Hvem er hvem? Ikke-invasive metoder for å Individuelt Sex og Mark altricial Chicks

Biology

GE Global Research must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokollen gir en praktisk sett av metoder, som gjør ekstremt rask, enkel, ikke-invasiv, pålitelig og rimelig, molekylær kjønnsbestemmelse av fugler og deres ikke-invasiv, rask, trygg og lett gjenkjennelig merking kort tid etter klekking. Bare begrenset håndtering av kyllingene er nødvendig. Denne praktiske verktøykasse av metoder oppfyller helt med RRR-retningslinjene.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mange eksperimenter krever tidlig fastsetting av avkom kjønn samt tidlig merking av nyfødte for individuell anerkjennelse. Ifølge retningslinjer dyrevelferd, bør ikke-invasive teknikker bli foretrukket når aktuelt. I vår gruppe, jobber vi på ulike arter av sangfugler i laboratoriet og i felt, og vi lykkes gjelde ikke-invasive metoder til sex og individuelt markere chicks. Dette notatet presenterer en omfattende ikke-invasiv verktøykasse. Sexing fugler før ekspresjon av sekundære seksuelle egenskaper krever innsamling av DNA-bærende materiale for PCR. Vi etablerte en rask og enkel metode for å sex fugler i alle aldre (post klekking) ved å trekke ut DNA fra buccal vattpinner. Resultater kan oppnås i løpet av 3 timer. For individuell merking dama er ned fjær er trimmet i bestemte mønstre som gir rask identifikasjon innen klekking rekkefølge. Dette sett av metoder er lett anvendbar i en standard utstyrt laboratorium, og spesielt egnet for redskapeng på området som ikke spesielt utstyr er nødvendig for sampling og lagring. Håndtering av kyllingene er minimert og merking og kjønnsbestemmelse av teknikker er ikke-invasiv og dermed støtter RRR-prinsippet om retningslinjer dyrevelferd.

Introduction

Individuell anerkjennelse, sexing og genotyping er grunnleggende forutsetninger i en rekke eksperimentelle studier. Innhenting av DNA bærende materiale og merking fag utvetydig (selv i tidlig alder) bør ha minimal påvirkning på fysiologi, atferd og overlevelse. Når det er mulig, bør invasiv prosedyrer unngås i henhold til RRR prinsippet en.

Ikke-invasive metoder er ikke bare gunstig for dyret, men også kan forbedre de innhentede data som dyr er mindre påvirket av behandlingene.

I fugler, kan DNA sexing utføres på en rekke ikke-invasiv oppnåelig materialer som avføring to, fjær 3,4 eller bukkale vattpinner 3,5,9. Uavhengig av motivets tilstand og alder bukkale vattpinner er metoden for valg for aviær sexing, fordi de er enkle å utføre, sjelden mislykkes og håndtering er kort.

Så langt, DNA fra buccal vattpinnerenten ble ekstrahert med kommersielt tilgjengelige kits 3,6 eller tidkrevende standard DNA-ekstraksjon protokoller 3,6-8. Pakkene er ikke bare ganske dyrt, men deres protokoller kan pålegge utfordringer for feltarbeid. Noen prosedyreinformasjon, f.eks tørking og inkubering av prøvene, er ikke praktisk på feltet. Spesielt i en setting der eksperimentelle protokoller krever sex avhengige behandling fra så tidlig som noen minutter etter klekking, det er trang for en rask, ikke-invasiv, pålitelig og enkel metode for å oppnå resultater.

Across the avian taxa en betydelig verktøykasse for merking enkeltpersoner har blitt utviklet 10. Det brede utvalget av tilgjengelige teknikker står for det mangfoldet av forskning mål, arter og budsjetter. Men merking små unger har konfrontert forskere med ekstra utfordringer. I noen arter (f.eks spurve) kyllingene er for små til å anvende band ben, og krever alternative metoder, somendrer ikke foreldre-avkom atferd. Som bevissthet og interesse i å forbedre dyrevelferd og teknikker i felt-og laboratoriestudier er økende, er bruken av ikke-invasive teknikker sterkt oppmuntret og foretrukket.

Denne protokollen gir en ikke-invasiv, rask, lett gjenkjennelig og vedvarende metode for å individuelt markere veldig unge unger før påføring leg band er gjennomførbart. Denne merkingen metoden er innført på en av de viktigste fugle laboratorium modellarter, Zebra Finch (Taeniopygia guttata) 11-13. Protokollen er i samsvar med alle de tidligere publiserte mål for enkeltfag merking teknikker 10 og har blitt allerede vellykket anvendt 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle prosedyrer ble utført i samsvar med tysk lov for dyrevern (TierSchG).

En. Utarbeidelse av reagenser og forbruksvarer

  1. Forbered en 5% (w / w) Chelex-100 løsningen i molekylær grade vann. Forbered alikvoter av 200 pl i standard 1,5 ml reaksjonsrørene. Som Chelex harpiksen utfelles raskt fra suspensjonen er det nødvendig å re-homogenisere suspensjonen hele tiden under fremstillingen av aliquoter. Det er tilrådelig å forberede 50 ml eller mer i en batch og holde suspensjonen homogenisert ved bruk av en magnetrører. Den Chelex oppløsningen kan lagres i årevis ved omgivelsesbetingelser.
  2. Skjær stykker av Whatman-papir med en bredde som er mindre enn nebbet bredden av fuglen som skal testes. Lengden av arket er avhengig av fremgangsmåten for å ta prøven:
    1. Ved hjelp av pinsetter, må stykket være lang nok til å muliggjøre prøvetaking uten tang som blir satt inn i nebbet av fuglen. Som engrovt anslag, for et nebb lengde på 0,5 cm et stykke papir med lengden på en cm bør være i orden.
    2. Hvis ikke ved å anvende pinsett, må stykket være lengre, men stivheten av stykket bør likevel tillate sampling av epitelceller.
  3. Tilbered en alikvot av PCR-premiks for hver prøve som skal analyseres. For en PCR i et totalvolum på 25 pl av blandingen inneholder 0,18 mM dNTPs, 2 mM MgCl 2, 70 mM Tris-HCl, 17.25 mM ammoniumsulfat, 0,1% Tween-20, 0.32 pM primer P2 (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 primer (CTCCCAAGGATGAGRAAYTG) 16 og to enheter Taq polymerase. Hjemmelaget Taq-polymerase 17 kan brukes. For å tillate tilsetningen av den maksimale mengde DNA-oppløsning, kan en 6 mL forblanding fremstilles og lagres ved -20 ° C i flere uker.

2. Prøvetaking

Iført hansker er ikke avgjørende for aviær kjønnsbestemmelse som PCR primere ikke kan varmebehandles til menneskelig DNA. Forandre genotyping formål det kan være tilrådelig.

  1. Fange fugl av interesse og holde den forsiktig i den ene hånden f.eks med "ringe grep '18. Pass på å ikke presse fuglen.
  2. Hold et stykke Whatman papir med en tang og sveiper den flere ganger tvers over innsiden av kinnene, tungen og choana. Vanligvis prøver er oppnådd i løpet av mindre enn 30 sekunder.
    1. Voksne dyr: avhengig av art kan det være vanskelig å få fuglen til å åpne nebbet. Vanligvis berøre siden av nebbet og bruke milde press vil fungere.
    2. Unger: Prøvetaking fra hatchlings eller unger er spesielt enkel å bruke denne teknikken, som deres tigge adferd gir enkel tilgang til innsiden av nebbet. Det kan også være mulig å oppnå at prøve uten å håndtere dem i det hele tatt, da de lett beg f.eks når deres nestbox åpnes.
  3. Umiddelbart lagre papiret i et forberedt reaksjon tube containing 200 ul av 5% (w / w) Chelex-100-løsning.

Hvis du også har tenkt / trenger å markere kyllingene, gjøre det nå som beskrevet i kapittel 6.

Tre. Lagring av prøver før DNA Extraction

  1. Hvis arbeider i laboratoriet, butikk prøver ved -20 ° C. Hvis dette ikke er mulig eller er vanskelig (f.eks i felten) lagre prøver ved omgivelsestemperaturer.
  2. Prøver kan lagres i mer enn tre år, ved temperaturer som varierer fra romtemperatur til -20 ° C.

4. DNA Extraction

  1. Hvis prøven er frosset, tine det ved romtemperatur.
  2. Påse at den del av papiret er på undersiden av røret neddykket i Chelex-100-løsning.
  3. Inkuber prøvene i 15 min ved 56 ° C.
  4. Vortex kort og spinne ned innholdet i røret.
  5. Inkuber prøvene i 8 min ved 100 ° C.
  6. Spin prøvene ved 15 000 x g i 3 min.
  7. Bruk supernatant for påfølgende genotyping.

5. Molekylær kjønnsbestemmelse

  1. Forbered en PCR rør med 6 mL premix per prøve, pluss to ekstra rør for den negative (obligatorisk) og positiv kontroll (valgfritt). For rutinemessig kjønnsbestemmelse inkluderer en prøve fra den siste vellykkede sexing som en positiv kontroll.
  2. Legg 19 pl av supernatanten fra DNA-ekstraksjon i PCR forblandingen. Sørg for å pipettere fra overflaten av løsningen for å unngå overføring av Chelex perler. Dette er avgjørende, som Chelex er en kationbytteren og dermed alvorlig hemmer alle enzymatiske reaksjoner.
  3. Kjør følgende PCR-program: Inkubasjon ved 94 ° C i 3 minutter, 45 sykluser hver med en 30 sek smelte trinn 94 ° C, etterfulgt av en 30 sek glødetrinn ved 55 ° C, etterfulgt av en 45 sek forlengelse trinn ved 72 ° C. I et siste trinn av chase blir reaksjonene inkubert i 5 min ved 72 ° C.
  4. Forbered en 2% standard TBE eller TAE Agaro se gel for å separere PCR-produktene.
  5. Kjør agarosegel med passende spenning innstillinger.
  6. Visual bandene under UV lys og ta et bilde. Pass på at de to bandene i prøvene stammer fra kvinner er godt atskilt.
  7. Skille male fra hunnprøver ved tilstedeværelsen av en (hann) eller to (hunn) bånd.

6. Merking unger

  1. Sjekk reir for nyklekkede kyllinger på en tidsplan som passer for arten / studie (f.eks daglige kontroller i morgen rådes som de fleste kyllingene klekkes da).
  2. Kutt ned fjær i hver chick innenfor et reir på en annen karakteristisk sted. I sebra finker dusker av nedturer vokse med fire karakteristiske og distinkte områder på tvers av nestling kropp (Figur 4A). For hver kylling kuttet ett område (figur 4B). Hvis det er mer enn fire unger i ett reir, de unike fire 'hårklipp' kan kombineres.
ove_content "> For sebra finker: Påfør leg band på ti dager etter klekking når ned fjær blir vanskelig å oppdage og nestling størrelsen gjør at ringing.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Buccal vattpinner kan brukes for å oppnå DNA for kjønnsbestemmelse i en rekke små fugler

Prøvene ble samlet inn fra Zebra Finch (Taeniopygia guttata, 99 enkeltpersoner, alder 0 dager - 5 år), Canaries (Serinus canaria), Bengalske Finches (Lonchura striata), Nightingales (Luscinia megarhynchos), store pupper (Parus major) og Blackbirds (Turdus merula) (for alle andre arter: utvalgsstørrelse 1-3, alder ukjent) (figur 1).

For prøver tatt fra Zebra Finch, var suksessraten for de PCRs 100%. PCR resultatet alltid matchet sex bestemmes av før (hos voksne) eller senere (i unger) fenotypiske inspeksjon. Intensiteten av band skilte seg ikke systematisk mellom unger eller voksne indikerer at tilsvarende mengder DNA holdig materiale er ervervet fra alle aldre.

Figur 1 "fo: content-width =" 6in "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figur 1. Molecular sexing. Eksempler på sexing resultater fra buccal vattpinner hentet fra ulike fuglearter. 2% agarosegel farget med etidiumbromid. Fra venstre til høyre: størrelse markør, Zebra Finch male, Bengalske Finch kvinnelig, Blackbird mann, Kjøttmeis male, Nightingale male, Canary mann, vann-kontroll, størrelse markør.

Det er viktig å hindre at Chelex overføringsforurensning i PCRs

For å demonstrere effekten av Chelex harpiks forurensning i en PCR-reaksjon, inkludert vi en liten mengde av Chelex-perler i en PCR-reaksjon (figur 2). Som kan sees i figur 2A, overføringsforurensning av Chelex-perler hindrer amplifikasjon av DNA som er ytterligere illustrert ved mangelen på primer-dimer dannelse i det forurensede prøven (<strong> figur 2B). I figur 2A kjørefelt to brukte vi det samme utvalget for PCR uten å overføre Chelex. Vanligvis forurensede prøvene er lett gjenkjennelig med mørke flekker i lommene på agarosegel (figur 2B).

Fig. 2
Figur 2. Chelex forurensning. A) Chelex overføring inn i PCR-reaksjonen hemmer amplifisering av DNA. Fra venstre til høyre:. Størrelse markør, Zebra Finch male, Zebra Finch kvinne, samme prøven med tilsiktet overføring av Chelex, vann-kontroll, størrelse markør B) Chelex perler er lett synlige som mørke flekker i lommen på gel (til venstre uten Chelex , rett med Chelex. The alvorlig inhibering av PCR-reaksjonen i nærvær av Chelex er også illustrert ved den manglende primer dimer formasjonen i kontaminerte prøven.

Prøver kan oppbevares ved romtemperatur før DNA-ekstraksjon for mer enn tre år

For å undersøke om vellykket utvinning kan fremdeles utføres etter lang lagring, ble prøvene tatt gjentatte ganger fra den samme fugl og lagres i laboratoriet ved romtemperatur i maksimalt tre år. Prøvene ble lagret i nærheten av et vindu med naturlig eksponering for lys og varme fra solen. Etter tre år DNA ble ekstrahert og sexing PCR utføres. Resultatet samsvarte med en gjennomført tre år tidligere (rett etter prøvetaking) og indikerte ikke noen effekt av lagring (figur 3).

Figur 3
Figur 3. Chelex tillater langtidslagring av prøver before og etter DNA-ekstraksjon. Prøver av to dyr (mannlig venstre, kvinnelig høyre) ble lagret under ulike forhold som angitt i tabellen. Signaler ble innhentet vellykket fra alle prøvene.

Figur 4
Figur 4. Merking av kyllinger. A) Skjematisk fremstilling og nomenklatur av de fire forskjellige områder av ned fjær vekst i sebra finch unger:. A = hodet, B = tilbake, C = vinger (begge), D = flankene (begge) B) Eksempel bilder av unger som enten fikk en av de respektive 'hårklipp' (AD) eller no 'hårklipp' (E).

Utvunnet DNA kan lagres i mer enn tre år ved 4 ° C

Zebra finch prøver fra det første eksperimentet ble lagret i tre år i en standard laboratorium frdge ved 4 ° C og hell testet på nytt. Alle prøver ga de samme PCR-resultater som direkte etter DNA-ekstraksjon (figur 3).

Hatchlings kan markeres ved å trimme sine ned fjær for å muliggjøre individuell anerkjennelse fra klekking på

Merking enkelte unger rett etter klekking ved å kutte sine ned fjær gjort dem lett gjenkjennelig (figur 4, 5, 6). Ned fjær har en luftig utseende som sine mothaker er ikke bundet sammen og danner en jevn skovl. De kan fortsatt bli gjenkjent på posthatch dag 10 på tuppen av utviklings fjær, som da dekker kroppen (figur 5). Deres fravær på forskjellige steder gjør anerkjennelse lett, noen ganger også uten håndtering av unger (figur 6). Bruk av disse såkalte `hårklipp 'er en elegant teknikk, som vellykket fyller gapet for tiden fra klekking til kroppsstørrelse på lunt zebra FINChes gjør anvendelsen av leggbånd bart.

Figur 5
Figur 5. Merket Zebra Finch unger på post luke dag 10. Bildene viser unger enten med (saks) eller uten (pil) tegninger. En pil peker på plasseringen av interesse i henhold til de respektive nomenklatur av dun fjær 'hårklipp': A = hode, B = tilbake, C = vinger, D = flankene.

Figur 6
Figur 6. Anerkjennelse av merkede unger (gjennomsnittsalder = 10 dager) innenfor natal reir i henhold til tolltariffen.A = hode, lett å få øye på grunn av hans prominente ned fjær, som kun mangler på hodet. B = tilbake, ned fjær synlig alle steder, men på baksiden. C = vinger, trenger en oppmerksom observatør som begge vingene mangler ned fjær, gjør men lunt holdning de ned fjær fra hodet dekke høyre ving. D = flankene, kan bare bli gjenkjent av elimineringsprosess som sine flankene ikke kan sees. Det kan bli pålitelig anerkjent som D som det viser klart ned fjær vekst på hodet, ryggen og vingene. E = en kombinasjon av 'hårklipp' hode (A) og rygg (B), er lett å skille så ned fjær på hodet og ryggen mangler. F = en kombinasjon av 'hårklipp' A (hode) og D (flankene), som bare kan differensieres gjennom å eliminere andre alternativer som leder sin merking er åpenbar, og ingen annen uidentifisert Nestling viser et hode merking. G = gjorde ikkemotta eventuelle markeringer og er mye mindre enn sine søsken som det var den siste til å klekke. I tillegg G er et godt eksempel for en nestling som ikke uttrykke ned fjær på alle steder.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sexing fra buccal vattpinner bruker Chelex viste en svært høy suksessrate. Cutting hatchling er ned fjær aktivert differensiering mellom unger inntil beinet banding var mulig.

Chelex-DNA-ekstraksjon fra buccal vattpinner ga nok DNA til å kunne utføre molekylær sexing. Kjønnsbestemmelse var 100% korrekt så validert av seksuelt dimorphic fjærdrakt. Suksessraten rapportert her er markert høyere enn raten rapportert av to tidligere studier 7,9. Den DNA-ekstraksjon med Chelex minimerer pipettering og nedbørs skritt i hvilket materiale kan gå tapt. Men en av studiene validerer vår protokoll i en annen art (Apus Apus) fortsatt oppnådde en lavere suksessrate på 89% 9, selv om dette var allerede klart høyere enn 82% rapporterte i Arima et al. 7.

Hva kan være årsaken? Den mest avgjørende del er å oppmerksomt følge protocol, inkludert den delen for hvordan å ta prøver (forsiktig sveip vev flere ganger i munnen), og for å hindre at overhenget av Chelex perler inn i PCR reaksjonen. Som Chelex er en kationbytter det alvorlig hemmer PCR-reaksjonen hindre forsterkning i forurensede prøver. Forurensede prøvene kan lett gjenkjennes av perler synlige i lommene på agarosegeler og mangel på primer dimer.

Mindre sannsynlige årsaker til svikt for å kunne sex prøvene kunne også skyldes artsforskjeller, eller bruken av en annen teknologi for å detektere bandet forskjellen i de kvinnelige prøvene.

Kutte ned fjær av hatchling sebra finker er en trygg måte å individuelt markere fag. Disse "hårklipp" var lett å kjenne igjen inntil unger var gammel nok til å motta nummererte leg band (f.eks på dag 10 i sebra finker). Denne merkingen teknikken kan lett justeres for å møte forskjellige experimental krav, for eksempel for videoopptak markeringer kan være begrenset til hodet av kyllingene. Kombinasjoner av kutt på to posisjoner kan brukes hvis reir er større enn fem unger. Holde en forhåndsdefinert sekvens i å anvende 'hårklipp' (f.eks den første hatchling i et reir alltid mottar 'hårklipp A, den andre alltid får' hårklipp B "osv.) gir rask anerkjennelse innen klekking orden gjennom fjellandsbyer fase. Dette sikrer rask identifisering, noe som kan redusere eller hindre håndtering av kyllinger. I sebra finker, kan mangel på nedturer på en av de fire steder oppstå på grunn av naturlige svingninger. Således kan det ikke alltid være mulig å holde seg til en forhåndsbestemt merkesekvens.

Selv for noen uerfarne i å håndtere unger det er en raskt å lære, trygg og enkel merking teknikk for å kutte ned fjær. Men som det medfødte gapende respons av unger inkluderer hodebevegelser, noen mennesker finner det mer vanskelig å plassere markonger på hodet. Feil utsatt identifikasjon er avhengig av presise markeringer. Det er av største viktighet å grundig kutte hele ned fjær på et gitt sted, som ufullkomne merking / singel ned venstre-out fjær kan senere forvirre identitet.

Dette settet av metoder muliggjør ekstremt rask, enkel, ikke-invasiv, pålitelig og lave kostnader, kjønnsbestemmelse av fugler og deres ikke-invasiv, rask, trygg og lett gjenkjennelig merking i løpet av minutter etter klekking.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgements

Mange takk til Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch og Silke Voigt-Heucke for entusiastiske prøvetaking i felt, til Janett Birkenfeld for fortsatt bistand, til Ulla Kobalz for de vakre gels og til Tobias Krause for moralsk støtte.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics