Foldning og karakterisering af en Bio-responsiv Robot fra DNA Origami

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

DNA nanorobot er en hul sekskantet nanometrisk enhed, der er designet til at åbne som svar på specifikke stimuli og nuværende last sekvestreret indeni. Både stimuli og gods kan skræddersys efter specifikke behov. Her beskriver vi DNA nanorobot fabrikation protokollen, med anvendelse af DNA origami teknik. Proceduren starter ved blanding af korte enkeltstrengede DNA-hæfteklammer i en bestand blanding, som derefter tilsættes til en lang, cirkulær, enkeltstrenget DNA stillads i nærværelse af en foldningsbuffer. En standard termo variator er programmeret til gradvist sænke blanding reaktionstemperatur at lette hæfteklammer-til-stillads annealing, hvilket er den ledende kraft bag foldningen af ​​nanorobot. Når 60 timers folde reaktionen er fuldstændig, er overskydende hæfteklammer kasseres under anvendelse af en centrifugal filter, efterfulgt af visualisering via agarose-gelelektroforese (AGE). Endelig er en vellykket fremstilling af nanorobot verificeret ved transmissionselektronmikroskopi (TEM),med anvendelse af uranyl-formiat som negativ plet.

Introduction

Anvendelserne for nukleinsyrer nanoteknologi er forbløffende. Sporbarhed af Watson-Crick baseparring samt den lethed og relative lave omkostninger af store syntese af skræddersyede oligoer 2 har genereret en eksplosion af applikationer 3 og forskning inden for DNA-nanoteknologi. Strukturel DNA nanoteknologi, baseret på det immobile Seeman krydset 4,5 som en grundlæggende byggesten gør brug af DNA som en selvstændig samling elementære enhed til opførelse af vilkårlige figurer 6-8.

Den seneste udvikling i afstivet DNA origami 9 teknik giver mulighed for opførelse af komplekse 2D / 3D nano-arkitekturer 10-12 med sub-nanometer præcision og er en effektiv vej til at bygge nye funktionelle objekter med stigende kompleksitet og forbløffende mangfoldighed. Byggeprocessen er baseret på en lang stillads enkeltstrenget DNA, sædvanligvis afledt af et viralt genombetegnet e, som kan foldes gennem hybridisering af hundredvis af korte enkeltstrengede DNA-oligoer hæfteklammer. Den høje strukturelle opløsning fremstillet ved denne teknik er en direkte følge af de naturlige dimensioner af DNA dobbelt helix, mens reproducerbarheden af ​​fremstillingen er resultatet af at skræddersy de korte enkeltstrengede korte sekvenser for at lette maksimal hydrogenbinding komplementaritet opnås. Med brug af en langsom temperatur annealing rampe designet laveste energi, termodynamisk foretrukne nanostruktur er nået i høje udbytter og fidelity. Den nemme implementering af junction design regler i en computer-kode muliggjort udviklingen af CAD-værktøjer, såsom caDNAno 13, at ekstremt forenkle opgaven med at designe store, komplekse strukturer, der indeholder hundredvis af tilsluttede vejkryds.

Tidligere beskrev vi udformningen af en DNA nanorobot ved hjælp af caDNAno værktøjet 14,15. Her skildrer vi fabrikation ogvisualisering, via transmission elektronmikroskopi (TEM), i nanorobot, en 3D-hule sekskantet nanodevice, med dimensioner på 35 x 35 x 50 nm 3, designet til at gennemgå en større konformationsændring som reaktion på en forudbestemt påvirkning og nuværende specifikke fragt, såsom proteiner eller nucleinsyre-oligoer, afsondret indenfor. Mens 12 ladestationer er tilgængelige inde i det hule chassis, det faktiske antal containere, afviger med last størrelse. Lastmolekyler spænder fra små DNA-molekyler til enzymer, antistoffer og 5-10 nm guld nanopartikler. Cargocan enten være ensartet eller uensartet, således at hver nanorobot indeholder en blanding af forskellige molekyler. Sensing opnås via to dobbelt spiralformet låsning porte design til fornemme proteiner, nukleinsyrer eller andre kemikalier, baseret på enten aptasensor 16,17 eller DNA-streng forskydning 18 teknologier. Den seneste udvikling i aptamer selektionsprotokoller 19-21 gøre udformningen af nanorobotter reageretil en stadigt stigende vifte af molekyler og celletyper.

Tidligere arbejde viste en nanorobot bærer et specifikt antistof, som ved binding til dets antigen kan viderebringe enten en inhibitorisk eller en produktiv signal til indersiden af specifikke celletyper i en blandet cellepopulation 15. En spændende træk ved disse nanodevices er deres evne til at udføre endnu mere komplekse opgaver og logik kontrol med indførelsen af ​​forskellige nanorobot undertyper i en enkelt population. For nylig demonstrerede vi specifikke undertyper af nanorobotter udfører som enten positive eller negative regulatorer, kontrollerer en effektor befolkning indeholder et aktivt fragt molekyle 22.

Protokollen præsenteres her beskriver fremstilling, rensning og billeddannelse af en nanorobot gated med aptamer sensor sekvenser, som binder selektivt til PDGF for at lette åbningen af nanorobot 15,22. Fabrikationsprocessen beskrevne svarer til nanorobot produktionsprocessen oprindeligt afbildet af Douglas et al. 15 med ændringer med henblik på den samlede proces varighed reducere, og samtidig øge udbyttet og rensning satser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Fremstilling af Staples Pool Blanding

  1. Ordre lyofiliseret DNA nanorobot hæfteklammer på 96-brønds plader som anført i tabel 1 (se Materialer) og normalisere til 10 nmol. For en detaljeret beskrivelse af design og arkitektur af DNA nanorobot se Ben-Ishay et al. 14 og Douglas et al. 15).
  2. Rekonstituer hver krampe godt med DNase / RNase-fri ultrarent til en koncentration på 100 uM. For hæfteklammer normaliseret til 10 nmol, rekonstruere med 100 ul ultrarent vand.
  3. Pool sammen 20 pi af hver krampe ved anvendelse af en multikanalpipette og en steril 55 ml opløsning bassinet.
    Bemærk: Da nanorobot formen består af 254 korte tråde (inklusive Core, Kanter, Håndtag og Guider sekvenser, tabel 1), er koncentrationen af hvert af de hæfteklammer i hæfteklammer puljen er 394 nM. Fjernelse hæfteklammer fra hæftning poolen, eller tilføje nogle på forskellige volmængderne, kan reducere udbyttet betydeligt, eller på anden måde medføre udfoldede aggregater.

2. Fremstilling af Fabrication reaktionsblanding

  1. For en standard reaktionsblanding bruge 40 pi M13mp18 virale genom cirkulært enkeltstrenget DNA, svarende til 4 pmol stillads DNA (100 nM stamopløsning, se Materialer). Slutkoncentration på stilladset i fremstillingen blandingen er 20 nM, slutvolumen 200 pi.
    1. Justere mængden af ​​stilladset DNA ifølge specifikke behov; dog holde slutkoncentration på stilladset DNA i reaktionsblandingen ved en konstant 20 nM.
  2. Tilføj hæfteklammer at nå et stillads til hæfteklammer forholdet 1 til 10, henholdsvis. For en 20 nM stillads DNA-koncentration, idet hver af de 254 hæfteklammer endelige koncentration er 200 nM. For en 200 pi slutreaktionsvolumen tilføje 102 pi af hæfteklammer pool blandingen (afsnit 1.2).
    1. Tilføj specifikke Gate sekvenser separat til the folde reaktionsblandingen på dette tidspunkt. Disse oligoer bestilles separat og kræver HPLC-oprensning. Sikre, at Gate oligoer er til stede i en 1:10 stillads til Gate sekvensen forhold, dvs. 200 nM af hver oligo til 20 nM stillads koncentration. For en 200 pi folde reaktionsvolumen, tilsættes 0,4 pi for hver af de fire Gate oligo ved en 100 uM koncentration af stamopløsning.
  3. Tilføj 10x TAE stampuffer at nå en slutkoncentration på 1 x TAE (40 mM Tris-acetat, 1 mM EDTA). For en 200 pi folde reaktionsvolumen, tilsættes 20 pi 10x TAE.
  4. Tilsæt 1 M MgCl2 til en slutkoncentration på 10 mM. For en 200 pi folde reaktionsvolumen, tilsættes 2 pi 1 M MgCl2.
  5. Tilføj 36 pi DNase / RNase-frit ultrarent vand til en nå til en endelig volumen på 200 pi.
  6. Vortex og alikvot 100 pi prøver i PCR-hætteglas.
    Bemærk: Kontakt termocycler specifikation vedrørende der skal anvendes de maksimale reaktionsvolumener.Reducere mængden til at opfylde disse grænser vil ikke reducere opnåede udbytter. Reaktionsvolumener over den maksimale angivne vil true udbytterne.

3. Temperatur Annealing Rampe af Fabrication Reaction

  1. Program thermal cycler som følger:
    1. Rampe 85 ° C til 60 ° C med en hastighed på 5 min / ° C.
    2. Rampe 60 ° C til 4 ° C med en hastighed på 75 min / ° C.
    3. Hold ved 4 ° C uendeligt.
  2. Efter fremstilling er afsluttet Opbevar prøver ved -20 ° C.

4. fjernelse af overskydende Staples

  1. Tilsæt 100 pi folde reaktionsblandingen til en 0,5 ml centrifugal filter med en MWCO på 100 kDa. Gem en 10 pi prøve af nanorobotter pre-rensning til senere analyse.
  2. Centrifuger i 10 minutter ved 9.600 x g.
  3. Der tilsættes 400 pi foldningspuffer (1x TAE, 10 mM MgCl2).
  4. Gentag trin 4.2 og 4.3 gange mere.
  5. Centrifuger i 5 minutter ved 9.600 x g.
  6. Opsaml koncentratet ved at placere filteret på hovedet i et rent mikrocentrifugerør og spin for 1 min ved 9.600 x g. Slutvolumener kan variere efter det oprindelige volumen af ​​fabrikation reaktionsblanding, som blev sat ind i filteret. Typisk en 25-60 pi slutvolumen koncentreret nanorobot prøve opnås.
  7. Mål koncentration af DNA i prøverne via spektrofotometer ved 260 nm. Brug molekylvægt på 5,3 ug / pmol ved beregningen molære koncentrationer af nanorobot prøver.
    Bemærk: Den molære ekstinktionskoefficient for dsDNA, 50 ug / OD260, er tilstrækkelig til de fleste anvendelser. 48 ug / OD260 tager hensyn til poly thymin ssDNA strækker ved kanterne hæfteklammer.

5. agarosegelelektroforese Analyse af Foldede nanorobotter

  1. Fremstilling af 0,5x TBE (45 mM Tris-borat, 1 mM EDTA), 2% agarosegel suppleret med 10 mM MgCl2 m.fl. 21.):
    1. Forbered 0,5x TBE puffer ved at fortynde 6,25 ml 10x TBE stampuffer i 118,75 ml Hedeselskabet 2 O.
    2. 2,5 g agarose opløses i 125 ml 0,5x TBE puffer.
    3. Kog i mikrobølgeovn, indtil agarose er helt opløst.
    4. Tilføj 1,25 ml 1 M MgCl2 til en slutkoncentration på 10 mM.
    5. Tilføj 7 pi 10 mg / ml ethidiumbromid.
    6. Vent til opløsning til lidt cool og fylde gelen bakken før agarosegelen størkner. Installer ønskede kam samme.
    7. Forbered 1 L 0,5x TBE løbende buffer ved tilsætning af 50 ml 10 x TBE-buffer og stock 10 ml 1 M MgCl2 til at 940 ml dobbeltdestilleret 2 O.
    8. Når gelen er fast add løbende buffer til elektroforeseapparat og sætte enheden i et isbad.
  2. Lasten 1 ug total DNA af nanorobotter forrensning (trin 3.2), og efter oprensning (trin 4.7), sammen med et stilladsDNA-prøve og en 1 kb DNA-markør, på gelen. Et eksempel er givet i figur 2. Faktiske mængder af prøver afhænger af koncentrationerne opnået efter oprensning. Hver prøver er fyldt med loadingbuffer ved en 1: 6 endelig volumenforhold.
  3. Indstil strømkilde til 80 V og køre gel til 3 timer. Kør gelen i et bad fyldt med is og vand. Nanorobotter vil udfolde sig og fremstå som en udstrygning hvis agarosegelen bliver varmt under elektroforese. Under elektroforese tilføje ekstra is til at holde enheden fra opvarmning.
  4. Vis gel på en UV-tabel (figur 2).

6. Negativ Stain af nanorobot med uranyl-formiat

  1. Fremstilling af 2% uranyl-formiat stamopløsning (tilpasset fra Castro et al. 23):
    1. 100 mg af uranyl-formiat pulver afvejes i et 15 ml rør.
    2. Kog DNase / RNase gratis ultrarent vand i 3 minutter til de-oxygenat.
    3. Der tilsættes 5 ml deoxygeneret varmt vand (~ 60 ° C)i 15 ml rør indeholdende uranyl-formiat pulver (fra foregående trin). Tæt tæt låg, wrap i aluminiumsfolie og vortex strengt i 10 min (Fastgør rør til en hvirvel). Opløsningen skal synes uklar med en gul farve.
    4. Filter løsning gennem et 0,2 um sprøjte fi lter. Opløsningen skal være klar.
    5. Portion 200 pi af opløsningen i mikrocentrifugerør.
    6. Der centrifugeres ved maksimal hastighed i 5 minutter i en bordcentrifuge at samle prøver på bunden af ​​glasset.
  2. Lastning af prøve til nettet og negativ farvning:
    1. Optø en 200 gl prøve af 2% uranyl-formiatopløsning (udarbejdet i afsnit 6.1). Tilsæt 10 pi 0,5 M NaOH-opløsning og vortex grundigt i 3 minutter. Der centrifugeres ved maksimal hastighed i 5 minutter under anvendelse af en bordcentrifuge.
    2. I mellemtiden, glød-udledning gitter ved hjælp af rumluft ved 0,2 mbar og 25 mA i 30 sek.
    3. Tilføj 15 pi 2 nM nanorobot prøve efter rensning (sectipå 4.7) på oversiden af ​​nettet (afholdt med en pincet) og lad absorbere i 1 min. Brug lter papir for at dræne overskydende væske ved at placere risten oven på filterpapiret. Rør ikke gitteret overflade.
    4. Tilsæt 10 ul af 2% uranyl-formiat (fra trin 6.2.1) på oversiden af ​​gitteret (afholdt med en pincet).
    5. Hurtigt bruge lter papir for at dræne overskydende væske ved at placere risten oven på filterpapiret. Rør ikke gitteret overflade.
    6. Gentag trin 6.2.4 og 6.2.5.
    7. Tilsæt 10 ul af 2% uranyl-formiat (fra trin 6.2.1) på oversiden af ​​gitteret (afholdt med en pincet). Lad farvningsopløsning absorbere i 30 sek.
    8. Brug lter papir for at dræne overskydende væske ved at placere risten oven på filterpapiret. Rør ikke gitteret overflade.
    9. Lad gitteret tørre helt i mindst 30 minutter, står op på et filtrerpapir, før injektion ind i TEM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Repræsentative resultater er vist i figur 2A. Alle baner indeholder 1 ug totalt DNA, målt via spektrofotometer (OD 260). Sammenlignet med den cirkulære enkeltstrengede DNA stillads (bane 2), er nanorobotter hindres i gelen på grund af deres højere molekylvægt, er resultatet af hæfteklammer hybridisering til stilladset DNA (bane 3. rød pil). Den lave molekylvægt bånd i bane 3 repræsenterer overskydende hæfteklammer, som ikke binder til stilladset DNA (grøn pil). Efter rensning ved hjælp af centrifugal filtrering fleste af de overskydende hæfteklammer fjernes (bane 4-6) og nanorobotter er klar til at blive fyldt med lastmolekyler konjugeret til håndtagene komplementære streng 14,15,22. Banerne 4-6 indeholder højmolekylære bands, der repræsenterer nanorobot dimerer (blå pil), en population af nanorobotter der er bundet sammen. Reducere koncentrationen af ​​stilladset i fremstillingsprocedure (til enten 5 eller 10 nM) kan potentielt reduCE relative mængde af disse højmolekylære strukturer. Bane 4-6 viser nanorobotter post-rensning med små variationer til de beskrevne oprensningsprotokol, nemlig den oprindelige mængde af jern- nanorobotter hvormed centrifugeringsfiltret (Trin 4.1 Bane 4:. 50 pi, Bane 5: 100 pi Bane 6: 100 pi), og antallet af gange bufferen blev tilsat til filteret (Trin 4.4 Bane 4: 2 gange Bane 5:. 2 gange Bane 6: 5 gange).

Sammenligning af udbytte og rensning resultater mellem de forskellige variationer af protokollen (figur 2C) viser, at reducere det oprindelige volumen af fabrikerede robotter indlæst til den centrifugale filter (trin 4.1) har ringe effekt på udbyttet og rensning satser. Endvidere øge antallet af buffer udvekslinger og centrifugal spin (trin 4.4) har marginal indflydelse på renheden på nanorobotter, mens betydeligt reducere udbyttet. Derfor beskrevne protokol, svarende til 100 uloprindelige volumen og 2 buffer tilføjelser (Lane 5), betragtes som optimal.

Yield skøn er baseret på spektrofotometer (OD 260) målinger af hver prøve post-rensning og beregnet i forhold til det oprindelige beløb fyldt i hver centrifugalfilter. Oprensning er baseret på vægtprocenten af ​​nanorobotter fra hele DNA i prøven svarende til de nanorobotter og overskydende hæfteklammer, som ikke vaske ud under oprensning. Rensning skøn beregnes ud fra den relative intensitet af nanorobotter (rød og blå pile i figur 2A) til den af de overskydende hæfteklammer (grøn pil i figur 2B). De relative nanorobotter / hæfteklammer intensiteter blev normaliseret med pre-oprenset prøve (bane 3), hvor det totale DNA vægten af ​​hæfteklammer (grøn pil) ~ 4,5 gange større end den urensede nanorobotter (rød pil), der svarer til den oprindelige 10: 1 til stilladshæfteklammer molforhold i fremstillingen protokollen.

Endelige validering af strukturel integritet opnås via transmission elektronmikroskopi anvendelse af 2% uranyl-formiat som en negativ plet. Billeder er vist i figur 3.

Figur 1
Figur 1: Design skematiske af nanorobot (A) Set fra siden af en lukket nanorobot.. Gate dobbeltspiral, produceret af en aptamer sekvens og en komplementær streng, er angivet med en grøn pil. (B) set forfra af et lukket nanorobot viser protein fragt bundet inde. (C) Tværsnit Skema af lukkede nanorobot produceret. Håndterer hæfteklammer er fremhævet med en rød pil. Grønne cirkler angiver helixer, der indeholder et hængsel på den ene side og en gate-sekvens på den modsatte side. (D) tegninger afen nanorobot på siden. Håndtagene er angivet med røde pile. Gate-sekvenser er angivet med grønne pile. Klik her for at se en større version af dette tal.

Figur 2
Figur 2:. Agarosegelelektroforese resultater (A) Bane 1: 1 kb markør. Bane 2: M13mp18 cirkulært enkeltstrenget stilladset. Bane 3: nanorobotter forrensning. Baner 4-6: nanorobotter skrive oprensninger. Bane 4: 50 pi oprindelige volumen; 2 buffer tilføjelser. Bane 5: 100 pi oprindelige volumen; 2 buffer tilføjelser. Bane 6: 100 pi oprindelige volumen; 5 buffer tilføjelser. Overskydende hæfteklammer er angivet med en grøn pil Bearbejdede nanorobotter er angivet med en rød pil. Blå pil angivet nanorobot dimerer. (B) 3D-visning af den relative intensitet af båndene i agarosegel. (C) Yield og rensning skøn.

Figur 3
Figur 3: TEM foto af DNA nanorobotter taget fra flere påfund / farvningsprocedurer.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Core 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Antal Betegnelse Sekvens
1 Core AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Core GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Core TACGATATAGATAATCGAACAACA
4 Core CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Core GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Core GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Core AAAATCACCGGAAGCAAACTCTGTAGCT
8 Core CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Core CATGTAAAAAGGTAAAGTAATAAGAACG
10 Core ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Core ATAGTCGTCTTTTGCGGTAATGCC
12 Core AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Core AACTATTGACGGAAATTTGAGGGAATATAAA
14 Core ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Core AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Core GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Core GCACCGCGACGACGCTAATGAACAGCTG
18 Core AACTTCATTTTAGAATCGCAAATC
19 Core CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Core CCAATCAAAGGCTTATCCGGTTGCTATT
21 Core AGAGGCGATATAATCCTGATTCATCATA
22 Core CCGTAATCCCTGAATAATAACGGAATACTACG
23 Core AAATGGTATACAGGGCAAGGAAATC
24 Core TCCTCATCGTAACCAAGACCGACA
25 Core CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Core ACCCGCCCAATCATTCCTCTGTCC
27 Core CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Core CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Core TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Core
31 Core AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Core ACATTCAGATAGCGTCCAATATTCAGAA
33 Core AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Core GAGATGACCCTAATGCCAGGCTATTTTT
35 Core TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Core GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Core AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Core ACCAATCGATTAAATTGCGCCATTATTA d>
39 Core ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Core CCCTAAAAGAACCCAGTCACA
41 Core GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Core CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Core TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Core TTCCTTATAGCAAGCAAATCAAATTTTA
45 Core ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Core AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Core TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Core AAAGAAACAAGAGAAGATCCGGCT
50 Core TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Core TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Core ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Core AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Core ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Core TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Core AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Core CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Core TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Core ATAACGCAATAGTAAAATGTTTAAATCA
60 Core ACGAATCAACCTTCATCTTATACCGAGG
61 Core TAATGGTTTGAAATACGCCAA
62 Core CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Core ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Core AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Core AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Core GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Core TTTTAGAACATCCAATAAATCCAATAAC
69 Core AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Core ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Core CGCCATAAGACGACGACAATAGCTGTCT
72 Core GCGTATTAGTCTTTAATCGTAAGAATTTACEN
73 Core AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Core AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Core TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Core ACCAGGCGTGCATCATTAATTTTTTCAC
77 Core CAGCCTGACGACAGATGTCGCCTGAAAT
78 Core ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Core CTCGAATGCTCACTGGCGCAT
80 Core GGGCAGTCACGACGTTGAATAATTAACAACC
81 Core
82 Core TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Core ATTATACGTGATAATACACATTATCATATCAGAGA
84 Core GCAAATCTGCAACAGGAAAAATTGC
85 Core ATAATTACTAGAAATTCTTAC
86 Core TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Core AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Core CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Core TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Core AAATCAAAGAGAATAACATAACTGAACACAGT
92 Core CTGTATGACAACTAGTGTCGA
93 Core ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Core TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Core ATAAGAATAAACACCGCTCAA
96 Core CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Core AACCGCCTCATAATTCGGCATAGCAGCA
98 Core AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Core CAGTATAGCCTGTTTATCAACCCCATCC
100 Core TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Core CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Core AAGAAACTAGAAGATTGCGCAACTAGGG
103 Core CCAGAACCTGGCTCATTATACAATTACG
104 Core ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Core CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Core GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Core ACATCGGAAATTATTTGCACGTAAAAGT
109 Core CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Core AAATCGTACAGTACATAAATCAGATGAA
111 Core TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Core AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Core GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Core AGCTGCTCGTTAATAAAACGAGAATACC
115 Core CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Core CACCCTCTAATTAGCGTTTGCTACATAC
117 Core GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Core GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Core ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Core GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Core GGCTTGCGACGTTGGGAAGAACAGATAC
122 Core TAAATGCCTACTAATAGTAGTTTTCATT
123 Core TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Core TGACCATAGCAAAAGGGAGAACAAC
125 Core CGAGCCAGACGTTAATAATTTGTATCA
126 Core GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Core AGACGCTACATCAAGAAAACACTTTGAA
128 Core AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Core GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Core GGTATTAAGGAATCATTACCGAACGCTA
131 Core GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Core
133 Core ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Core AACGAGATCAGGATTAGAGAGCTTAATT
135 Core TACCAAGTTATACTTCTGAATCACCAGA
136 Core CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Core AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Core TTTCAACCAAGGCAAAGAATTTAGATAC
139 Core TTGAAATTAAGATAGCTTAACTAT
140 Core CTATTATCGAGCTTCAAAGCGTATGCAA
Core CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Core GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Core CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Core GTGTGATAAATAAGTGAGAAT
145 Core GCTATATAGCATTAACCCTCAGAGA
146 Core AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Core CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Core CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Core
150 Core ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Core ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Core TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Core AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Edge TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Edge TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Edge TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Edge
158 Edge TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Edge TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Edge TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Edge TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Edge TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Edge TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Edge TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Edge TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Edge TTTTTTTTTTTTTTTACCGGATATTCA
167 Edge TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Edge TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Edge CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Edge CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Edge TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Edge TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Edge
174 Edge TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Edge TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Edge TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Edge CCACACAACATACGTTTTTTTTTTTTT
178 Edge TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Edge TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Edge TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Edge TTTTTTTTTTTTTTTACGGCGGAT
182 Edge TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Edge TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Edge TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Edge TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Edge TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Edge TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Edge ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Edge
190 Edge TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Edge GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Edge GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Edge ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Edge TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Edge TTTTTTTTTTTTTTTACAAAATAAACA
196 Edge TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Edge
198 Edge TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Edge GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Edge TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Edge CACTAAAACACTTTTTTTTTTTTTTTT
202 Edge TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Edge TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Edge TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Edge TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Edge TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Edge CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Edge TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Edge AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Edge ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Edge TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Edge TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Edge TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Edge TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Edge TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Edge TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Edge TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Edge AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Edge CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Edge TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Edge TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Edge TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Edge AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Edge CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Edge TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Edge TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Edge TTTTTTTTTTTTTCATCTTTGACCC
230 Edge TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Edge GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Edge TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Edge GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Edge TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Edge TTTTTTTTTTTTTTTATAGCAATAGCT
236 Håndtag AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Håndtag ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Håndtag CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Håndtag CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Håndtag CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Håndtag CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Håndtag AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Håndtag CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Håndtag CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Håndtag TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Håndtag AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Håndtag GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guides AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guides ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guides CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guides GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guides AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guides TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guides TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Guides Fjernelse GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Guides Fjernelse GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Guides Fjernelse TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Guides Fjernelse AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Guides Fjernelse CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 Guides Fjernelse GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Guides Fjernelse ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Gates Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Gates Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Gates Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Gates Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tabel 1: Liste over korte sekvenserbruges til at konstruere nanorobot. Staples 1-153 betegnes Core og udgør hovedparten af strukturen. Hæfteklammer 154-235 betegnes kanter og er beliggende ved hver af enderne af de 61 helixer af strukturen. Edge hæfteklammer indeholder en poly thymin hale til formål at undgå sammenlægning af nanorobotter. Staples 236-247 betegnes Håndtag og gøre op fragt docking sites. Håndtag hæfteklammer har en unik sekvens region, der forbinder dem til deres specifikke placering af strukturen, og en konsensussekvens region, der anvendes som docking site for lastmolekyler. Staples 248-254 betegnes Guides og vedhæfte de to halvdele af enheden under udglødningsprocessen. Efter fabrikation styrene er fjernet ved tilsætning af Guide Removal hæfteklammer 255-261 (trin 6), hvorefter enheden låses af de to sensorer i nanorobot. Sensor sekvenser betegnes Gates. Hver af de to sensorer består af en PDGF aptamer og en komplementær streng. For en mere detaljeret af forklaringennation se Ben-Ishay et al. 14 og Douglas et al. 15. hæfteklammer bestilles kommercielt på tre plader med 96 brønde (dyb rund bund). Hvert hæfte beløb normaliseres til 10 nmol. Bortset fra Gate sekvenser, som kræver HPLC-oprensning, har hæfteklammer ikke kræver en speciel oprensningsprocedure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi beskrev fremstilling, oprensning og visualisering af DNA nanorobot. Efter fremstilling af den sekskantede chassis af enheden, er funktionen af nanorobot programmeret med den enkle indførelse af specifikke last og sensing tråde til robotten, som let finde deres udpegede position på grund af brint-bonding komplementaritet med tilgængelige enkeltstrengede docking sites 14 , 15,22.

Fremstillingen beskrevne protokol anvender en langsom annealing rampe, som almindeligvis anvendes i vores laboratorium til at folde en bred vifte af origami figurer. Hvis produktionstiden bliver en nøglefaktor andre protokoller, såsom den hurtige folde protokollen beskrevet af Sobczak et al. 24 kan anvendes. Denne protokol er rapporteret at opnå origami foldning i høje udbytter, men det kræver kalibrering for hver origami form.

Spin filtrering anvendes til at oprense robotterne fra overskydende hæfteklammer. Når du lægger de spin søjle med prøver eller buffer, bør der udvises forsigtighed for ikke at beskadige membranen med pipettespidsen. Membranen kan potentielt sprænges hvilket resulterer i dramatisk reduceret udbytte. Det er tilrådeligt at ikke skille sig af gennemstrømning indtil nanorobotter visualiseres efter alder.

For visse ansøgning en højere rensning sats ønskes; dette kan opnås ved at gentage filtrering under anvendelse af den oprindelige spinsøjle. For endnu højere renhed, kan et nyt spin kolonne bruges, men dette vil have en dramatisk negativ effekt på udbyttet satser. Andre fremgangsmåder til oprensning DNA origami strukturer blev testet, såsom udskæring fra agarosegel efter elektroforese og dialyse af overskydende hæfteklammer. Disse metoder har resulteret i enten dårlig udbytte eller dårlige rensning i sammenligning med den beskrevne protokol. Andre metoder, såsom PEG-baseret oprensning 25 og hastigheds-zone ultracentrifugering 26 blev ikke testet. Disse metoder er rapporteret at achieve høj rensning satser, men de enten resultere i dårlige udbytter (sats-zoner ultracentrifugering) eller kræve fældning (PEG-baserede), som potentielt kan skade den hule nanorobot form.

Nanorobotter er fremstillet med Guide hæfteklammer, som låser formen i den lukkede position med henblik på at øge fabrikation yeilds 15. Det er vigtigt at fjerne disse hæfteklammer ved tilsætning Guide Removal hæfteklammer for nanorobotter til effektivt åbne som reaktion på de designede stimuli (PDGF i den beskrevne protokol). Guide hæfteklammer er designet med fodfæste enkeltstrenget region for sammenkobling af Guide Removal hæfteklammer som frigiver Guide hæfteklammer gennem en proces med strengforskydning 18 .Disse hæfteklammer bør tilføjes på et 10: 1 molforhold ved udgangen af oprensningen af overskydende hæfteklammer 'fase (trin 4.7) og inkuberet i 2 timer ved stuetemperatur på en ende til ende shaker.

Visualisering af TEM blev beskrevet, including uranyl-formiat 2% negativ farvning. Sammenlignet med uranyl-acetat, uranyl-formiat producerer finere korn strukturer, som giver mulighed for bedre opløsning af DNA origami design. Pleje bør tages som uranyl-formiat vil størkne, hvis portioner er frosset i lange perioder. Det er tilrådeligt at bruge en frisklavet 2% uranyl-formiat løsning til farvning. Bedre beslutninger er opnåelige ved anvendelse af Cryo-TEM 27.

Det grundlæggende arkitektoniske design og fabrikation protokol af DNA nanorobot er i sidste ende ensartede og ligetil. Dog tilbydes en bred vifte af fleksibilitet i form af specifikke fragt blandinger og sensing tråde. Ydermere, i en enkelt population mange undertyper kan indføres og deres relative støkiometri programmeres og optimeres til at passe særlige behov. Endnu større finjustering af de specifikke kinetik ved hver hastighedsbegrænsende trin er opnåeligt med stigende / reducere længden af ​​dobbelt streng hybridisering ellerindførelse af mismatch på specifikke nøglepositioner. Denne høje grad af fleksibilitet med lethed af byggeri giver mulighed for konstruktion af nanoskala enheder kan udføre meget forskellige komplekse opgaver i et biologisk relevant miljø.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne vil gerne takke S. Douglas for ekstremt værdifulde diskussioner og rådgivning, og alle medlemmer af Bachelet laboratorium for nyttige diskussioner og arbejde. Dette arbejde er støttet af tilskud fra Det Biovidenskabelige Fakultet og Institut for Nanoteknologi & Advanced Materials ved Bar-Ilan University.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics