mesmo uma maior afinação fina da cinética específicas em cada passo limitante da velocidade é alcançável com o aumento / redução da duração de hibridação de cadeia dupla ou aintrodução de incompatibilidades nas posições-chave específicas. Este alto grau de flexibilidade com a facilidade de construção permite a engenharia de dispositivos em nanoescala capazes de realizar tarefas complexas altamente variadas em um meio relevante biológica.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Os autores agradecem a S. Douglas para discussões e conselhos extremamente valiosos, e todos os membros do laboratório Bachelet para discussões úteis e trabalho. Este trabalho é apoiado por subsídios da Faculdade de Ciências da Vida e do Instituto de Nanotecnologia e Materiais Avançados da Universidade de Bar-Ilan.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics