من هو من؟ طرق غير الغازية إلى الجنس بشكل فردي ومارك Altricial الفراخ

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

يوفر هذا البروتوكول مجموعة مريحة من الأساليب، والتي تمكن سريع للغاية، وسهلة وغير الغازية وموثوقة ومنخفضة التكلفة، وتحديد الجنس الجزيئية من الطيور وعلى غير الغازية، سريعة وآمنة ويمكن التعرف عليها بسهولة بمناسبة بعد وقت قصير من الفقس. مطلوب فقط معالجة محدودة من الكتاكيت. هذه الأدوات ملائمة لأساليب يتوافق تماما مع المبادئ التوجيهية-RRR.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

العديد من التجارب تتطلب تحديد النسل في وقت مبكر من الجنس وكذلك وضع العلامات المبكرة لحديثي الولادة للاعتراف الفردية. وفقا للمبادئ التوجيهية الرفق بالحيوان، ينبغي تفضيل تقنيات غير الغازية متى شاءت. في مجموعتنا، ونحن نعمل على أنواع مختلفة من الطيور الأغنية في المختبر أو في الميدان، ونجحنا في تطبيق أساليب غير الغازية لممارسة الجنس وبشكل فردي بمناسبة الكتاكيت. تعرض هذه الورقة غير الغازية أداة مربع شاملة. تلفيق الطيور قبل التعبير عن الصفات الجنسية الثانوية يتطلب جمع المواد DNA الحاملة للPCR. أنشأنا طريقة سريعة وسهلة للطيور الجنس في أي عمر (آخر الفقس) عن طريق استخراج الحمض النووي من مسحات الشدق. ويمكن الحصول على نتائج في غضون 3 ساعات. ليتم قطع الريش أسفل الفردية فرخ وسم في أنماط محددة تسمح بتحديد سريع داخل النظام الفقس. هذه مجموعة من الأساليب ينطبق بسهولة في المختبر القياسية مجهزة ومناسبة خاصة لركينمطلوب ز في الميدان وعدم وجود معدات خاصة لأخذ العينات والتخزين. يتم التقليل من التعامل مع الدجاج ووضع العلامات وتلفيق تقنيات غير الغازية مما يدعم RRR-مبدأ من المبادئ التوجيهية رعاية الحيوان.

Introduction

الاعتراف الفردي، [سإكسينغ والتنميط الجيني هي الشروط الأساسية في مجموعة متنوعة من الدراسات التجريبية. وينبغي الحصول على الحمض النووي والمواد التي تحمل العلامات المواضيع لا لبس فيه (حتى في سن مبكرة) لها تأثير ضئيل على علم وظائف الأعضاء والسلوك، والبقاء على قيد الحياة. كلما كان ذلك ممكنا، وينبغي تجنب الإجراءات الغازية وفقا لمبدأ RRR 1.

أساليب غير الغازية ليست فقط مفيدة للحيوان ولكن أيضا قد تؤدي إلى تحسين البيانات التي تم الحصول عليها كما هي أقل تأثرا من الحيوانات العلاجات.

في الطيور، [سإكسينغ الحمض النووي لا يمكن أن يؤديها على عدد من المواد التي يمكن الحصول عليها غير جراحية مثل فضلات 2، 3،4 الريش أو مسحات الشدق 3،5،9. بغض النظر عن حالة والعمر مسحات الشدق الموضوع هي الأسلوب المفضل ل[سإكسينغ الطيور، لأنها سهلة لتنفيذ، ونادرا ما تفشل والمناولة قصيرة.

حتى الآن، والحمض النووي من مسحات الشدقتم استخراج إما مع مجموعات المتاحة تجاريا 3،6 أو مضيعة للوقت قياسي بروتوكولات استخراج الحمض النووي 3،6-8. مجموعات ليست فقط مكلفة نوعا ما، ولكن يمكن بروتوكولاتها تفرض تحديات للعمل الميداني. بعض التفاصيل الإجرائية، مثل التجفيف وحضانة العينات، ليست عملية في هذا المجال. خصوصا في وضع حيث تتطلب البروتوكولات التجريبية الجنس العلاج تعتمد في وقت مبكر من بضع دقائق الفقس آخر، هناك حث للطريقة سريعة وغير الغازية وموثوقة وسهلة للحصول على نتائج.

عبر أصناف الطيور وقد تم تطوير مجموعة أدوات كبيرة للأفراد بمناسبة 10. مجموعة واسعة من التقنيات المتاحة لحسابات متنوعة من أهداف البحث والأنواع والميزانيات. ومع ذلك، بمناسبة الصقور الصغيرة صغيرة واجهت الباحثين مع تحديات إضافية. في بعض الأنواع (مثل العصفوريات) فراخ صغيرة جدا لتطبيق نطاقات الساق وتتطلب طرق بديلة، والتيلا تغير سلوك الآباء والأبناء. كما الوعي والاهتمام في تحسين الرفاهية والتقنيات في الدراسات الميدانية والمختبرية الحيوان ينمو، واستخدام تقنيات غير الغازية ويشجع بقوة وفضل.

يوفر هذا البروتوكول لذلك، طريقة سريعة، يمكن التعرف عليها بسهولة ومستمرة غير الغازية للاحتفال بشكل فردي الصقور الصغيرة مبكرة جدا قبل تطبيق نطاقات الساق هو ممكن عمليا. يتم إدخال هذه الطريقة لوضع علامات على واحدة من أهم الأنواع نموذج مختبر الطيور، زيبرا فينش (Taeniopygia الرقشاء) 11-13. بروتوكول يتوافق مع جميع الأهداف التي تم نشرها مسبقا لتقنيات بمناسبة الفردية 10 وتم تطبيقه بالفعل بنجاح 14،15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تم تنفيذ كافة الإجراءات وفقا للقانون الألماني لحماية الحيوان (TierSchG).

1. إعداد الكواشف والمواد المستهلكة

  1. إعداد 5٪ (ث / ث) Chelex-100 حل في الماء الصف الجزيئية. إعداد aliquots من 200 ميكرولتر في مستوى رد الفعل أنابيب 1.5 مل. كما يترسب الراتنج Chelex سريع عن تعليق فمن الضروري لإعادة التجانس-تعليق باستمرار أثناء إعداد مأخوذة. فإنه من المستحسن للتحضير 50 ​​مل أو أكثر دفعة واحدة والحفاظ على التعليق المتجانس باستخدام محرك مغناطيسي. ويمكن تخزين الحل Chelex لسنوات في الظروف المحيطة.
  2. قطع قطعة من الورق WHATMAN مع عرض أصغر من عرض منقار الطيور لفحصها. طول الورقة يعتمد على طريقة لأخذ عينة:
    1. باستخدام ملقط، يجب أن تكون قطعة طويلة بما يكفي لتمكين جمع العينات دون ملقط يجري إدراجها في منقار الطير. كما وتقدير تقريبي، لطول المنقار من 0.5 سم قطعة من الورق مع طول 1 سم وينبغي أن يكون على ما يرام.
    2. إذا لم تكن تستخدم ملقط، يجب أن يكون قطعة أطول، ولكن صلابة من قطعة لا يزال ينبغي السماح أخذ عينات من الخلايا الظهارية.
  3. إعداد قسامة واحدة من PCR بريمكس لكل عينة لتحليلها. لPCR في الحجم الكلي لل25 ميكرولتر من مزيج يحتوي على 0.18 ملي dNTPs، 2 مم MgCl 70 ملي تريس، حمض الهيدروكلوريك، كبريتات الامونيوم 17.25 ملم، 0.1٪ توين 20، 0.32 ميكرومتر P2 التمهيدي (TCTGCATCGCTAAATCCTTT)، 0.32 ميكرومتر P8 التمهيدي (CTCCCAAGGATGAGRAAYTG) 16 و 2 وحدة طق البلمرة. محلية الصنع طق البلمرة 17 يمكن استخدامها. للسماح إضافة أكبر قدر ممكن من الحمض النووي الحل، وهو بريمكس 6 ميكرولتر يمكن إعداد وتخزينها في -20 درجة مئوية لعدة أسابيع.

2. جمع العينات

ارتداء القفازات ليست ضرورية لتحديد الجنس الطيور كما الاشعال PCR لا يمكن أن يصلب على الحمض النووي البشري. إلىأغراض أخرى التنميط الجيني قد يكون من المستصوب.

  1. التقاط الطيور من الفائدة وبلطف الاحتفاظ بها في جهة على سبيل المثال مع 'قبضة المسابقة في' 18. تأكد من عدم الضغط على الطيور.
  2. عقد قطعة من الورق WHATMAN مع ملقط وانتقد عدة مرات عبر داخل الخدين، واللسان والمنعر. عادة ما يتم الحصول على العينات في غضون أقل من 30 ثانية.
    1. الحيوانات الكبار: تبعا للأنواع قد يكون من الصعب الحصول على الطيور لفتح منقاره. وعادة ما لمس جانب من منقار وتطبيق ضغط لطيف العمل.
    2. الصقور الصغيرة: أخذ العينات من سلحفاة صغيرة أو الصقور الصغيرة من السهل خاصة باستخدام هذه التقنية، كما يوفر سلوك التسول على سهولة الوصول إلى داخل المنقار. قد يكون من الممكن الحصول على عينة من دون التعامل معها على الإطلاق، لأنها التسول بسهولة على سبيل المثال عندما يتم فتح nestbox بهم.
  3. تخزين فورا الصحيفة في استعداد إحتوى أنبوب رد فعلنينغ 200 ميكرولتر من 5٪ (ث / ث) Chelex-100 الحل.

إذا كنت تنوي أيضا / بحاجة للاحتفال الكتاكيت، تفعل ذلك الآن كما هو موضح في القسم 6.

3. تخزين العينات قبل استخراج الحمض النووي

  1. إذا كان يعمل في المختبر، وعينات تخزينها في -20 درجة مئوية. إذا كان هذا غير ممكن أو صعب (على سبيل المثال في الميدان) عينات تخزينها في درجات الحرارة المحيطة.
  2. ويمكن تخزين العينات لأكثر من 3 سنوات في درجات حرارة تتراوح من درجة حرارة الغرفة إلى -20 درجة مئوية.

4. استخراج الحمض النووي

  1. إذا تم تجميد العينة، ذوبان الجليد في درجة حرارة الغرفة.
  2. تأكد من أن قطعة من الورق على الجزء السفلي من الأنبوب المغمور في حل Chelex-100.
  3. احتضان العينات لمدة 15 دقيقة في 56 درجة مئوية.
  4. لفترة وجيزة دوامة وتدور باستمرار محتوى الأنبوب.
  5. احتضان العينات لمدة 8 دقائق في 100 درجة مئوية.
  6. تدور العينات في 15،000 x ج لمدة 3 دقائق.
  7. استخدام قupernatant عن التنميط الجيني لاحقة.

5. الجزيئية الجنس تقدير

  1. إعداد واحد أنبوب PCR مع 6 ميكرولتر لكل عينة بريمكس بالاضافة الى اثنين من أنابيب إضافية لالسلبية (إلزامي) وإيجابية التحكم (اختياري). لتحديد الجنس الروتيني تشمل عينة من آخر [سإكسينغ ناجحة كعنصر تحكم إيجابية.
  2. إضافة 19 ميكرولتر من طاف من استخراج الحمض النووي للبريمكس PCR. تأكد من ماصة من على سطح الأرض من الحل لتجنب المرحل من الخرز Chelex. هذا أمر بالغ الأهمية، كما هو Chelex مبادل الموجبة، وبالتالي يمنع بشدة جميع التفاعلات الأنزيمية.
  3. تشغيل البرنامج PCR التالية: الحضانة في 94 درجة مئوية لمدة 3 دقائق، كل 45 دورات مع ذوبان الخطوة 30 ثانية 94 درجة مئوية، تليها خطوة الصلب 30 ثانية في 55 درجة مئوية، تليها خطوة استطالة 45 ثانية في 72 ° C. في نهائي مطاردة قبالة الخطوة، يتم تحضين ردود الفعل لمدة 5 دقائق عند 72 درجة مئوية.
  4. إعداد معيار TBE 2٪ أو TAE agaro حد ذاتها هلام لفصل المنتجات PCR.
  5. تشغيل هلام الاغاروز مع إعدادات الجهد المناسب.
  6. تصور العصابات تحت ضوء الأشعة فوق البنفسجية والتقاط صورة. تأكد من يتم فصل اثنين من العصابات في العينات القادمة من الإناث أيضا.
  7. تمييز الذكور من الإناث عينات من وجود واحد (الذكور) أو اثنين (أنثى) العصابات.

6. تمييز الكتاكيت

  1. تحقق أعشاش للالكتاكيت حديثة الفقس على جدول زمني مناسب للأنواع / دراسة (مثل الشيكات يوميا في الصباح وينصح لأن معظم الكتاكيت يفقس ثم).
  2. قطع الريش أسفل كل فرخ داخل العش في مكان سمة مختلفة. في العصافير حمار وحشي خصلات من الهبوط تنمو في أربعة مجالات مميزة ومتميزة في جميع أنحاء الجسم (الشكل 4A) في عشش و. لكل كتكوت خفض منطقة واحدة (الشكل 4B). إذا كان هناك أكثر من أربعة فراخ داخل عش واحد، ويمكن الجمع بين فريدة من نوعها "حلاقة" الأربعة.
ove_content "> للالعصافير حمار وحشي: تطبيق نطاقات الساق في آخر عشرة أيام الفقس عندما تصبح أسفل الريش من الصعب الكشف عن حجم وعشش يسمح الرنين.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ويمكن استخدام مسحات الشدق للحصول على الحمض النووي لتحديد الجنس في مجموعة متنوعة من الطيور الصغيرة

تم جمع عينات من طيور البرقش زيبرا (Taeniopygia الرقشاء، 99 الأفراد، والعمر 0 أيام - 5 سنوات)، جزر الخالدات (Serinus كناريا)، البنغالية طيور البرقش (Lonchura المخططة)، العنادل (megarhynchos Luscinia)، الثدي الكبير (PARUS الكبرى) والبلاكبيرد (Turdus merula) (لجميع الأنواع الأخرى: حجم العينة 1-3، غير معروف العمر) (الشكل 1).

لعينات أخذت من طيور البرقش زيبرا، كان معدل النجاح لتقارير إنجاز المشروعات بنسبة 100٪. نتيجة PCR دائما يقابل الجنس يحدده السابقة (في البالغين) أو في وقت لاحق (في الصقور الصغيرة) التفتيش المظهري. لم شدة العصابات لا تختلف بشكل منهجي بين الصقور الصغيرة أو البالغين مشيرا إلى أن كميات مماثلة من المواد DNA الحاملة والمكتسبة من جميع الأعمار.

الشكل 1 "لل: محتوى العرض =" 6in "FO: SRC =" / files/ftp_upload/51429/51429fig1highres.jpg "سرك =" / files/ftp_upload/51429/51429fig1.jpg "/>
الشكل 1. الجزيئية [سإكسينغ. أمثلة من نتائج [سإكسينغ من مسحات الشدق تم الحصول عليها من أنواع الطيور المختلفة. 2٪ هلام الاغاروز ملطخة بروميد إيثيديوم. من اليسار إلى اليمين: حجم علامة، زيبرا فينش الذكور، البنغالية فينش الإناث، شحرور الذكور، تيط العظمى من الذكور، العندليب الذكور، الذكور الكناري، التحكم في المياه، وحجم علامة.

من المهم لمنع التلوث المرحل Chelex في تقارير إنجاز المشروعات

للتدليل على تأثير تلوث الراتنج Chelex في تفاعل PCR، ونحن شملت كمية صغيرة من حبات Chelex في تفاعل PCR (الشكل 2). كما يمكن أن يرى في الشكل 2A، التلوث المرحل من الخرز Chelex يمنع التضخيم من الحمض النووي الذي يؤكده عدم تشكيل ديمر التمهيدي في العينة الملوثة (<قوي> الشكل 2B). في الشكل 2A 2 لين استخدمنا نفس العينة لPCR دون تحمل اكثر Chelex. العينات الملوثة عادة يتم التعرف عليها بسهولة عن طريق البقع الداكنة في جيوب agarose هلام (الشكل 2B).

الرقم 2
الشكل 2. Chelex التلوث. A) Chelex المرحل في رد فعل PCR يحول دون التضخيم من الحمض النووي. من اليسار إلى اليمين: حجم علامة، زيبرا فينش الذكور، زيبرا فينش الإناث، نفس العينة مع المرحل المتعمد للChelex، التحكم في المياه، وحجم علامة B) حبات Chelex مرئية بسهولة كما تلطيخ الظلام في جيب هلام (يسار دون Chelex ، والحق مع Chelex. ويتضح تثبيط شديد من رد فعل PCR في وجود Chelex أيضا التمهيدي المفقودة دتشكيل IMER في العينة الملوثة.

ويمكن تخزين العينات في درجة حرارة الغرفة قبل استخراج الحمض النووي لأكثر من ثلاث سنوات

من أجل التحقيق في ما إذا كان استخراج الناجحة لا يزال يتعين القيام بها بعد تخزين طويل، وعينات أخذت بشكل متكرر من نفس الطيور وتخزينها في المختبر في درجات الحرارة المحيطة عن الحد الأقصى ثلاث سنوات. تم تخزين العينات على مقربة من نافذة مع التعرض الطبيعي للضوء والحرارة من الشمس. بعد ثلاث سنوات تم استخراج الحمض النووي وإجراء PCR تلفيق. النتيجة مطابقة واحدة يؤديها قبل ذلك بثلاث سنوات (يمين بعد أخذ العينات)، ولم تشير أي تأثير التخزين (الشكل 3).

الرقم 3
الرقم 3. يسمح Chelex التخزين الطويل الأجل للعينات befoتم تخزين إعادة وبعد استخراج الحمض النووي. عينات من حيوانين (يسار الذكور، الإناث حق) في ظل ظروف مختلفة كما هو مبين في الجدول. تم الحصول على إشارات بنجاح من جميع العينات.

الرقم 4
الشكل 4. تمييز الكتاكيت. أ) تمثيل تخطيطي والتسميات من المناطق الأربعة المتميزة للنمو الريش أسفل حمار وحشي في الصقور الصغيرة فينش:. الصور A = الرأس، B = الظهر، C = الأجنحة (على حد سواء)، D = الأجنحة (على حد سواء) B) مثال من الصقور الصغيرة التي إما تلقى واحدة من "حلاقة الشعر على كل من (م) أو لا" حلاقة "(E).

ويمكن تخزين الحمض النووي المستخرج لأكثر من ثلاث سنوات في 4 درجات مئوية

تم تخزين العينات حمار وحشي فينش من التجربة الأولى لمدة ثلاث سنوات في الجمعة المختبر القياسيةDGE في 4 درجات مئوية واختبارها بنجاح. جميع العينات أسفرت نتائج PCR نفس مباشرة بعد استخراج الحمض النووي (الشكل 3).

سلحفاة صغيرة يمكن أن تكون علامة من قبل تقليم الريش أسفل لتمكين الفرد من التعرف على الفقس

بمناسبة الصقور الصغيرة الفردية الحق بعد الفقس عن طريق قطع الريش إلى أسفل جعلهم بسهولة التعرف عليها (الأرقام 4، 5، 6). أسفل الريش لها مظهر رقيق مثل هذه الانتقادات ليست انضمت معا لتشكيل ريشة ناعمة. أنها ما زالت قادرة على أن يعترف في يوم 10 posthatch على نصائح من الريش النامية التي كتبها ثم تغطية الجسم (الشكل 5). غيابهم في مواقع متميزة يجعل من السهل الاعتراف، وأحيانا حتى من دون التعامل مع الصقور الصغيرة (الشكل 6). تطبيق هذه ما يسمى `حلاقة الشعر" هو أسلوب أنيق، والتي تملأ الفجوة بنجاح للمرة من الفقس حتى حجم جسم عشش فينك حمار وحشي[هس] يجعل تطبيق نطاقات الساق ممكنا.

الرقم 5
الرقم 5. المحددة الصقور الصغيرة زيبرا فينش في ​​يوم آخر يفقس 10. تظهر صور الصقور الصغيرة إما مع (مقص) أو بدون (السهم) علامات. ويشير السهم إلى موقع الفائدة وفقا لتسمية كل من "حلاقة" أسفل ريشة: A = الرأس، B = الظهر، C = الأجنحة، D = الأجنحة.

الرقم 6
الرقم 6. الاعتراف الصقور الصغيرة ملحوظ (متوسط ​​العمر = 10 يوما) داخل عش الولادة وفقا لهذه التسميات.A = الرأس، من السهل على الفور بسبب وضعه أسفل الريش بارزة، والتي هي في عداد المفقودين فقط على الرأس. B = الظهر، أسفل الريش واضحة في جميع المواقع ولكن على ظهره. C = الأجنحة، يحتاج مراقب يقظ على حد سواء أجنحة مفقودة أسفل الريش، ولكن عشش في الموقف يجعل الريش أسفل من الرأس تغطية الجناح الأيمن. D = الأجنحة، لا يمكن إلا أن يكون معترف بها من قبل عملية الإزالة كما جنباته لا يمكن رؤيتها. فإنه يمكن التعرف بشكل موثوق كما D لأنه يظهر واضحا أسفل نمو الريش على رأس والظهر وأجنحتها. E = مزيج من رئيس 'حلاقة' (A) والخلفي (B)، من السهل أن نميز كما أسفل الريش على الرأس والظهر مفقودة. F = مزيج من A 'حلاقة' (الرأس) وD (الأجنحة)، والتي لا يمكن إلا أن تكون متباينة من خلال القضاء على خيارات أخرى رئيسا لها بمناسبة واضح ولا عشش مجهولين أخرى يسلك رأس وسم. لم G = لاتلقي أي علامات وأصغر بكثير من الأشقاء، حيث أنه كان آخر ليفقس. بالإضافة إلى ذلك G هو مثال جيد لعشش الذي لا يعبر أسفل الريش في جميع المواقع.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

تلفيق من مسحات الشدق باستخدام Chelex أظهرت نسبة نجاح عالية للغاية. الريش أسفل قطع فقس البيض لتمكين التفريق بين الصقور الصغيرة حتى كان ربط الساق ممكن.

استخراج الحمض النووي من Chelex مسحات الشدق أسفرت عن الحمض النووي كافية لتنفيذ [سإكسينغ الجزيئية بنجاح. كان تحديد الجنس صحيحة 100٪ حسب ما صادق عليه ريش ديمبرافيك جنسيا. نسبة النجاح ذكرت هنا هي أعلى بشكل ملحوظ من معدل ذكرت من قبل اثنين من الدراسات السابقة 7،9. استخراج الحمض النووي مع Chelex يقلل pipetting لوهطول الخطوات التي يمكن أن تضيع المادية. ومع ذلك، واحدة من دراسات التحقق من صحة بروتوكول لدينا في مختلف الأنواع (بوحدات تزويد الطاقة بوحدات تزويد الطاقة) لا يزال حققت أقل معدلات نجاح 89٪ 9 على الرغم من هذا كان بالفعل أعلى بشكل ملحوظ من 82٪ عنها في أريما وآخرون. 7.

ما يمكن أن يكون السبب؟ الجزء الأكثر أهمية هو أن تتبع باهتمام البروتوكول الاضافيocol، بما في ذلك الجزء عن كيفية أخذ عينات (الأنسجة انتقد بلطف عدة مرات في الفم) ومنع ترحيل حبات Chelex في رد فعل PCR. كما Chelex هو مبادل الموجبة فإنه يمنع بشدة رد فعل PCR التضخيم في منع العينات الملوثة. العينات الملوثة يمكن التعرف بسهولة عن طريق الخرز واضحة في جيوب المواد الهلامية الاغاروز وعدم وجود dimers التمهيدي.

أسباب أقل احتمالا لعدم بنجاح يمكن أن تكون عينات الجنس أيضا بسبب الاختلافات بين الأنواع أو استخدام تقنية مختلفة للكشف عن الفرق الفرقة في عينات الإناث.

قطع الريش أسفل من فقس البيض العصافير حمار وحشي هو وسيلة آمنة للاحتفال بشكل فردي المواضيع. كانت هذه "حلاقة الشعر 'السهل على الاعتراف حتى كانت الصقور الصغيرة من العمر ما يكفي لتلقي العصابات الساق المرقمة (على سبيل المثال في يوم 10 في العصافير حمار وحشي). ويمكن تعديل هذه التقنية بمناسبة بسهولة لتلبية مختلف experimمطالب ental؛ على سبيل المثال لتسجيلات الفيديو علامات يمكن أن تقتصر على رأس الكتاكيت. مزيج من التخفيضات على موقعين يمكن تطبيقها إذا أعشاش تكون أكبر من خمسة الصقور الصغيرة. الحفاظ على تسلسل محدد مسبقا في تطبيق "حلاقة" (على سبيل المثال فقس البيض لأول مرة في عش دائما على "حلاقة A '، والثانية دائما على" حلاقة ب' الخ) يسمح الاعتراف بسرعة داخل النظام طوال مرحلة الفقس عشش. وهذا يتيح التعرف السريع، والتي يمكن أن تقلل أو حتى منع التعامل مع الدجاج. في العصافير حمار وحشي، يمكن أن يحدث نقص هبوطا في واحد من المواقع الأربعة بسبب التقلبات الطبيعية. وبالتالي، فإنه قد لا يكون من الممكن دائما التمسك تسلسل علامات محددة مسبقا.

حتى بالنسبة لشخص عديم الخبرة في التعامل مع الصقور الصغيرة أنها سرعان ما تعلم، وآمنة وسهلة لخفض بمناسبة تقنية الريش أسفل. لكن، وكما الاستجابة الفطرية خطيئة من الصقور الصغيرة ويشمل حركات الرأس، وبعض الناس يجدون صعوبة أكبر في وضع مارالملوك على رأسه. يعتمد تحديد الخطأ عرضة على علامات دقيقة. فإنه من الأهمية البارزة لخفض شامل لكامل أسفل الريش في بقعة معينة، وعلامات ناقصة / وحيد اليسار من أسفل الريش قد تخلط في وقت لاحق الهوية.

هذه المجموعة من أساليب تمكن سريع للغاية، وسهلة وغير الغازية وموثوقة ومنخفضة التكلفة، وتحديد الجنس من الطيور وعلى غير الغازية، سريعة وآمنة ويمكن التعرف عليها بسهولة بمناسبة غضون دقائق بعد الفقس.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

والكتاب ليس لديهم ما يكشف.

Acknowledgements

شكرا جزيلا لسيلك كيبر سارة كيفر، مايكل فايس، كوني بارتش وسيلكه فويت-Heucke لجمع العينات حماسا في الميدان، لJanett في Birkenfeld عن المساعدة المستمرة، إلى العلا Kobalz عن المواد الهلامية جميلة وتوبياس كراوس عن الدعم المعنوي.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics