Кто есть кто? Неинвазивные методы, чтобы Индивидуально Секс и Все птенцовых Chicks

Biology

GE Global Research must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Этот протокол обеспечивает удобный набор методов, который позволяет очень быстро, легко, неинвазивный, надежный и недорогой, определение молекулярной секс птиц и их неинвазивный, быстрый, безопасный и легко узнаваемы маркировки вскоре после вылупления. Только ограничивается обработка цыплят требуется. Эта удобная панель инструментов методов соответствует полностью с RRR-принципов.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Многие эксперименты требуют раннего определения пола потомства, а также в начале маркировки новорожденных для индивидуального признания. Согласно требованиям организаций защиты животных, неинвазивные методы, следует отдать предпочтение, когда это применимо. В нашей группе, мы работаем на разных видов певчих птиц в лаборатории и на местах, и мы успешно применять неинвазивные методы к сексу и индивидуально пометить птенцов. Эта статья представляет собой всеобъемлющий неинвазивный окна инструментов. Определение пола птиц до выражения вторичных половых признаков требует сбора ДНК-содержащего материала для ПЦР. Мы создали быстрый и простой способ, чтобы секс птиц любого возраста (после вылупления) путем извлечения ДНК из щечной тампоны. Результаты могут быть получены в течение 3 часов. Для пуховые перья Индивидуальная маркировка птенца отделаны в конкретных моделей, позволяющих быстро идентифицировать в рамках того штриховки. Этот набор методов легко применимы в стандартном оборудованы лаборатории и особенно подходит для работаюг в области как без специального оборудования не требуется для отбора проб и хранения. Обработка цыплят сводится к минимуму и маркировки и определения пола методы неинвазивной тем самым поддерживая RRR-принцип принципов защиты животных.

Introduction

Индивидуальный признание, определение пола и генотипирование фундаментальные предпосылки в различных экспериментальных исследований. Получение ДНК материала подшипника и маркировка предметов однозначно (даже в раннем возрасте) должны иметь минимальное воздействие на физиологии, поведения и выживания. Когда это возможно, инвазивные процедуры следует избегать в соответствии с принципом RRR 1.

Неинвазивные методы являются не только полезно для животного, но и может улучшить полученные данные, как животные менее подвержены влиянию лечения.

У птиц, определение пола ДНК может быть выполнена на ряде неинвазивно, получаемых материалов, как помет, перья 2 3,4 или щечной тампоны 3,5,9. Независимо от состояния и возраста щечной тампоны субъекта являются методом выбора для птичьего определения пола, потому что они легко выполнить, редко не и обращение коротка.

До сих пор, ДНК из щечной тампоныбыл либо экстрагируют коммерчески доступных наборов 3,6 или времени стандартные протоколы выделения ДНК 3,6-8. Комплекты не только довольно дорогие, но их протоколы могут наложить проблем для работы на местах. Некоторые процедурные детали, например, сушка и инкубации образцов, не практичны в этой области. Особенно в условиях, когда экспериментальные протоколы требуют секс зависимой лечение от уже в течение нескольких минут после вылупления, есть стремление к быстрой, неинвазивной, надежный и простой метод получения результатов.

Через птичьего таксонов значительная инструментов для маркировки лиц была разработана 10. Широкий спектр доступных технологий приходится на различных научно-исследовательских целей, видов и бюджетов. Тем не менее, маркировки стрелкового птенцов столкнулась исследователям дополнительные проблемы. У некоторых видов (например, воробьиные) птенцов слишком малы, чтобы применить полосы ног и требуют альтернативных методов, которыене изменяют поведение родителей и потомства. Как осведомленности и заинтересованности в улучшении благосостояния и методы в полевых и лабораторных исследований животных растет, использование неинвазивных методов настоятельно рекомендуется и предпочтительнее.

Этот протокол обеспечивает неинвазивный, быстрый, легко узнаваемый и постоянный метод индивидуально отметить очень молодых птенцов перед нанесением полос ног осуществимо. Этот метод маркировки вводится на одном из самых важных видов птиц лабораторный образец, в Zebra Finch (Taeniopygia Guttata) 11-13. Протокол соответствует всем ранее опубликованных задач для отдельных маркировки методов 10 и уже успешно применяется 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все процедуры были выполнены в соответствии с законодательством Германии для защиты животных (TierSchG).

1. Подготовка реагентов и расходных материалов

  1. Подготовьте 5% (м / м) Chelex-100 решение в молекулярной класса воде. Подготовка аликвоты 200 мкл в стандартных реакционных 1,5 мл пробирки. Поскольку смола Chelex выпадает в осадок быстро из суспензии необходимо повторно гомогенизируют суспензию непрерывно во время приготовления аликвот. Желательно, чтобы подготовить 50 мл или более в одну партию, и держать подвеска гомогенизируют с использованием магнитной мешалки. Решение Chelex могут быть сохранены в течение многих лет в условиях окружающей среды.
  2. Вырезать куски ватмана с шириной меньше ширины клюва птицы, чтобы быть проверены. Длина бумаги зависит от метода, чтобы взять образец:
    1. Использование щипцов, часть должна быть достаточно длинной, чтобы создать условия для сбора образца без щипцов вставляют в клюв птицы. КакГрубая оценка, на длину клюва 0,5 см кусок бумаги с длиной 1 см должна быть тонкой.
    2. Если не с помощью щипцов, часть должна быть больше, но жесткость кусок все равно должны позволить выборку эпителиальных клеток.
  3. Подготовьте аликвоты ПЦР премикса для каждого образца для анализа. Для ПЦР в общем объеме 25 мкл смесь содержит 0,18 мМ дНТФ, 2 мМ MgCl 2, 70 мМ Трис-HCl, 17,25 мМ сульфат аммония, 0,1% Tween-20, 0,32 мкМ праймер Р2 (TCTGCATCGCTAAATCCTTT), 0,32 мкМ P8 праймер (CTCCCAAGGATGAGRAAYTG) 16 и 2 единицы Taq полимеразы. Домашнее Taq полимеразы 17 может быть использован. Чтобы разрешить добавление максимального количества ДНК-раствором, 6 мкл премикс, могут быть получены и хранили при -20 ° С в течение нескольких недель.

2. Отбор проб

Надев перчатки не является необходимым для птичьего определения пола как ПЦР праймеры не могут отжигать в ДНК человека. Длядругих целей генотипирования было бы целесообразно.

  1. Захват птицу интереса и мягко держать его в одной руке, например, с «захватом Рингера '18. Убедитесь, что не выжать птицу.
  2. Держите кусок ватмана с пинцетом и проведите его несколько раз по внутренней стороне щеки, языка и хоаны. Обычно образцы получены в течение менее чем 30 секунд.
    1. Взрослые животные: в зависимости от вида это может быть трудно получить птицу, чтобы открыть свой клюв. Обычно прикасаясь к поверхности клюва и слегка надавливая будет работать.
    2. Птенцы: Отбор проб из птенцов или птенцами особенно легко с помощью этой техники, так как их просить поведение обеспечивает легкий доступ к внутренней части клюва. Это может быть даже можно получить образец без обработки их вообще, так как они легко просить, например, когда их гнездовой ящик открыт.
  3. Сразу хранить бумагу в подготовленном Contai реакционную трубкунин 200 мкл 5% (м / м) Chelex-100 решение.

Если вы также намерены / нужно пометить птенцов, сделайте это сейчас, как описано в разделе 6.

3. Хранение образцов Перед ДНК Добыча

  1. Если работающие в лаборатории, хранить образцы при -20 ° С Если это невозможно или трудно (например, в области) хранить образцы при температуре окружающей среды.
  2. Образцы могут храниться в течение более 3 лет при температурах в диапазоне от комнатной температуры до -20 ° С.

4. ДНК Добыча

  1. Если образец замораживают, оттаивают при комнатной температуре.
  2. Убедитесь, что лист бумаги находится на нижней части трубки, погруженной в раствор Chelex-100.
  3. Инкубируйте образцы в течение 15 мин при 56 ° С
  4. Vortex кратко и спином вниз содержание трубки.
  5. Инкубируйте образцы в течение 8 мин при 100 ° С
  6. Спин образцов при 15000 мкг в течение 3 мин.
  7. Используйте секupernatant для последующего генотипирования.

Молекулярная Определение Секс 5.

  1. Подготовьте ПЦР-пробирку с 6 мкл премикса на образце плюс два дополнительных труб для отрицательной (обязательно) и положительный контроль (опция). Для определения рутинного секса включают образец из последнего успешного определения пола в качестве положительного контроля.
  2. Добавить 19 мкл супернатанта от экстракции ДНК к предварительной смеси ПЦР. Убедитесь, что пипетки от поверхности раствора, чтобы избежать уноса из бисера Chelex. Это очень важно, так как Chelex является катионообменник и, таким образом, резко тормозит все ферментативные реакции.
  3. Выполните следующую программу ПЦР инкубации при 94 ° С в течение 3 мин, 45 циклов каждый с шагом 30 сек плавления 94 ° С, за которым следует стадии отжига 30 сек при 55 ° С, с последующим удлинением шаге 45 сек при 72 ° С. В заключительном Chase выходной шаге Реакционные смеси инкубируют в течение 5 мин при 72 ° С
  4. Подготовьте 2% стандартный КЭ или TAE AGARO себе гель для разделения продуктов ПЦР.
  5. Запустите агарозный гель с соответствующими параметрами напряжения.
  6. Визуализация полосы в УФ-свете и сделать снимок. Убедитесь, что две полосы в образцах, происходящих из самок хорошо разделены.
  7. Различают мужчина от женских образцов наличием одного (мужчина) или двух (розетка) диапазонах.

6. Маркировка Птенцы

  1. Проверьте гнезда для только что вылупившихся цыплят по расписанию, соответствующим видам / учебы (например, ежедневные проверки по утрам рекомендуется, поскольку большинство цыплят люк в то время).
  2. Отрежьте вниз перья каждого птенца в гнезде в другом характерном месте. В зебры зябликов пучки падения растут на четырех характерных и различных районах по всей птенец в тело (рис. 4, а). Для каждого цыпленка разрезать одну область (рис. 4б). Если есть более чем в четыре цыплят в течение одного гнезда, уникальные четыре "стрижки" могут быть объединены.
ove_content "> Для зебры зябликов: Применить полосы ног на десять дней после вылупления, когда пуховые перья становятся трудно обнаружить и птенец размер позволяет звонить.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Щечной тампоны могут быть использованы для получения ДНК для определения пола в различных мелких птиц

Образцы были собраны от Zebra зябликах (Taeniopygia Guttata, 99 лиц, возрастных 0 дней - 5 лет), Канарейки (Serinus Канария), бенгальские Финчес (Lonchura полосатое), Соловьев (Luscinia megarhynchos), большой синицы (Parus Major) и дроздов (Turdus Merula) (для всех других видов: размер выборки 1-3, возраст неизвестных) (рис. 1).

Для образцов, взятых у Zebra зябликах, вероятность успеха для ПЦР составил 100%. Результат ПЦР всегда соответствовала секс определяется до (у взрослых) или поздно (в птенцов) фенотипическая осмотр. Интенсивность полос не было систематически отличаются между птенцов и взрослых, указывающих, что подобные суммы ДНК-содержащего материала можно получить от всех возрастов.

Рисунок 1 "FO: контент-ширины =" 6 дюймов "FO: Пребывание" / files/ftp_upload/51429/51429fig1highres.jpg "Первоначально" / files/ftp_upload/51429/51429fig1.jpg "/>
Рисунок 1. Молекулярная определение пола. Примеры результатов определения пола из щечной тампоны, полученных из различных видов птиц. 2% агарозном геле окрашивали бромистым этидием. Слева направо: маркер размера, Zebra Finch мужчина, бенгальский Финч женщина, Blackbird мужчина, большая синица мужчина, Соловей мужчина, Канарские мужчина, контроль воды, размер маркера.

Важно, чтобы предотвратить загрязнение Chelex переходящий в МКП

Чтобы продемонстрировать эффект Chelex загрязнения смолы в ПЦР-реакции, мы включили небольшое количество шариков Chelex в ПЦР-реакции (рис. 2). Как можно видеть на фиг.2А, перенос загрязнение шариков Chelex предотвращает амплификации ДНК, которые дополнительно проиллюстрировано отсутствие образования димера праймера в загрязненной образца (<сильный> Рисунок 2B). В рис. 2А дорожке 2 мы использовали тот же образец для ПЦР без переноса Chelex. Обычно загрязненные образцы легко узнать по темных пятен в карманах агарозном геле (рис. 2В).

Рисунок 2
Рисунок 2. Загрязнение Chelex. A) Chelex перенос в ПЦР-реакции ингибирует амплификацию ДНК. Слева направо:. Размер маркера, Zebra Finch мужчина, Zebra Finch женщина, тот же образец с преднамеренной переносу Chelex, контроль воды, размер маркера B) легко различимы как темной окраски в кармане геля (слева без Chelex бусы Chelex , прямо с Chelex. Суровый ингибирование ПЦР в присутствии Chelex также иллюстрируется пропавшего грунтовки гImer образование в загрязненной пробе.

Образцы могут храниться при комнатной температуре до выделения ДНК в течение более чем трех лет

Для того чтобы исследовать ли еще может быть выполнена успешно извлечение после длительного хранения были взяты образцы повторно одной птицы и хранится в лаборатории при температуре окружающей среды в течение максимально трех лет. Образцы хранили близко к окну с естественным воздействием света и тепла от Солнца. После трех лет ДНК была извлечена и определения пола ПЦР выполняется. Результат соответствует один выполняется тремя годами ранее (сразу после отбора проб) и не указывают никакого эффекта хранения (рис. 3).

Рисунок 3
Рисунок 3. Chelex позволяет длительное хранение образцов BefoRe и после ДНК-экстракции. Образцы двух животных (самец левой, правой женской) были сохранены в различных условиях, как указано в таблице. Сигналы были успешно получены из всех образцов.

Рисунок 4
Рисунок 4. Маркировка цыплят. А) Схематическое изображение и номенклатура четырех различных областях вниз роста перьев в Zebra Finch птенцов:. = ​​Голова, B = назад, С = крылья (оба), D = фланги (оба) Б) Пример фотографии птенцов, которые либо получил одну из соответствующих «стрижки» (AD) или нет "стрижка" (Е).

Экстрагированной ДНК можно хранить в течение более чем трех лет при 4 ° С

Образцы Zebra Finch от первого эксперимента были храниться в течение трех лет в стандартной лабораторной птDGE при 4 ° С и успешно повторно. Все образцы дали те же результаты ПЦР в качестве непосредственно после экстракции ДНК (рис. 3).

Детеныши могут быть отмечены путем обрезки их вниз перья, чтобы включить индивидуальную признание от вылупления на

Маркировка отдельных птенцов сразу после вылупления, сокращая их вниз перья сделаны их легко узнаваемыми (рис. 4, 5, 6). Вниз перья имеют пушистый вид, как их колкостями не соединены вместе, чтобы сформировать гладкую неподвижны. Они могут еще быть признаны в posthatch день 10 на кончиках развивающихся перьями, которые к тому времени покрывают тело (рис. 5). Их отсутствие в разных местах делает признание легко, иногда даже без перегрузки птенцов (рис. 6). Применяя эти так называемые `стрижки" это элегантный метод, который успешно заполняет пробел на время от не вылупления до размеру тела птенец зебры FincГЭС делает приложение полос ног возможным.

Рисунок 5
Рисунок 5. Помечено Zebra Finch птенцы в сообщение люка 10-й день. Изображения показывают птенцов либо с (ножницами) или без (стрелка) маркировки. Стрелка указывает на местоположение интерес в соответствии с соответствующей номенклатуры 'стрижек "Вниз перо: A = голова, B = назад, C = крыльями, D = фланги.

Рисунок 6
Рисунок 6. Признание отмеченных птенцов (средний возраст = 10 дней) в гнезде внутриутробного в соответствии с номенклатурой.= Голова, легко обнаружить из-за его выдающихся пуху, которые отсутствуют только на голове. B = назад, вниз перья видно во всех местах, но на спине. C = крыльями, нуждается внимательный наблюдатель, как оба крыла не хватает вниз перьев, но птенец Поза делает пуховые перья с головы покрывают правое крыло. D = фланги, могут быть признаны только в процессе ликвидации, как ее фланги не видно. Это может быть надежно признана D, поскольку это показывает ясное темпов роста перьев на голове, назад и ее крылья. Е = комбинацию головы "Стрижки" (А) и обратно (В), легко отличить как вниз перья на голова и спина не хватает. F = комбинацию А 'стрижки "(голова) и D (флангов), которые могут быть дифференцированы только путем ликвидации других вариантов в качестве ее главы маркировки очевидна, и никакой другой неопознанный птенец не проявляет голову маркировки. G = не сделалполучать маркировку и намного меньше, чем его братья и сестры, как это было в прошлом, чтобы люк. Кроме G является хорошим примером для птенца, который не выразить вниз перья во всех местах.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Определение пола из щечной тампоны с использованием Chelex показали чрезвычайно высокий уровень успеха. Пуховые перья резки Детеныш позволила дифференцировать птенцов, пока нога полосы не удалось.

Добыча Chelex-ДНК из щечной тампоны дали достаточно ДНК для успешного выполнения молекулярную Sexing. Определение Секс был на 100% правильно, как подтверждено половой диморфизм оперением. Шанс успеха сообщили здесь заметно выше, чем скорость отчетный двумя предыдущими исследованиями 7,9. Выделение ДНК с Chelex минимизирует пипетирования и осадки шаги, в котором материал может быть потеряна. Тем не менее, одно из исследований тестирующих наш протокол в различных видов (Apus Apus) еще достигается более низкие показатели успеха 89% 9, хотя это было уже заметно выше, чем 82% сообщается в Arima и др.. 7.

Что может быть причиной? Наиболее важной частью является внимательно следить за протocol, в том числе часть о том, как взять образцы (мягко салфетки ткани несколько раз во рту) и предотвратить перенесение бисером Chelex в ПЦР-реакции. Как Chelex является катионообменник это серьезно тормозит ПЦР предотвращая усиление в загрязненных образцов. Загрязненные образцы можно легко узнать по бусы видимых в карманах агарозном геле и отсутствие праймеров димеров.

Менее вероятные причины отказа успешно образцы секс также может быть связано с различиями видов или использования другой технологии для обнаружения разницы полосы в женских образцов.

Резка вниз перья птенцов зебры зябликов является безопасным способом индивидуально отмечать предметы. Были легко распознать эти «стрижки» до птенцы не были достаточно взрослыми, чтобы получить пронумерованные полосы ног (например, на 10-й день в зебры зябликов). Эта маркировка метод может быть легко скорректированы для удовлетворения различных Эксперимental требования; например, для видеозаписей маркировка может быть ограничено главы цыплят. Комбинации сокращений на две позиции могут быть применены, если гнезда больше, чем пять птенцов. Хранение предварительно определенную последовательность в применении «стрижки» (например, первый Детеныш в гнезде всегда получает 'стрижка A', второй всегда получает 'стрижка B' и т.д.) позволяет быстро признание в вылупления порядок во всем птенец фазе. Это позволяет быстро определить, что может снизить или даже предотвратить обработку птенцов. В зебры зябликов, отсутствие падения в одном из четырех местах может произойти из-за естественных колебаний. Таким образом, это не всегда возможно придерживаться заранее определенной маркировки последовательности.

Даже для тех, неопытного в обработке птенцов это быстро, чтобы узнать, безопасный и простой маркировки технику, чтобы сократить вниз перья. Однако, как врожденная зияющие реакция птенцов включает движения головы, некоторые люди считают его более трудным для размещения марцари на голове. Ошибка склонны идентификация основывается на точных маркировки. Это имеет огромное значение для тщательного сократить весь вниз перья в данный месте, как несовершенные маркировки / одиночная левая из пуховые перья могут позже путать идентичность.

Этот набор методов позволяет чрезвычайно быстро, легко, неинвазивный, надежный и недорогой, секс определение птиц и их неинвазивный, быстрый, безопасный и легко узнаваемы маркировки в течение нескольких минут после вылупления.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрывать.

Acknowledgements

Большое спасибо Силке Kipper, Сара Кифера, Майкл Вайсс, Конни Барч и Силке Фойгта-Heucke для восторженной отбора проб в этой области, к Janett Биркенфельд для дальнейшей помощи, к Улла Kobalz для красивых гелей и к Tobias Краузе для моральной поддержки.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics