Hvem er hvem? Ikke-invasive metoder til individuelt Sex og Mark Altricial Chicks

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokol giver en bekvem sæt af metoder, der gør det muligt ekstremt hurtig, nem, non-invasive, pålidelig og billig, molekylær kønsbestemmelse af fugle og deres ikke-invasiv, hurtig, sikker og let genkendelig mærkning kort tid efter klækning. Kun begrænset håndtering af kyllinger er påkrævet. Denne bekvemme værktøjskasse af metoder opfylder helt med RRR-retningslinjer.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mange eksperimenter kræve tidlig bestemmelse af afkom køn samt tidlig mærkning af nyfødte for individuel anerkendelse. Ifølge retningslinjer for dyrevelfærd bør ikke-invasive teknikker blive foretrukket, når det er relevant. I vores gruppe arbejder vi på forskellige arter af sangfugle i laboratoriet og i marken, og vi med succes anvende ikke-invasive metoder til sex og individuelt markere kyllinger. Denne artikel præsenterer en omfattende ikke-invasiv værktøjskasse. Kønsbestemmelse fugle før ekspression af sekundære seksuelle træk kræver indsamling af DNA-bærende materiale til PCR. Vi har etableret en hurtig og nem metode til sex fugle af enhver alder (post udklækning) ved at udvinde DNA fra buccale svaberprøver. Resultater kan opnås inden for 3 timer. For individuel mærkning chick s dun er trimmet i bestemte mønstre giver hurtig identifikation inden udklækning orden. Dette sæt af metoder er let anvendelig i en standard udstyret laboratorium og specielt velegnet til Working på banen, da ikke særligt udstyr er påkrævet for prøveudtagning og opbevaring. Håndtering af kyllinger minimeres og mærkning og kønsbestemmelse teknikker er ikke-invasiv derved understøtte RRR-princippet om retningslinjer for dyrevelfærd.

Introduction

Individuel anerkendelse, kønsbestemmelse og genotypebestemmelse er grundlæggende forudsætninger i en lang række eksperimentelle studier. Indhentning af DNA bærende materiale og mærkning emner entydigt (selv i en tidlig alder) bør have minimal indflydelse på fysiologi, adfærd og overlevelse. Når det er muligt, bør invasive procedurer undgås i henhold til RRR princip 1..

Ikke-invasive metoder er ikke kun til gavn for dyret, men også kan forbedre de opnåede data dyr påvirkes mindre af behandlingerne.

Hos fugle kan DNA kønsbestemmelse udføres på en række ikke-invasivt opnåelige materialer som ekskrementer 2, fjer 3,4 eller bukkale podninger 3,5,9. Uanset fagets tilstand og alder buccale svaberprøver er den foretrukne metode for aviær kønsbestemmelse, fordi de er nemme at udføre, sjældent mislykkes og håndtering er kort.

Hidtil DNA fra buccale svaberprøverenten blev ekstraheret med kommercielt tilgængelige kits 3,6 eller tidskrævende standard DNA ekstraktionsprotokoller 3,6-8. Kits er ikke kun temmelig dyrt, men deres protokoller kan pålægge udfordringer for markarbejde. Nogle proceduremæssige detaljer, fx tørring og inkubation af prøver, er ikke praktisk i marken. Især i en indstilling, hvor forsøgsprotokoller kræver sex afhængig behandling fra så tidligt som et par minutter efter udklækning, er der trang til en hurtig, non-invasive, pålidelig og nem metode til at opnå resultater.

På tværs af aviær taxa en betydelig værktøjskasse til mærkning individer er blevet udviklet 10. Den brede vifte af tilgængelige teknikker tegner sig for de forskellige forsknings målsætninger, arter og budgetter. Men mærkning små unger har konfronteret forskere med ekstra udfordringer. I nogle arter (f.eks spurvefugle) kyllinger er for små til at anvende ben bands og kræver alternative metoder, somikke ændrer forældre-afkom adfærd. Som bevidsthed og interesse i at forbedre dyrevelfærd og teknikker i marken og laboratorieundersøgelser er stigende, er brugen af ​​ikke-invasive teknikker opfordres kraftigt og foretrækkes.

Denne protokol giver en non-invasiv, hurtig, let genkendelig og vedvarende metode til individuelt at markere meget unge unger, før du anvender benbånd er muligt. Denne mærkning metode indføres på en af de vigtigste fugle laboratorium modelarter, Zebra Finch (Taeniopygia guttata) 11-13. Protokollen overholder alle de tidligere offentliggjorte mål for de enkelte mærkning teknikker 10 og er allerede blevet anvendt med succes 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedurer blev udført i overensstemmelse med den tyske lov om dyrebeskyttelse (TierSchG).

1.. Fremstilling af reagenser og forbrugsartikler

  1. Forbered en 5% (w / w) Chelex-100 løsning i molekylærbiologisk kvalitet vand. Der forberedes delprøver på 200 ul i standard 1,5 ml reagensglas. Som Chelex harpiks udfældes hurtigt fra suspensionen er det nødvendigt at re-homogenisere suspensionen konstant under udarbejdelsen af ​​de udtagne. Det er tilrådeligt at fremstille 50 ml eller mere i et parti og holde suspensionen homogeniseret ved hjælp af en magnetisk omrører. Chelex Opløsningen kan opbevares i årevis ved omgivelsesbetingelser.
  2. Udskårne stykker Whatman-papir med en bredde mindre end næb bredden af ​​fuglen, der skal testes. Længden af ​​papiret afhænger af den metode til at tage prøven:
    1. Ved hjælp af pincet bør stykke være lang nok til at muliggøre samling af prøver uden tangen bliver indsat i næb fugl. Somgroft skøn for en næb længde på 0,5 cm et stykke papir med længden af ​​1 cm bør være fint.
    2. Hvis det ikke ved hjælp af pincet må stykket være længere, men stivhed af stykket skal stadig tillade prøveudtagning af epitelceller.
  3. Forbered en portion af PCR premix til hver prøve, der skal analyseres. For en PCR i et samlet volumen på 25 pi blandingen indeholder 0,18 mM dNTP'er, 2 mM MgCl2, 70 mM Tris-HCI, 17,25 mM ammoniumsulfat, 0,1% Tween-20, 0,32 uM P2 primer (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 primer (CTCCCAAGGATGAGRAAYTG) 16 og 2 enheder Taq-polymerase. Hjemmelavet Taq-polymerase og 17 kan anvendes. For at tillade tilsætning af den maksimale mængde af DNA-løsning, kan en 6 pi premix forberedes og opbevares ved -20 ° C i flere uger.

2.. Prøvetagning

Iført handsker er ikke afgørende for aviær kønsbestemmelse som PCR primere ikke kan anneale til menneskelig DNA. Forandre genotypebestemmelse formål kan det være tilrådeligt.

  1. Fang fuglen af renter og forsigtigt holde den i den ene hånd med f.eks den "Ringers grip '18. Sørg for ikke at klemme fuglen.
  2. Hold et stykke Whatman papir med en pincet og knalde det flere gange på tværs af indersiden af ​​kinderne, tungen og choana. Normalt prøver opnås inden for mindre end 30 sekunder.
    1. Voksne dyr: afhængigt af arten kan det være svært at få fuglen til at åbne næbbet. Normalt rører siden af ​​næbet og anvende let tryk vil arbejde.
    2. Unger: Prøveudtagning fra larver eller unger er særlig let at bruge denne teknik, da deres tiggeri adfærd giver nem adgang til den indvendige side af næbbet. Det kan endda være muligt at få prøven uden at afvikle dem på alle, da de let tigge fx når deres redekasse åbnes.
  3. Umiddelbart opbevare papiret i en forberedt reaktion rør containing 200 pi 5% (w / w) Chelex-100-opløsning.

Hvis du også har til hensigt / brug for at markere de kyllinger, så gør det nu, som beskrevet i afsnit 6.

3.. Opbevaring af prøver Før DNA Extraction

  1. Hvis der arbejder i laboratoriet, gemme prøver ved -20 ° C. Hvis dette ikke er muligt eller vanskeligt (fx i marken) opbevare prøver ved omgivelsestemperaturer.
  2. Prøver kan opbevares i mere end 3 år ved temperaturer fra stuetemperatur til -20 ° C.

4.. DNA Extraction

  1. Hvis prøven er frosset, optø ved stuetemperatur.
  2. Sikre, at det stykke papir er på bunden af ​​røret nedsænket i Chelex-100-opløsning.
  3. Inkuber prøver i 15 min ved 56 ° C.
  4. Vortex kort og spin ned indholdet af røret.
  5. Inkuber prøverne for 8 min ved 100 ° C.
  6. Spin prøverne ved 15.000 xg i 3 min.
  7. Brug supernatant til efterfølgende genotypebestemmelse.

5.. Molekylær kønsbestemmelse

  1. Forbered et PCR-rør med 6 pi premix per prøve plus to ekstra rør til den negative (obligatorisk) og positiv kontrol (ekstraudstyr). Til rutinemæssig kønsbestemmelse omfatter en prøve fra sidste vellykkede kønsbestemmelse som en positiv kontrol.
  2. Tilføj 19 ul af supernatanten fra DNA-ekstraktion til PCR-forblandingen. Sørg for at pipettere fra overfladen af ​​løsningen for at undgå overførsel af Chelex perler. Dette er afgørende, da Chelex er en kationbytter og dermed alvorligt hæmmer alle enzymatiske reaktioner.
  3. Kør følgende PCR-program: Inkubation ved 94 ° C i 3 minutter, 45 cykler, hver med en 30 sek smeltepunkt trin 94 ° C, efterfulgt af en 30 sek annealingstrin ved 55 ° C, efterfulgt af en 45 sek forlængelse ved 72 ° C. I et sidste chase fra trin reaktionerne inkuberes i 5 minutter ved 72 ° C.
  4. En 2% standard TBE eller TAE Agaro SE gel til at adskille PCR-produkterne.
  5. Kør agarosegelen med passende spænding indstillinger.
  6. Visualiser bands under UV-lys og tage et billede. Sørg for, at de to bands i prøverne stammer fra hunner er godt adskilt.
  7. Skelne mand fra kvindelige prøver ved tilstedeværelsen af ​​en (mandlig) eller to (kvinde) bånd.

6.. Mærkning unger

  1. Tjek reder for nyklækkede kyllinger på en tidsplan passende for arten / studie (f.eks daglig kontrol i formiddag rådes som de fleste kyllinger klækkes da).
  2. Skær ned fjer i hver kylling i en rede på en anden karakteristisk placering. I zebrafinker totter af nedture vokse med fire karakteristiske og særskilte områder på tværs af nestling krop (figur 4A). For hver kylling skære et område (figur 4B). Hvis der er mere end fire kyllinger inden en rede, de unikke fire "haircuts" kan kombineres.
ove_content "> For zebrafinker: Påfør benbånd til ti dage efter klækning når dun bliver svært at opdage og nestling størrelse gør ringer.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Buccale vatpinde kan bruges til at opnå DNA til kønsbestemmelse i en række små fugle

Prøver blev indsamlet fra Zebrafinker (Taeniopygia guttata, 99 individer, alder 0 dage - 5 år), De Kanariske Øer (Serinus canaria), Bengalese Finches (Lonchura striata), nattergale (Luscinia megarhynchos), musvit (Parus major) og Blackbirds (Turdus merula) (for alle andre arter: stikprøve størrelse 1-3, alder ukendt) (Figur 1).

For prøver fra zebrafinker, succesraten for PCR'erne var 100%. PCR-resultat altid matchede køn bestemmes ved forudgående (hos voksne) eller senere (i unger) fænotypisk inspektion. Intensiteten af ​​båndene ikke systematisk afviger mellem unger eller voksne tyder på, at tilsvarende mængder af DNA-bærende materiale er opnået fra alle aldre.

Figur 1 "fo: content-width =" 6tommer "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Fig. 1. Molekylær kønsbestemmelse. Eksempler på kønsbestemmelse resultater fra buccale podninger opnået fra forskellige fuglearter. 2% agarosegel farvet med ethidiumbromid. Fra venstre til højre: størrelse markør, Zebra Finch mandlig, Bengalese Finch kvinde, Blackbird mandlig, Musvit mandlig, Nightingale mandlig, Canary mandlig, vandkontrol, størrelse markør.

Det er vigtigt at forhindre Chelex fremførsel kontaminering i PCR'er

For at demonstrere effekten af Chelex harpiks forurening i en PCR-reaktion, vi inkluderet en lille mængde af Chelex perler i en PCR-reaktion (figur 2). Som det kan ses i figur 2A, fremførsel kontaminering af Chelex perler forhindrer amplifikation af DNA, som er yderligere illustreret af manglen på primer-dimer-dannelse i den forurenede prøve (<strong> Figur 2B). I figur 2A bane 2 brugte vi den samme prøve til PCR uden fremførsel Chelex. Normalt forurenede prøver er let genkendelige med mørke pletter i lommerne på agarosegelen (figur 2B).

Figur 2
Figur 2. Chelex forurening. A) Chelex fremførsel i PCR-reaktionen hæmmer opformering af DNA. Fra venstre til højre:. Størrelse markør, Zebra Finch mandlig, Zebra Finch kvindelige, samme prøve med forsætlig overførsel af Chelex, vandkontrol, størrelse markør B) Chelex perler er umiddelbart synlige som mørke pletter i lommen på gelen (venstre uden Chelex , højre med Chelex. Den alvorlige hæmning af PCR-reaktionen i nærværelse af Chelex illustreres også af den manglende primer dimer dannelse i forurenet prøve.

Prøver kan opbevares ved stuetemperatur, før DNA-ekstraktion i mere end tre år

For at undersøge, om en vellykket udvinding stadig kan udføres efter lang tids opbevaring, blev prøver udtaget gentagne gange fra den samme fugl og opbevares i laboratoriet ved omgivende temperaturer i maximalt tre år. Prøverne blev opbevaret tæt på et vindue med naturlig eksponering for lys og varme fra solen. Efter tre år blev ekstraheret DNA, og kønsbestemmelse PCR udført. Resultatet matchede ene udførte tre år tidligere (lige efter prøvetagning) og indikerede ikke nogen effekt af lagring (Figur 3).

Figur 3
Figur 3.. Chelex tillader langtidsopbevaring af prøver before og efter DNA-ekstraktion. Prøver af to dyr (mandlig venstre, kvindelige højre) blev opbevaret under forskellige betingelser som angivet i tabellen. Signaler blev opnået med succes fra alle prøver.

Figur 4
Figur 4.. Mærkning af kyllinger. A) Skematisk repræsentation og nomenklatur af de fire forskellige områder af ned fjer vækst i zebra finke unger:. A = hoved, B = tilbage, C = vinger (begge), D = flanker (begge) B) eksempel billeder af unger, som enten modtog en af ​​de respektive »haircuts« (AD) eller nej 'haircut' (E).

Ekstraherede DNA kan opbevares i mere end tre år ved 4 ° C

Zebra finke prøver fra det første eksperiment blev opbevaret i tre år i en standard laboratorium freDGE ved 4 ° C og med held testes igen. Alle prøver givet de samme PCR-resultater så direkte efter DNA-ekstraktion (Figur 3).

Hatchlings kan markeres ved at trimme deres dun for at muliggøre individuel anerkendelse fra klækning på

Mærkning individuelle unger lige efter klækning ved at skære deres ned fjer gjort dem let genkendelige (figur 4, 5, 6). Ned fjer har en fluffy udseende som deres modhager ikke sammen for at danne en glat vinge. De kan stadig blive anerkendt på posthatch dag 10 på spidsen af udviklingslandenes fjer, som ved så dækker kroppen (figur 5). Deres fravær på forskellige steder gør anerkendelse let, nogle gange endda uden at håndtere unger (Figur 6). Anvendelsen af ​​disse såkaldte `haircuts« er en elegant teknik, som med succes udfylder hullet for den tid fra klækning indtil kropsstørrelse nestling zebra Finches gør anvendelsen af ​​benbånd muligt.

Figur 5
Figur 5.. Markeret Zebra Finch unger hos Post luge dag 10. Billeder viser unger enten med (saks) eller uden (pil) aftegninger. En pil peger på placeringen af renter i henhold til den respektive nomenklatur ned fjer 'haircuts ": A = hoved, B = ryg, C = vinger, D = fløjene.

Figur 6
Figur 6.. Anerkendelse af afmærkede unger (gennemsnitsalder = 10 dage) inden for det natal reden efter nomenklaturen.A = hoved, let at få øje på grund af hans fremtrædende dun, som kun mangler på hovedet. B = tilbage, ned fjer synlig på alle steder, men på bagsiden. C = vinger, har brug for en opmærksom iagttager, da begge fløje mangler ned fjer, men putter kropsholdning gør dun fra hovedet dække højre. D = flanker, kan kun anerkendes af udelukkelsesmetoden som dens flanker ikke kan ses. Det kan opgøres pålideligt indregnes som D, da det viser klart ned fjer vækst på hovedet, ryggen og dens vinger. E = en kombination af 'haircuts' hoved (A) og tilbage (B), er let at skelne som ned fjer på hoved og ryg mangler. F = en kombination af 'haircuts' A (hoved) og D (flanker), som kun kan differentieres ved at fjerne andre muligheder som leder mærkning er indlysende, og ingen anden uidentificeret nestling udviser en hoved-mærkning. G = ikke gjordemodtage markeringer og er meget mindre end sine søskende, da det var den sidste til at klække. Derudover G er et godt eksempel på en nestling der ikke udtrykker ned fjer på alle lokaliteter.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kønsbestemmelse fra buccale svaberprøver hjælp Chelex viste en meget høj succesrate. Skæring Hatchling s dun aktiveret differentiering mellem unger indtil benet banding var muligt.

Chelex-DNA-ekstraktion fra buccale podninger viste nok DNA til med succes at udføre molekylær kønsbestemmelse. Kønsbestemmelse var 100% korrekt som valideret seksuelt dimorfe fjerdragt. Succesraten rapporteret her er markant højere end den sats, rapporteret af to tidligere studier 7,9. DNA ekstraktion med Chelex minimerer pipettering og nedbørsforhold trin i hvilket materiale kan gå tabt. Men en af de undersøgelser, der underbygger vores protokol i en anden art (Apus apus) stadig opnået en lavere succesrate på 89% 9 selvom det allerede var markant højere end de 82% målt i Arima et al. 7..

Hvad kunne være årsagen? Det mest afgørende del er at opmærksomt følge protocol, herunder den del for hvordan man kan tage prøver (forsigtigt knalde væv flere gange i munden) og for at forhindre overførsel af Chelex perler ind i PCR-reaktionen. Som Chelex er en kationbytter det alvorligt hæmmer PCR reaktionen forhindrer forstærkning i forurenede prøver. Kontaminerede prøver kan let genkendes af perler synlige i lommerne på agarosegeler og manglen på primerdimerer.

Mindre sandsynlige årsager til manglende succes sex prøver kan også skyldes artsforskelle eller brug af en anden teknologi til at opdage bandet forskel på de kvindelige prøver.

Skæring ned fjer af Hatchling zebrafinker er en sikker måde at individuelt markere emner. Disse »haircuts« var let at genkende indtil unger var gammel nok til at modtage nummererede benbånd (fx på dag 10 i zebrafinker). Denne mærkning teknik let kan justeres til at opfylde forskellige experimENTAL krav, fx til video optagelser markeringer kan begrænses til lederen af kyllinger. Kombinationer af nedskæringer på to positioner kan anvendes, hvis reder er større end fem unger. Holde en foruddefineret sekvens i at anvende »haircuts« (f.eks første Hatchling i en rede modtager altid 'haircut A', den anden modtager altid 'haircut B' osv.) giver mulighed for hurtig anerkendelse inden for udrugning orden hele nestling fase. Dette muliggør hurtig identifikation, der kan reducere eller helt forhindre håndtering af kyllinger. I zebrafinker, kan mangel på downs på et af de fire steder opstå på grund af naturlige udsving. Således kan det ikke altid være muligt at holde sig til en foruddefineret mærkning sekvens.

Selv for en person uerfarne i håndtering unger er det en hurtigt at lære, sikker og nem mærkning teknik til at skære ned fjer. Men som det medfødte gabende reaktion unger omfatter hoved bevægelser, nogle mennesker finder det sværere at placere markonger på hovedet. Fejl tilbøjelige identifikation bygger på præcise markeringer. Det er yderst vigtigt at grundigt skære hele ned fjer på en given plet, som ufuldkomne markeringer / enkelt venstre-out ned fjer senere kan forvirre identitet.

Dette sæt af metoder muliggør ekstremt hurtigt, nemt, non-invasive, pålidelig og billig, kønsbestemmelse af fugle og deres ikke-invasiv, hurtig, sikker og let genkendelig mærkning inden for få minutter efter udrugning.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at afsløre.

Acknowledgements

Mange tak til Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch og Silke Voigt-Heucke for entusiastiske prøvetagning i marken, til Janett Birkenfeld for fortsat bistand, Ulla Kobalz for de smukke geler og Tobias Krause for moralsk støtte.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics