Pliant et caractérisation d'un Robot Bio-sensible de l'ADN Origami

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Cite this Article

Copy Citation | Download Citations

Amir, Y., Abu-Horowitz, A., Bachelet, I. Folding and Characterization of a Bio-responsive Robot from DNA Origami. J. Vis. Exp. (106), e51272, doi:10.3791/51272 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le nanorobot d'ADN est un dispositif nanométrique hexagonale creuse, destinée à ouvrir en réponse à des stimuli spécifiques et des marchandises présente séquestrés à l'intérieur. Les deux stimuli et des marchandises peuvent être adaptés en fonction des besoins spécifiques. Ici, nous décrivons le protocole de fabrication ADN nanorobot, avec l'utilisation de la technique de l'ADN origami. La procédure lance en mélangeant courts agrafes d'ADN simple brin dans un mélange d'actions qui est ensuite ajouté à une longue, circulaire, simple brin d'ADN échafaudage en présence d'un tampon de pliage. Un cycleur thermique standard est programmé de manière à abaisser progressivement la température de réaction de mélange pour faciliter le recuit agrafes-à-échafaudage, qui est la force motrice derrière le pliage de la nanorobot. Une fois que la réaction de pliage 60 h est terminée, les agrafes en excès sont éliminées en utilisant un filtre centrifuge, suivie par la visualisation par l'intermédiaire d'une électrophorèse sur gel d'agarose (AGE). Enfin, la fabrication réussie de la nanorobot est vérifiée par microscopie électronique à transmission (TEM),avec l'utilisation d'uranyle-formate comme coloration négative.

Introduction

Les utilisations pour les acides nucléiques nanotechnologies sont étonnants. La traçabilité de l'appariement de bases de Watson-Crick ainsi que la facilité et à faible coût relatif de la synthèse à grande échelle d'oligos-mesure 2 a généré une explosion des applications 3 et la recherche dans le domaine de la nanotechnologie de l'ADN. Nanotechnologie d'ADN structurale, sur la base de la jonction 4,5 Seeman immobile comme un bloc de construction fondamental se sert de l'ADN en tant qu'unité primaire auto-assemblage pour la construction de formes arbitraires 6-8.

Le développement récent de l'ADN origami échafaudage 9 technique permet la construction de 2D / 3D nano-architectures complexes 10-12 avec une précision sub-nanométrique et est une voie efficace pour la construction de nouveaux objets fonctionnels avec l'augmentation de la complexité et de la diversité étonnante. Le processus de construction est basée sur un ADN simple brin long échafaudage, généralement dérivé d'un génome virale, qui peut être pliée par l'hybridation de centaines de courts oligonucleotides d'ADN simple brin appelé agrafes. La résolution structurel élevé obtenu par cette technique est le résultat direct des dimensions naturelles de la double hélice d'ADN, tandis que la reproductibilité de la fabrication est le résultat d'adapter les courtes séquences de base simple brin pour faciliter la liaison hydrogène complémentarité maximale réalisable. Avec l'utilisation d'un recuit lent de la température de rampe la plus faible d'énergie conçu, thermodynamiquement préféré nanostructure est atteinte avec des rendements élevés et de fidélité. La mise en œuvre facile des règles de conception de jonction dans un code informatique a permis le développement d'outils de CAO, tels que caDNAno 13, qui simplifie extrêmement la tâche de concevoir de grandes structures complexes contenant des centaines de jonctions connectés.

Auparavant, nous avons décrit la conception d'un nanorobot d'ADN à l'aide de l'outil 14,15 caDNAno. Ici, nous décrivons la fabrication etvisualisation, par microscopie électronique à transmission (MET), de l'nanorobot, un nanodispositif hexagonale creuse 3D, avec des dimensions de 35 x 35 x 50 nm 3, conçu pour subir un changement conformationnel majeur en réponse à un stimuli prédéterminés et marchandises spécifiques présents, tels comme des protéines ou des oligonucléotides d'acide nucléique, piégé à l'intérieur. Bien que 12 stations de chargement sont disponibles à l'intérieur du châssis creux, le nombre réel de cargaison lié est différente de la taille de la cargaison. Molécules cargo vont de petites molécules d'ADN à des enzymes, des anticorps et des nanoparticules d'or 5-10 nm. Cargocan être soit uniforme ou hétérogène, de telle sorte que chaque nanorobot contient un mélange de molécules différentes. Détection est réalisée par deux double hélice conception de portes de verrouillage pour détecter protéines, acides nucléiques ou d'autres produits chimiques, basée soit sur ​​aptasensor 16,17 ou 18 brin d'ADN déplacement technologies. Les développements récents dans les protocoles de sélection des aptamères 19-21 permettent la conception de nanorobots répondreà une gamme de plus en plus des molécules et des types de cellules.

Des travaux antérieurs ont montré un nanorobot portant un anticorps spécifique, qui lors de la liaison à son antigène peut relayer soit un inhibiteur ou un signal prolifique à l'intérieur de types de cellules spécifiques dans une population de cellules mixtes 15. Une caractéristique intéressante de ces nano est leur capacité à effectuer des tâches encore plus complexe et logique de commande avec l'introduction de différents sous-types de nanorobots dans une seule population. Récemment, nous avons démontré sous-types spécifiques de nanorobots spectacle soit comme des régulateurs positifs ou négatifs, de contrôler une population effecteur contenant une molécule cargo actif 22.

Le protocole présenté ici décrit la fabrication, la purification et l'imagerie d'un nanorobot fermée, avec des séquences de sonde de aptamère qui se lient sélectivement au PDGF pour faciliter l'ouverture de la nanorobot 15,22. Le procédé de fabrication décrit est similaire au nprocessus de fabrication de anorobot initialement représenté par Douglas et al. 15 avec des changements visant à réduire la durée globale du processus, tout en augmentant les taux de rendement et de purification.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Préparation de Staples Piscine Mélange

  1. Ordre lyophilisé ADN nanorobots agrafes sur des plaques à 96 puits énumérés dans le tableau 1 (voir Matériaux) et de normaliser à 10 nmol. Pour une description détaillée de la conception et l'architecture du nanorobot d'ADN voir Ben-Ishay et al., 14 et Douglas et al. 15).
  2. Reconstituer chaque agrafe bien avec DNase / ultrapure exempte de RNases à une concentration de 100 um. Pour agrafes normalisées à 10 nmol, reconstituer avec 100 pi d'eau ultra-pure.
  3. Piscine ensemble 20 pi de chaque agrafe à l'aide d'une pipette multicanaux et 55 ml de solution stérile bassin.
    Remarque: Comme la forme de nanorobot se compose de 254 brins de base (y compris de base, arêtes, poignées et des séquences guides, tableau 1), la concentration de chacun des agrafes dans la piscine des agrafes est 394 nM. Retrait des agrafes de la piscine de base, ou l'ajout de certains au vol différenteUMES, peut réduire considérablement le rendement, ou entraîner autrement dans les agrégats dépliées.

2. Préparation de Fabrication Réaction Mélange

  1. Pour un mélange de réaction standard utiliser 40 pl de l'ADN simple brin M13mp18 du génome viral circulaire, correspondant à 4 pmol de l'ADN de l'échafaudage (solution 100 nM boursier, voir Matériaux). La concentration finale de échafaudage dans le mélange de fabrication est de 20 nM, volume final de 200 ul.
    1. Ajuster la quantité d'ADN de l'échafaudage en fonction des besoins spécifiques; cependant, maintenir la concentration finale de l'ADN de l'échafaudage dans le mélange de réaction à une 20 nM constante.
  2. Ajouter agrafes à atteindre un échafaudage à ratio des agrafes de 1 à 10, respectivement. Pour une concentration de 20 nM d'ADN d'échafaudage, chacun de concentration finale de 254 agrafes est de 200 nM. Pour un volume de réaction de 200 ul finale, on ajoutera 102 pi du mélange de la piscine des agrafes (section 1.2).
    1. Ajouter séquences Porte spécifiques séparément THe mélange réactionnel pliage pour le moment. Ces oligos sont commandés séparément et nécessitent une purification par HPLC. Assurez-vous que oligos Porte sont présents dans un rapport de 1:10 à échafaud Porte de séquence, soit 200 nM de chaque oligo pour une concentration de 20 nM de l'échafaudage. Pour un pliage volume de réaction de 200 pi, 0,4 pi ajouter pour chacun des oligo quatre porte à une concentration stock 100 um.
  3. Ajouter 10x TAE de stock tampon pour atteindre une concentration finale de TAE 1X (40 mM Tris-acétate, EDTA 1 mM). Pour un pliage volume de réaction de 200 pi, ajouter 20 pi de 10x TAE.
  4. Ajouter 1 M MgCl 2 à une concentration finale de 10 mM. Pour un pliage volume de réaction de 200 pi, ajouter 2 pi de 1 M MgCl2.
  5. Ajouter 36 ul de DNase / RNase eau ultra-pure à une connexion atteindre un volume final de 200 ul.
  6. Vortex et 100 ul aliquote des échantillons dans des fioles de PCR.
    Remarque: Consultez la spécification de cycleur thermique en ce qui concerne les volumes de réaction maximale à utiliser.Réduire le volume pour répondre à ces limites ne va pas réduire les rendements obtenus. Les volumes de réaction au-dessus du maximum spécifié mettra en péril les rendements.

3. Température recuit Rampe de Fabrication Réaction

  1. Programme cycleur thermique comme suit:
    1. Rampe 85 ° C à 60 ° C à une vitesse de 5 min / ° C.
    2. Rampe de 60 ° C à 4 ° C à une vitesse de 75 min / ° C.
    3. Tenir à 4 ° C indéfiniment.
  2. Après la fabrication est terminée, stocker les échantillons à -20 ° C.

4. Suppression de Staples excédentaires

  1. Ajouter 100 ul de mélange réactionnel de pliage à un filtre centrifuge 0,5 ml avec un MWCO de 100 kDa. Enregistrer un échantillon de 10 pi de nanorobots pré-purification pour une analyse ultérieure.
  2. Centrifugeuse pendant 10 min à 9600 x g.
  3. Ajouter 400 ul de tampon de pliage (1x TAE, 10 mM de MgCl2).
  4. Répétez les étapes 4.2 et 4.3 fois plus.
  5. Centrifugeuse pendant 5 min à 9600 x g.
  6. Récupérer le concentré en plaçant le filtre à l'envers dans un tube à centrifuger propre et essorage pendant 1 min à 9600 x g. Volumes finals peuvent varier en fonction du volume initial de mélange réactionnel de fabrication qui a été mis dans le filtre. Typiquement, un volume final 25-60 pi de l'échantillon de nanorobot concentré est obtenu.
  7. Mesurer la concentration de l'ADN dans les échantillons par l'intermédiaire d'un spectrophotomètre à 260 nm. Utilisez poids moléculaire de 5,3 pg / pmol lors du calcul des concentrations molaires des échantillons de nanorobots.
    Remarque: Le coefficient d'extinction molaire pour ADNdb, 50 pg / OD 260, est suffisant pour la plupart des applications. 48 pg / OD 260 prend en compte la thymine poly ssADN étend sur les bords des agrafes.

5. Agarose Gel d'électrophorèse Analyse des Plié Nanorobots

  1. Préparation du 0,5 x TBE (45 mM de Tris-borate, 1 mM EDTA), gel d'agarose à 2% additionné de 10 mM de MgCl2 et al 21.):
    1. Préparer tampon de TBE 0,5x en diluant 6,25 ml de 10x TBE tampon de stock en 118.75 ml de ddH 2 O.
    2. Dissoudre 2,5 g d'agarose dans 125 ml de tampon TBE 0,5x de.
    3. Faire bouillir au micro-ondes jusqu'à ce que l'agarose est complètement dissous.
    4. Ajouter 1,25 ml de 1 M de MgCl2 à une concentration finale de 10 mM.
    5. Ajouter 7 pi de 10 mg / ml de bromure d'éthidium.
    6. Attendez solution à refroidir légèrement et remplir le plateau de gel avant la solidification du gel d'agarose. Installez peigne désiré immédiatement.
    7. Préparer 1 L 0,5x TBE tampon fonctionnant par addition de 50 ml de 10x TBE du stock régulateur et 10 ml de 1 M MgCl 2 à 940 ml de ddH 2 O.
    8. Une fois que le gel est add solide exécutant tampon à l'appareil d'électrophorèse et le dispositif mis dans un bain de glace.
  2. Charge 1 pg d'ADN total de la nanorobots pré-purification (étape 3.2), et après purification (étape 4.7), aux côtés d'un échafaudageÉchantillon d'ADN et un ADN marqueur, sur le gel de 1 kb. Un exemple est donné sur la figure 2. Volumes d'échantillons réels dépendent des concentrations obtenues après purification. Chacun des échantillons est chargé avec du tampon de chargement à un rapport de 1: 6 de volume final.
  3. Réglez la source d'alimentation à 80 V et exécuter gel pendant 3 heures. Exécutez le gel dans un bain rempli de glace et d'eau. Nanorobots vont se dérouler et apparaissent comme un frottis si le gel d'agarose réchauffe pendant l'électrophorèse. Pendant électrophorèse ajouter de la glace supplémentaire pour garder appareil de chauffage.
  4. Voir le gel sur une table UV (Figure 2).

6. coloration négative du nanorobot avec Uranyle-formate

  1. Préparation de la solution mère d'uranyle-formate 2% (adapté de Castro et al 23.):
    1. Peser 100 mg de poudre d'uranyle-formate dans un tube de 15 ml.
    2. Faire bouillir DNase / RNase eau ultra-pure gratuite pendant 3 min à De-oxygéner.
    3. Ajouter 5 ml d'eau chaude désoxygéné (~ 60 ° C)dans le tube de 15 ml contenant de la poudre d'uranyle-formate (de l'étape précédente). Bien fermer le couvercle, envelopper dans du papier d'aluminium et le vortex rigoureusement pendant 10 min (tube, fixez un vortex). Solution devrait apparaître trouble avec une couleur jaune.
    4. Solution à travers un filtre de 0,2 um seringue fi filtre. Solution doit devenir clair.
    5. Aliquoter 200 ul de la solution dans des tubes de microcentrifugation.
    6. Centrifugeuse à vitesse max pendant 5 min dans une centrifugeuse de paillasse à des échantillons de la piscine au fond du tube.
  2. Chargement de l'échantillon à grille et coloration négative:
    1. Décongeler une aliquote de 200 pi de solution uranyle-formate 2% (préparé dans la section 6.1). Ajouter 10 pi de solution et le vortex NaOH 0,5 M rigoureusement pendant 3 min. Centrifugeuse à vitesse max pendant 5 minutes à l'aide d'une centrifugeuse de dessus de table.
    2. Pendant ce temps, la grille décharge luminescente en utilisant l'air ambiant à 0,2 mbar et 25 mA pendant 30 sec.
    3. Ajouter 15 pi de 2 nM échantillon de nanorobot après purification (sectisur 4,7) sur face supérieure de la grille (tenue avec une pince) et laisser absorber pendant 1 min. Utilisez du papier fi ltre pour drainer l'excès de liquide en plaçant la grille sur le dessus du papier filtre. Ne touchez pas la surface de la grille.
    4. Ajouter 10 ul de la formiate-uranyle à 2% (de l'étape 6.2.1) sur la face supérieure de la grille (tenue avec des pinces).
    5. Utiliser rapidement papier fi ltre pour drainer l'excès de liquide en plaçant la grille sur le dessus du papier filtre. Ne touchez pas la surface de la grille.
    6. Répétez les étapes 6.2.4 et 6.2.5.
    7. Ajouter 10 ul de la formiate-uranyle à 2% (de l'étape 6.2.1) sur la face supérieure de la grille (tenue avec des pinces). Laissez solution de coloration absorber pendant 30 sec.
    8. Utilisez du papier fi ltre pour drainer l'excès de liquide en plaçant la grille sur le dessus du papier filtre. Ne touchez pas la surface de la grille.
    9. Laissez sécher complètement la grille pendant au moins 30 min, face vers le haut sur un papier filtre, avant de l'injecter dans le TEM.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Les résultats représentatifs sont présentés sur la figure 2A. Toutes les voies contiennent 1 pg d'ADN total, mesuré par spectrophotomètre (DO260). Par rapport à la circulaire échafaudage d'ADN simple brin (Lane 2), nanorobots sont entravés dans le gel en raison de leur poids moléculaire élevé, le résultat d'agrafes hybridation à l'ADN de l'échafaudage (Lane 3. flèche rouge). La bande basse de poids moléculaire Lane 3 représente agrafes excédentaires qui ne se lient à l'ADN de l'échafaudage (flèche verte). Après purification par filtration centrifuge plupart des excès agrafes sont enlevés (Lanes 4-6) et les nanorobots sont prêtes à être chargées avec des molécules de fret conjugués aux poignées brin complémentaire 14,15,22. Lanes 4-6 contiennent des bandes de poids moléculaire élevé représentant dimères de nanorobots (bleu de flèche), une population de nanorobots qui sont liés ensemble. La réduction de la concentration de l'échafaudage dans la procédure de fabrication (à 5 ou 10 nM) peuvent potentiellement réduCE de la quantité relative de ces structures de haut poids moléculaire. Lanes 4-6 Appelez nanorobots post-purification avec de légères variations au protocole de purification décrit, à savoir le volume initial de nanorobots fabriqués ajoutés au filtre de spin (étape 4.1 Lane 4:. 50 pi; Lane 5: 100 pi; Lane 6: 100 ul), et le nombre de fois que le tampon a été ajouté au filtre (étape 4.4 Lane 4: 2 fois; 5 Lane:. deux fois; piste 6: 5 fois).

Comparaison du rendement et de purification des résultats entre les différentes variations du protocole (figure 2C) montrer que la réduction du volume initial de robots fabriqués chargés vers le filtre centrifuge (étape 4.1) a peu d'effet sur ​​les taux de rendement et de purification. En outre, l'augmentation du nombre d'échanges de tampons et des tours centrifuges (étapes 4.4) a une influence marginale sur la pureté sur les nanorobots, tout en réduisant considérablement le rendement. Ainsi le protocole décrit, correspondant à 100 ulvolume initial et 2 ajouts tampons (piste 5), est considéré comme optimal.

Des estimations de rendement sont basés sur spectrophotomètre (DO260) mesures de chaque échantillon post-purification et calculés par rapport au montant initial chargé dans chaque filtre centrifuge. La purification est basé sur le pour cent en poids des nanorobots de la totalité de l'ADN dans l'échantillon, correspondant aux nanorobots et les agrafes en excès qui n'a pas lavent au cours de la purification. Des estimations de purification sont calculés à partir de l'intensité relative des nanorobots (flèches rouges et bleues sur la figure 2a) à celui de l'excès agrafes (flèche verte sur la figure 2B). Les relatifs nanorobots / agrafes intensités ont été normalisées avec l'échantillon pré-purifiée (piste 3), dans laquelle le poids total de l'ADN des agrafes (flèche verte) est ~ 4,5 fois celle de la nanorobots non purifiés (flèche rouge), correspondant à la première 10: 1 échafaudrapport molaire des agrafes dans le protocole de fabrication.

La validation finale de l'intégrité structurale est réalisée par microscopie électronique à transmission en utilisant 2% d'uranyle-formate comme une coloration négative. Photos sont présentés dans la figure 3.

Figure 1
Figure 1: Conception schématique du nanorobot vue (A) de côté d'un nanorobot fermée.. Double hélice Gate, produit par une séquence d'aptamère et un brin complémentaire, est indiquée par une flèche verte. (B) Vue de face d'un nanorobot fermé montrant fret lié aux protéines à l'intérieur. (C) de la Croix-section des schémas de nanorobot fermé produite. Poignées agrafes sont mis en évidence par une flèche rouge. Les cercles verts indiquent hélices qui contiennent une charnière sur un côté et une séquence de grille sur le côté opposé. (D) de Blueprintsun nanorobot à vue de côté. Les poignées sont indiquées par des flèches rouges. Séquences grille sont indiquées par des flèches vertes. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2:. Agarose résultats d'électrophorèse sur gel (A) Ligne 1: 1kb Marker. Lane 2: M13mp18 circulaire échafaudage simple brin. Lane 3: nanorobots pré-purification. Lanes 4-6: nanorobots poster purifications. Piste 4: 50 ul de volume initial; 2 additions tampons. Lane 5: 100 ul de volume initial; 2 additions tampons. Lane 6: 100 ul de volume initial; 5 additions tampons. Agrafes excédentaires sont indiqués par une flèche verte nanorobots travaillées sont indiqués par une flèche rouge. Flèche bleue indiqué dimères de nanorobots. (B) de la vue 3D de l'intensité relative des bandes dans le agarosegel. (C) le rendement et de purification des estimations.

Figure 3
Figure 3: TEM photo de nanorobots ADN prélevés sur de multiples fabrications / procédures de coloration.

"> TATACAGGAAATAAAGAAATTTTGCCCGAACGTTAAGACTTT 2 "> Noyau 141 0 "> TTTTTTTTTTTTTTTGTTAATTTCATCT
Nombre La désignation Séquence
1 Noyau AAAAACCAAACCCTCGTTGTGAATATGGTTTGGTC
2 Noyau GGAAGAAGTGTAGCGGTCACGTTATAATCAGCAGACTGATAG
3 Noyau TACGATATAGATAATCGAACAACA
4 Noyau CTTTTGCTTAAGCAATAAAGCGAGTAGA
5 Noyau GTCTGAAATAACATCGGTACGGCCGCGCACGG
6 Noyau GGAAGAGCCAAACAGCTTGCAGGGAACCTAA
7 Noyau AAAATCACCGGAAGCAAACTCTGTAGCT
8 Noyau CCTACATGAAGAACTAAAGGGCAGGGCGGAGCCCCGGGC
9 Noyau CATGTAAAAAGGTAAAGTAATAAGAACG
10 Noyau ATTAAATCAGGTCATTGCCTGTCTAGCTGATAAATTGTAATA
11 Noyau ATAGTCGTCTTTTGCGGTAATGCC
12 Noyau AGTCATGGTCATAGCTGAACTCACTGCCAGT
13 Noyau AACTATTGACGGAAATTTGAGGGAATATAAA
14 Noyau ATCGCGTCTGGAAGTTTCATTCCATATAGAAAGACCATC
15 Noyau AAATATTGAACGGTAATCGTAGCCGGAGACAGTCATAAAAAT
16 Noyau GTCTTTACAGGATTAGTATTCTAACGAGCATAGAACGC
17 Noyau GCACCGCGACGACGCTAATGAACAGCTG
18 Noyau AACTTCATTTTAGAATCGCAAATC
19 Noyau CGTAGAGTCTTTGTTAAGGCCTTCGTTTTCCTACCGAG
20 Noyau CCAATCAAAGGCTTATCCGGTTGCTATT
21 Noyau AGAGGCGATATAATCCTGATTCATCATA
22 Noyau CCGTAATCCCTGAATAATAACGGAATACTACG
23 Noyau AAATGGTATACAGGGCAAGGAAATC
24 Noyau TCCTCATCGTAACCAAGACCGACA
25 Noyau CATTATCTGGCTTTAGGGAATTATGTTTGGATTAC
26 Noyau ACCCGCCCAATCATTCCTCTGTCC
27 Noyau CGACCAGTCACGCAGCCACCGCTGGCAAAGCGAAAGAAC
28 Noyau CTAAAGGCGTACTATGGTTGCAACAGGAGAGA
29 Noyau TTGGCAGGCAATACAGTGTTTCTGCGCGGGCG
30 Noyau
31 Noyau AAGTATAGTATAAACAGTTAACTGAATTTACCGTTGAGCCAC
32 Noyau ACATTCAGATAGCGTCCAATATTCAGAA
33 Noyau AAACATCTTTACCCTCACCAGTAAAGTGCCCGCCC
34 Noyau GAGATGACCCTAATGCCAGGCTATTTTT
35 Noyau TCCTGAATTTTTTGTTTAACGATCAGAGCGGA
36 Noyau GCCGAAAAATCTAAAGCCAATCAAGGAAATA
37 Noyau AGCGTAGCGCGTTTTCACAAAATCTATGTTAGCAAACGAACGCAACAAA
38 Noyau ACCAATCGATTAAATTGCGCCATTATTA d>
39 Noyau ATCTTACTTATTTTCAGCGCCGACAGGATTCA
40 Noyau CCCTAAAAGAACCCAGTCACA
41 Noyau GGAAGGGCGAAAATCGGGTTTTTCGCGTTGCTCGT
42 Noyau CAGACCGGAAGCCGCCATTTTGATGGGGTCAGTAC
43 Noyau TAATATTGGAGCAAACAAGAGATCAATATGATATTGCCTTTA
44 Noyau TTCCTTATAGCAAGCAAATCAAATTTTA
45 Noyau ACTACGAGGAGATTTTTTCACGTTGAAACTTGCTTT
46 Noyau AAACAGGCATGTCAATCATATAGATTCAAAAGGGTTATATTT
47 AACAGGCACCAGTTAAAGGCCGCTTTGTGAATTTCTTA
48 Noyau TTCCTGAGTTATCTAAAATATTCAGTTGTTCAAATAGCAG
49 Noyau AAAGAAACAAGAGAAGATCCGGCT
50 Noyau TTGAGGGTTCTGGTCAGGCTGTATAAGC
51 Noyau TTTAACCGTCAATAGTGAATTCAAAAGAAGATGATATCGCGC
52 Noyau ACGAGCGCCCAATCCAAATAAAATTGAGCACC
53 Noyau AATAAGTCGAAGCCCAATAATTATTTATTCTT
54 Noyau ACGAAATATCATAGATTAAGAAACAATGGAACTGA
55 Noyau TTTCATAGTTGTACCGTAACACTGGGGTTTT
56 Noyau AGGAGCGAGCACTAACAACTAAAACCCTATCACCTAACAGTG
57 Noyau CAAAGTATTAATTAGCGAGTTTCGCCACAGAACGA
58 Noyau TGGGGAGCTATTTGACGACTAAATACCATCAGTTT
59 Noyau ATAACGCAATAGTAAAATGTTTAAATCA
60 Noyau ACGAATCAACCTTCATCTTATACCGAGG
61 Noyau TAATGGTTTGAAATACGCCAA
62 Noyau CGGAACAAGAGCCGTCAATAGGCACAGACAATATCCTCAATC
63 Noyau ATTAAAGGTGAATTATCAAAGGGCACCACGG
64 GGCAACCCATAGCGTAAGCAGCGACCATTAA
65 Noyau AGAAACGTAAGCAGCCACAAGGAAACGATCTT
66 Noyau AGAGGTCTTTAGGGGGTCAAAAGGCAGT
67 Noyau GGGGACTTTTTCATGAGGACCTGCGAGAATAGAAAGGAGGAT
68 Noyau TTTTAGAACATCCAATAAATCCAATAAC
69 Noyau AAATGTGGTAGATGGCCCGCTTGGGCGC
70 Noyau ACGGATCGTCACCCTCACGATCTAGAATTTT
71 Noyau CGCCATAAGACGACGACAATAGCTGTCT
72 Noyau GCGTATTAGTCTTTAATCGTAAGAATTTACUN
73 Noyau AGAGAACGTGAATCAAATGCGTATTTCCAGTCCCC
74 Noyau AACGAAAAAGCGCGAAAAAAAGGCTCCAAAAGG
75 Noyau TAATTTAGAACGCGAGGCGTTAAGCCTT
76 Noyau ACCAGGCGTGCATCATTAATTTTTTCAC
77 Noyau CAGCCTGACGACAGATGTCGCCTGAAAT
78 Noyau ATTAGTCAGATTGCAAAGTAAGAGTTAAGAAGAGT
79 Noyau CTCGAATGCTCACTGGCGCAT
80 Noyau GGGCAGTCACGACGTTGAATAATTAACAACC
81 Noyau
82 Noyau TCAACCCTCAGCGCCGAATATATTAAGAATA
83 Noyau ATTATACGTGATAATACACATTATCATATCAGAGA
84 Noyau GCAAATCTGCAACAGGAAAAATTGC
85 Noyau ATAATTACTAGAAATTCTTAC
86 Noyau TATCACCGTGCCTTGAGTAACGCGTCATACATGGCCCCTCAG
87 Noyau AAGTAGGGTTAACGCGCTGCCAGCTGCA
88 Noyau CCAGTAGTTAAGCCCTTTTTAAGAAAAGCAAA
89 Noyau TGGCGAAGTTGGGACTTTCCG
90 CAGTGAGTGATGGTGGTTCCGAAAACCGTCTATCACGATTTA
91 Noyau AAATCAAAGAGAATAACATAACTGAACACAGT
92 Noyau CTGTATGACAACTAGTGTCGA
93 Noyau ATCATAAATAGCGAGAGGCTTAGCAAAGCGGATTGTTCAAAT
94 Noyau TTGAGTAATTTGAGGATTTAGCTGAAAGGCGCGAAAGATAAA
95 Noyau ATAAGAATAAACACCGCTCAA
96 Noyau CGTTGTAATTCACCTTCTGACAAGTATTTTAA
97 Noyau AACCGCCTCATAATTCGGCATAGCAGCA
98 Noyau AAATAGGTCACGTTGGTAGCGAGTCGCGTCTAATTCGC
99 Noyau CAGTATAGCCTGTTTATCAACCCCATCC
100 Noyau TTGCACCTGAAAATAGCAGCCAGAGGGTCATCGATTTTCGGT
101 Noyau CGTCGGAAATGGGACCTGTCGGGGGAGA
102 Noyau AAGAAACTAGAAGATTGCGCAACTAGGG
103 Noyau CCAGAACCTGGCTCATTATACAATTACG
104 Noyau ACGGGTAATAAATTAAGGAATTGCGAATAGTA
105 Noyau CCACGCTGGCCGATTCAAACTATCGGCCCGCT
106 Noyau GCCTTCACCGAAAGCCTCCGCTCACGCCAGC
107 CAGCATTAAAGACAACCGTCAAAAATCA
108 Noyau ACATCGGAAATTATTTGCACGTAAAAGT
109 Noyau CAACGGTCGCTGAGGCTTGATACCTATCGGTTTATCAGATCT
110 Noyau AAATCGTACAGTACATAAATCAGATGAA
111 Noyau TTAACACACAGGAACACTTGCCTGAGTATTTG
112 Noyau AGGCATAAGAAGTTTTGCCAGACCCTGA
113 Noyau GACGACATTCACCAGAGATTAAAGCCTATTAACCA
114 Noyau AGCTGCTCGTTAATAAAACGAGAATACC
115 Noyau CTTAGAGTACCTTTTAAACAGCTGCGGAGATTTAGACTA
116 Noyau CACCCTCTAATTAGCGTTTGCTACATAC
117 Noyau GAACCGAAAATTGGGCTTGAGTACCTTATGCGATTCAACACT
118 Noyau GCAAGGCAGATAACATAGCCGAACAAAGTGGCAACGGGA
119 Noyau ATGAAACAATTGAGAAGGAAACCGAGGATAGA
120 Noyau GGATGTGAAATTGTTATGGGGTGCACAGTAT
121 Noyau GGCTTGCGACGTTGGGAAGAACAGATAC
122 Noyau TAAATGCCTACTAATAGTAGTTTTCATT
123 Noyau TGCCGTCTGCCTATTTCGGAACCAGAATGGAAAGCCCACCAGAAC
124 Noyau TGACCATAGCAAAAGGGAGAACAAC
125 Noyau CGAGCCAGACGTTAATAATTTGTATCA
126 Noyau GCTCAGTTTCTGAAACATGAAACAAATAAATCCTCCCGCCGC
127 Noyau AGACGCTACATCAAGAAAACACTTTGAA
128 Noyau AGTACTGACCAATCCGCGAAGTTTAAGACAG
129 Noyau GATTCCTGTTACGGGCAGTGAGCTTTTCCTGTGTGCTG
130 Noyau GGTATTAAGGAATCATTACCGAACGCTA
131 Noyau GTTCATCAAATAAAACGCGACTCTAGAGGATCGGG
132 Noyau
133 Noyau ACAGAGGCCTGAGATTCTTTGATTAGTAATGG
134 Noyau AACGAGATCAGGATTAGAGAGCTTAATT
135 Noyau TACCAAGTTATACTTCTGAATCACCAGA
136 Noyau CAGTAGGTGTTCAGCTAATGCGTAGAAA
137 Noyau AGGATGACCATAGACTGACTAATGAAATCTACATTCAGCAGGCGCGTAC
138 Noyau TTTCAACCAAGGCAAAGAATTTAGATAC
139 Noyau TTGAAATTAAGATAGCTTAACTAT
140 Noyau CTATTATCGAGCTTCAAAGCGTATGCAA
Noyau CAGGGTGCAAAATCCCTTATAGACTCCAACGTCAAAAGCCGG
142 Noyau GAGCTTGTTAATGCGCCGCTAATTTTAGCGCCTGCTGCTGAA
143 Noyau CGAACGTTAACCACCACACCCCCAGAATTGAG
144 Noyau GTGTGATAAATAAGTGAGAAT
145 Noyau GCTATATAGCATTAACCCTCAGAGA
146 Noyau AGGAGAGCCGGCAGTCTTGCCCCCGAGAGGGAGGG
147 Noyau CGGCCTCCAGCCAGAGGGCGAGCCCCAA
148 Noyau CCAAAACAAAATAGGCTGGCTGACGTAACAA
149 Noyau
150 Noyau ATAAAGGTTACCAGCGCTAATTCAAAAACAGC
151 Noyau ATTGCCCCCAGCAGGCGAAAAGGCCCACTACGTGACGGAACC
152 Noyau TTTTAAAACATAACAGTAATGGAACGCTATTAGAACGC
153 Noyau AATTGGGTAACGCCAGGCTGTAGCCAGCTAGTAAACGT
154 Bord TTACCCAGAACAACATTATTACAGGTTTTTTTTTTTTTTTT
155 Bord TTTTTTTTTTTTTTTTAATAAGAGAATA
156 Bord TTTTTTTTTTTTTTTTCCAGTTTGGGAGCGGGCTTTTTTTTTTTTTTT
157 Bord
158 Bord TTTTTTTTTTTTTTTGATTAAGACTCCTTATCCAAAAGGAAT
159 Bord TTTTTTTTTTTTTTTTCTTCGCTATTACAATT
160 Bord TTTTTTTTTTTTTTTCTTGCGGGAGAAGCGCATTTTTTTTTTTTTTTT
161 Bord TTTTTTTTTTTTTTGGGAATTAGAGAAACAATGAATTTTTTTTTTTTTTT
162 Bord TCAGACTGACAGAATCAAGTTTGTTTTTTTTTTTTTTT
163 Bord TTTTTTTTTTTTTTTGGTCGAGGTGCCGTAAAGCAGCACGT
164 Bord TTTTTTTTTTTTTTTTTTAATCATTTACCAGACTTTTTTTTTTTTTTT
165 Bord TTTTTTTTTTTTTCATTCTGGCCAAATTCGACAACTCTTTTTTTTTTTTT
166 Bord TTTTTTTTTTTTTTTACCGGATATTCA
167 Bord TTTTTTTTTTTTTTTTAGACGGGAAACTGGCATTTTTTTTTTTTTTTT
168 Bord TTTTTTTTTTTTTTTCAGCAAGCGGTCCACGCTGCCCAAAT
169 Bord CTGAGAGAGTTGTTTTTTTTTTTTTTT
170 Bord CAATGACAACAACCATTTTTTTTTTTTTTTT
171 Bord TTTTTTTTTTTTTTTTGAGAGATCTACAAGGAGAGG
172 Bord TCACCAGTACAAACTATTTTTTTTTTTTTTT
173 Bord
174 Bord TAAAGTTACCGCACTCATCGAGAACTTTTTTTTTTTTTTT
175 Bord TTTTTTTTTTTTTTTCACCCTCAGAACCGCC
176 Bord TTTTTTTTTTTTTAGGTTTAACGTCAATATATGTGAGTTTTTTTTTTTTT
177 Bord CCACACAACATACGTTTTTTTTTTTTT
178 Bord TTTTTTTTTTTTTTTGCTAGGGCGAGTAAAAGATTTTTTTTTTTTTTT
179 Bord TTTTTTTTTTTTTTTAGTTGATTCCCAATTCTGCGAACCTCA
180 Bord TTATTTAGAGCCTAATTTGCCAGTTTTTTTTTTTTTTTTT
181 Bord TTTTTTTTTTTTTTTACGGCGGAT
182 Bord TTTTTTTTTTTTTTTATATGCGTTAAGTCCTGATTTTTTTTTTTTTTT
183 Bord TTTTTTTTTTTTTTTACGATTGGCCTTGATA
184 Bord TTTTTTTTTTTTTTTCAACGCCTGTAGCATT
185 Bord TTTTTTTTTTTTTTTGGCTTTGAGCCGGAACGATTTTTTTTTTTTTTT
186 Bord TTTTTTTTTTTTTTTAAGCAAGCCGTTT
187 Bord TTTTTTTTTTTTTATGTGTAGGTAAGTACCCCGGTTGTTTTTTTTTTTTT
188 Bord ATCGTCATAAATATTCATTTTTTTTTTTTTTTTT
189 Bord
190 Bord TTTTTTTTTTTTTGTATTAAATCCTGCGTAGATTTTCTTTTTTTTTTTTT
191 Bord GCCATATAAGAGCAAGCCAGCCCGACTTGAGCCATGGTT
192 Bord GTAGCTAGTACCAAAAACATTCATAAAGCTAAATCGGTTTTTTTTTTTTT
193 Bord ATAACGTGCTTTTTTTTTTTTTTTTTT
194 Bord TTTTTTTTTTTTTTTAAAATACCGAACGAACCACCAGTGAGAATTAAC
195 Bord TTTTTTTTTTTTTTTACAAAATAAACA
196 Bord TTTTTTTTTTTTTTTACAAGAAAAACCTCCCGATTTTTTTTTTTTTTT
197 Bord
198 Bord TTTTTTTTTTTTTCAATTACCTGAGTATCAAAATCATTTTTTTTTTTTTT
199 Bord GGTACGGCCAGTGCCAAGCTTTTTTTTTTTTTTT
200 Bord TTTTTTTTTTTTTTGAATAACCTTGAAATATATTTTATTTTTTTTTTTTT
201 Bord CACTAAAACACTTTTTTTTTTTTTTTT
202 Bord TTTTTTTTTTTTTTTTAACCAATATGGGAACAATTTTTTTTTTTTTTT
203 Bord TACGTCACAATCAATAGAATTTTTTTTTTTTTTT
204 Bord TTTTTTTTTTTTTTTAGAAAGATTCATCAGTTGA
205 Bord TTTTTTTTTTTTTGTGGCATCAATTAATGCCTGAGTATTTTTTTTTTTTT
206 Bord TTTTTTTTTTTTTTTTTGCATGCCTGCATTAATTTTTTTTTTTTTTTT
207 Bord CCAGCGAAAGAGTAATCTTGACAAGATTTTTTTTTTTTTTT
208 Bord TTTTTTTTTTTTTTTGAATCCCCCTCAAATGCTT
209 Bord AGAGGCTGAGACTCCTTTTTTTTTTTTTTTT
210 Bord ACAAACACAGAGATACATCGCCATTATTTTTTTTTTTTTTT
211 Bord TTTTTTTTTTTTTTTCAAGAGAAGGATTAGG
212 Bord TTTTTTTTTTTTTGAATTGAGGAAGTTATCAGATGATTTTTTTTTTTTTT
213 CAGAACAATATTTTTTTTTTTTTTTTT
214 Bord TTTTTTTTTTTTTAGCCGGAAGCATAAAGTGTCCTGGCC
215 Bord TGACCGTTTCTCCGGGAACGCAAATCAGCTCATTTTTTTTTTTTTTTTTT
216 Bord TTTTTTTTTTTTTTTGGTAATAAGTTTTAAC
217 Bord TTTTTTTTTTTTTTGTCTGTCCATAATAAAAGGGATTTTTTTTTTTTTTT
218 Bord TTTTTTTTTTTTTTTCCTCGTTAGAATCAGAGCGTAATATC
219 Bord AATTGCTCCTTTTGATAAGTTTTTTTTTTTTTTT
220 Bord CATCGGACAGCCCTGCTAAACAACTTTCAACAGTTTTTTTTTTTTTTT
221 TTTTTTTTTTTTTTTAACCGCCTCCCTCAGACCAGAGC
222 Bord TCTGACAGAGGCATTTTCGAGCCAGTTTTTTTTTTTTTTT
223 Bord TTTTTTTTTTTTTTTTTTCAGCGGAGTTCCATGTCATAAGG
224 Bord TTTTTTTTTTTTTTTCGCCCACGCATAACCG
225 Bord AATTACTTAGGACTAAATAGCAACGGCTACAGATTTTTTTTTTTTTTT
226 Bord CAAGTTTTTTGGTTTTTTTTTTTTTTT
227 Bord TTTTTTTTTTTTTTTCCTTTAGCGCACCACCGGTTTTTTTTTTTTTTT
228 Bord TTTTTTTTTTTTTTTGAATCGGCCGAGTGTTGTTTTTTTTTTTTTTTT
229 Bord TTTTTTTTTTTTTCATCTTTGACCC
230 Bord TTTTTTTTTTTTTATAATCAGAAAATCGGTGCGGGCCTTTTTTTTTTTTT
231 Bord GATACAGGAGTGTACTTTTTTTTTTTTTTTT
232 Bord TTTTTTTTTTTTTTTGGCGCAGACAATTTCAACTTTTTTTTTTTTTTT
233 Bord GGAGGTTTAGTACCGCTTTTTTTTTTTTTTT
234 Bord TTTTTTTTTTTTTACCGCCAGCCATAACAGTTGAAAGTTTTTTTTTTTTT
235 Bord TTTTTTTTTTTTTTTATAGCAATAGCT
236 Poignées AATAAGTTTTGCAAGCCCAATAGGGGATAAGTTGTGCTACTCCAGTTC
237 Poignées ACATAGCTTACATTTAACAATAATAACGTTGTGCTACTCCAGTTC
238 Poignées CCTTTTTGAATGGCGTCAGTATTGTGCTACTCCAGTTC
239 Poignées CGTAACCAATTCATCAACATTTTGTGCTACTCCAGTTC
240 Poignées CACCAACCGATATTCATTACCATTATTGTGCTACTCCAGTTC
241 Poignées CCACCCTCATTTTCTTGATATTTGTGCTACTCCAGTTC
242 Poignées AACTTTGAAAGAGGAGAAACATTGTGCTACTCCAGTTC
243 Poignées CAAGGCGCGCCATTGCCGGAATTGTGCTACTCCAGTTC
244 Poignées CATAGCCCCCTTAAGTCACCATTGTGCTACTCCAGTTC
245 Poignées TTTCCCTGAATTACCTTTTTTACCTTTTTTGTGCTACTCCAGTTC
246 Poignées AACGGTGTACAGACTGAATAATTGTGCTACTCCAGTTC
247 Poignées GATTCGCGGGTTAGAACCTACCATTTTGTTGTGCTACTCCAGTTC
248 Guides AGAGTAGGATTTCGCCAACATGTTTTAAAAACC
249 Guides ACGGTGACCTGTTTAGCTGAATATAATGCCAAC
250 Guides CGTAGCAATTTAGTTCTAAAGTACGGTGTTTTA
251 Guides GCTTAATGCGTTAAATGTAAATGCTGATCTTGAAATGAGCGTT
252 Guides AAGCCAACGGAATCTAGGTTGGGTTATATAGATTAAGCAACTG
253 Guides TTTAACAACCGACCCAATCGCAAGACAAAATTAATCTCACTGC
254 Guides TTTAGGCCTAAATTGAGAAAACTTTTTCCTTCTGTTCCTAGAT
255 Guides Enlèvement GGTTTTTAAAACATGTTGGCGAAATCCTACTCT
256 Guides Enlèvement GTTGGCATTATATTCAGCTAAACAGGTCACCGT
257 Guides Enlèvement TAAAACACCGTACTTTAGAACTAAATTGCTACG
258 Guides Enlèvement AACGCTCATTTCAAGATCAGCATTTACATTTAACGCATTAAGC
259 Guides Enlèvement CAGTTGCTTAATCTATATAACCCAACCTAGATTCCGTTGGCTT
260 GuiEnlèvement des GCAGTGAGATTAATTTTGTCTTGCGATTGGGTCGGTTGTTAAA
261 Guides Enlèvement ATCTAGGAACAGAAGGAAAAAGTTTTCTCAATTTAGGCCTAAA
262 Portes Gate29 TGGGGCGCGAGCTGAAAAGTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA
263 Portes Gate30 TACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCTGAGAGACTACCTT
264 Portes Gate0 TGATGAGCGTGGATGATACTCAGCCCATTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTCATTTTTGCGGATGG
265 Portes Gate61 ATACAAAAAGCCTGTTTAGTATCTACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA

Tableau 1: Liste de séquences discontinuesutilisé pour construire le nanorobot. Staples 1-153 sont désignés base et constituent l'essentiel de la structure. Staples 154-235 sont désignés bords et sont situés à chacune des extrémités des 61 hélices de la structure. Agrafes Edge contiennent une queue de thymine poly conçu pour éviter l'agrégation des nanorobots. Staples 236-247 sont désignés Poignées et constituent des sites d'accueil de fret. Poignées agrafes ont une région de séquence unique, en les reliant à leur emplacement spécifique de la structure, et une région de séquence consensus qui est utilisé comme site d'ancrage pour les molécules cargo. Staples 248-254 sont désignés Guides et joindre les deux moitiés de l'appareil au cours du processus de recuit. Après la fabrication des Guides sont retirés avec l'ajout d'agrafes Guide de suppression 255-261 (de l'étape 6), laissant l'appareil est verrouillé par les deux capteurs du nanorobot. Séquences de capteurs sont désignés Gates. Chacun des deux capteurs est constitué d'un aptamère PDGF et un brin complémentaire. Pour une EXPOSÉ plus détailléenation voir Ben-Ishay et al. 14 et Douglas et al. 15. Staples sont classés dans le commerce sur trois plaques à 96 puits à fond rond (profonde). Chaque montant de base est normalisée à 10 nmol. A l'exception des séquences de grille, qui nécessitent une purification par HPLC, les agrafes ne nécessitent pas un procédé de purification spécial.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nous avons décrit la fabrication, la purification, et la visualisation de la nanorobot d'ADN. À la suite de la fabrication du châssis hexagonal du dispositif, la fonction de la nanorobot est programmé avec la simple introduction de marchandises spécifique et brins de détection pour le robot qui trouvent facilement leur position désignée en raison de la liaison hydrogène complémentarité avec des sites d'accueil disponible simple brin 14 , 15,22.

Le protocole de fabrication décrit utilise une rampe de recuit lent, qui est généralement utilisé dans notre laboratoire à plier un large éventail de formes d'origami. Si le temps de production devient un facteur clé d'autres protocoles, tels que le protocole de pliage rapide décrit par Sobczak et al. 24 peut être utilisé. Ce protocole est rapporté pour atteindre origami avec des rendements élevés, mais il nécessite un étalonnage pour chaque forme d'origami.

Filtration de Spin est utilisé pour purifier les robots des agrafes en excès. Lors du chargement des scolonne de broches avec des échantillons ou tampon, il faut prendre soin de ne pas endommager la membrane avec la pointe de la pipette. La membrane peut se rompre potentiellement conduire à des rendements considérablement réduits. Il est conseillé de ne pas jeter le accréditives jusqu'à ce que les nanorobots sont visualisés par AGE.

Pour certaine application, un taux de purification élevée est souhaitée; ceci peut être obtenu en répétant la filtration en utilisant la colonne de centrifugation initiale. Pour une pureté encore plus élevée, une nouvelle colonne de spin peut être utilisé, mais cela aura un effet négatif considérable sur les taux de rendement. Autres méthodes pour les structures d'origami d'ADN de purification ont été testés, tels que l'excision du gel d'agarose à la suite de l'électrophorèse et la dialyse d'agrafes en excès. Ces méthodes abouti à faible rendement ou taux de purification pauvres par rapport au protocole décrit. D'autres méthodes, comme la purification à base de PEG-25 et le taux-zonale ultracentrifugation 26 ont pas été testés. Ces méthodes sont signalés à Achieve taux élevés de purification, mais ils résultent soit de mauvais rendements (taux-zonale ultracentrifugation) ou exigent précipitations (basée-PEG) qui peut potentiellement nuire à la forme de nanorobot creux.

Nanorobots sont fabriqués avec des agrafes de guidage qui verrouillent la forme en position fermée afin d'augmenter yeilds de fabrication 15. Il est important d'éliminer ces agrafes en ajoutant Guide agrafes pour la suppression de nanorobots à effectivement ouverts en réponse aux stimuli conçus (PDGF dans le protocole décrit). Agrafes de guidage sont conçus avec une région simple brin de prendre pied pour l'accueil du Guide des agrafes de déménagement qui libèrent les agrafes de guide à travers un processus de déplacement de brin 18 .Ces agrafes devraient être ajoutés à un ratio de 10: 1 molaire à la fin de la purification de l'excès L'étape d'agrafes (étape 4.7) et incubé pendant 2 heures à la température ambiante sur une extrémité sur agitateur de fin.

Visualisation par TEM a été décrit, including uranyle-formate 2% de coloration négative. Comparé à uranyle-acétate, formate uranyle-produit des structures de grains plus fins qui permettent une meilleure résolution de modèles d'origami ADN. Il faut prendre soin que uranyle-formate consolidera si aliquotes sont congelés pendant de longues périodes de temps. Il est conseillé d'utiliser une solution uranyle-formate 2% fraîchement préparé pour la coloration. De meilleures résolutions sont réalisables par l'utilisation de Cryo-TEM 27.

La conception et la fabrication architecturale protocole de base du nanorobot d'ADN sont en fin de compte uniforme et simple. Cependant, une large gamme de flexibilité est offert sous forme de mélanges de fret spécifiques et des brins de détection. En outre, dans une seule population nombreux sous-types peuvent être introduites et de leur stoechiométrie par rapport programmées et optimisées pour répondre aux besoins spécifiques. Même plus réglage fin de la cinétique spécifiques à chaque étape de limitation de vitesse est réalisable avec l'augmentation / réduction de la durée de la double hybridation de fil ou laintroduction d'inadéquation à des postes clés spécifiques. Ce degré élevé de flexibilité avec la facilité de construction permet pour l'ingénierie des dispositifs nanométriques capables d'exécuter des tâches complexes très variées dans un milieu biologique pertinente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs ont rien à révéler.

Acknowledgments

Les auteurs tiennent à remercier S. Douglas pour des discussions et des conseils très précieux, et tous les membres du laboratoire Bachelet pour des discussions utiles et travail. Ce travail est soutenu par des subventions de la Faculté des sciences de la vie et de l'Institut des nanotechnologies et matériaux avancés à l'Université Bar-Ilan.

Materials

Name Company Catalog Number Comments
DNase/RNase free distilled water Gibco 10977
M13mp18 ssDNA scaffold NEB N4040S
10x TAE Gibco 15558-042
1 M MgCl2 Ambion AM9530G
Amicon Ultra 0.5 ml centrifugal filter 100K MWCO Amicon UFC510024
Agarose Promega V3125
TBE buffer Promega V4251
Ethidium bromide 10 mg/ml solution Sigma Aldrich E1510
1 kb DNA marker NEB N3232S
Loading Dye NEB B7021S
uranyl formate polysciences 24762
carbon-coated TEM grids  Science services EFCF400-Cu-50
Thermal Cycler c1000 Touch Bio-Rad
Glow Discharge K100X Emitech
UV table Gel Doc EZ Imager Bio-Rad
NanoDrop 2000c Thermo Scientific
TEM FEI-G12 Tecnai

DOWNLOAD MATERIALS LIST

References

  1. Watson, J. D., Crick, F. H. Genetical implications of the structure of deoxyribonucleic acid. Nature. 171, 964-967 (1953).
  2. Kosuri, S., Church, G. M. Large-Scale de novo. DNA synthesis: technologies and applications. Nature Meth. 11, (5), 499-507 (2014).
  3. Pinheiro, A. V., Han, D., Shih, W. M., Yan, H. Challenges and opportunities for structural DNA nanotechnology. Nature Nanotech. 6, (12), 763-772 (2011).
  4. Seeman, N. C. Nucleic acid junctions and lattices. J Theor Biol. 99, (2), 237-247 (1982).
  5. Chen, J. H., Seeman, N. C. Synthesis from DNA of a molecule with the connectivity of a cube. Nature. 350, (6319), 631-633 (1991).
  6. Wei, B., Dai, M., Yin, P. Complex shapes self-assembled from single-stranded DNA tiles. Nature. 485, (7400), 623-626 (2012).
  7. He, Y., et al. Hierarchical self-assembly of DNA into symmetric supramolecular polyhedra. Nature. 452, (7184), 198-201 (2008).
  8. Yin, P., Hariadi, R. F., Sahu, S., Choi, H. M. T., Park, S. H., Labean, T. H., Reif, J. H. Programming DNA tube circumferences. Science. 321, (5890), 824-826 (2008).
  9. Rothemund, P. W. Folding DNA to create nanoscale shapes and patterns. Nature. 440, (7082), 297-302 (2006).
  10. Dietz, H., Douglas, S. M., Shih, W. M. Folding DNA into twisted and curved nanoscale shapes. Science. 325, (5941), 725-730 (2009).
  11. Douglas, S. M., et al. Self-assembly of DNA into nanoscale three-dimensional shapes. Nature. 459, (7245), 414-418 (2009).
  12. Zhang, F., Nangreave, J., Liu, Y., Yan, H. Structural DNA nanotechnology: state of the art and future perspective. J Am Chem Soc. 136, (32), 11198-11211 (2014).
  13. Douglas, S. M., et al. Prototyping of 3D DNA-origami shapes with caDNAno. Nucleic Acids Res. 37, (15), 5001-5006 (2009).
  14. Ben-Ishay, E., Abu-Horowitz, A., Bachelet, I. Designing a bio-responsive robot from DNA origami. J Vis Exp. (77), e50268 (2013).
  15. Douglas, S. M., Bachelet, I., Church, G. M. A logic-gated nanorobot for targeted transport of molecular payloads. Science. 335, (6070), 831-834 (2012).
  16. Tan, W., Donovan, M. J., Jiang, J. Aptamers from cell-based selection for bioanalytical applications. Chem Rev. 113, (4), 2842-2862 (2013).
  17. Xiang, D., et al. Nucleic Acid Aptamer-Guided Cancer Therapeutics and Diagnostics: The Next Generation of Cancer Medicine. Theranostics. 5, (1), 23-42 (2015).
  18. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat Chem. 3, (2), 103-113 (2011).
  19. Tang, Z., Parekh, P., Turner, P., Moyer, R. W., Tan, W. Generating aptamers for recognition of virus-infected cells. Clin Chem. 55, (4), 813-822 (2009).
  20. Sefah, K., Shangguan, D., Xiong, X., O'Donoghue, M. B., Tan, W. Development of DNA aptamers using Cell-SELEX. Nature Prot. 5, (6), 1169-1185 (2010).
  21. McKeague, M., DeRosa, M. C. Challenges and Opportunities for Small Molecule Aptamer Development. J Nucleic Acids. 2012, (2012).
  22. Amir, Y., et al. Universal computing by DNA origami robots in a living animal. Nature Nanotech. 9, (5), 353-357 (2014).
  23. Castro, C. E., et al. A primer to scaffolded DNA origami. Nature Meth. 8, (3), 221-229 (2011).
  24. Sobczak, J. P., Martin, T. G., Gerling, T., Dietz, H. Rapid folding of DNA into nanoscale shapes at constant temperature. Science. 338, (6113), 1458-1461 (2012).
  25. Stahl, E., Martin, T. G., Praetorius, F., Dietz, H. Facile and scalable preparation of pure and dense DNA origami solutions. Angew Chem Int Ed Engl. 53, (47), 12735-12740 (2014).
  26. Lin, C., Perrault, S. D., Kwak, M., Graf, F., Shih, W. M. Purification of DNA-origami nanostructures by rate-zonal centrifugation. Nucleic Acids Res. 41, (2), (2012).
  27. Bai, X. C., Martin, T. G., Scheres, S. H., Dietz, H. Cryo-EM structure of a 3D DNA-origami object. Proc Natl Acad Sci U S A. 109, (49), 20012-20017 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics