Kim kimdir? Non-invaziv yöntemler Bireysel Seks ve Mark altricial Civcivler

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu protokol son derece hızlı, kolay, non-invaziv, güvenilir ve düşük maliyetli sağlayan yöntemlerin uygun bir dizi, kuşların moleküler cinsiyet tayini ve non-invaziv, hızlı, güvenli ve kolayca tanınabilir kısa yumurtadan çıktıktan sonra işaretleme sağlar. Civcivlerin sadece sınırlı bir işleme gerek yoktur. Yöntemlerden Bu kullanışlı araç RRR-kurallarına tamamen uygundur.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Birçok deneyler erken yavrusunun seks belirlenmesi yanı sıra erken bireysel tanınması için yenidoğanların işaretleme gerektirir. Uygulanabilir olduğunda hayvan refahı kurallarına göre, non-invaziv teknikler tercih edilmelidir. Bizim grupta, biz laboratuvarda ve alanda şarkı kuşların farklı türler üzerinde çalışmak ve başarılı seks için non-invaziv yöntemler uygulanır ve ayrı ayrı civciv işaretleyin. Bu kağıt kapsamlı bir non-invaziv alet kutusu sunar. Kuş cinsiyet tayini önce ikincil cinsel özelliklerinin ifadesi için PCR için DNA-içeren malzemenin toplanmasını gerektirir. Biz bukkal sürüntü DNA ayıklamak herhangi bir yaşta (sonrası kuluçka) cinsiyeti kuşlar için hızlı ve kolay bir yöntem kurmuştur. Sonuçlar, 3 saat içinde elde edilebilir. Bireysel işaretleme civcivin aşağı tüyleri kuluçka düzen içinde hızlı tanımlanmasına izin veren özel desenler kesilmiş için. Yöntemler Bu set, standart donanımlı bir laboratuvarda kolaylıkla uygulanabilir ve çalışıyorsun için uygundurözel bir donanım olarak alanında g numune alma ve depolama için gereklidir. Civcivlerin taşınması minimize ve işaretleme ve sexing teknikleri böylece hayvan refahı kurallar RRR-prensibini destekleyen non-invaziv olmasıdır.

Introduction

Bireysel tanıma, cinsiyet tayini ve genotiplendirme deneysel çalışmaların çeşitli temel şartlardır. DNA taşıyan malzemenin elde edilmesi ve (hatta erken yaşta) açıkça konular işaretleme fizyoloji, davranış ve yaşam üzerinde çok az etkiye sahip olmalıdır. Mümkün olduğunda, invazif prosedürler RRR prensibine 1 'e göre kaçınılmalıdır.

Non-invazif yöntemler sadece hayvan için faydalı değil, aynı zamanda daha az hayvan tedavi etkilenen olarak elde edilen verileri geliştirmek olabilir.

Kuşlarda, DNA cinsiyet tayini pisliği 2, tüy 3,4 veya bukkal bezlerden 3,5,9 non-invazif elde edilebilen malzemeler bir dizi üzerinde gerçekleştirilebilir. Onlar yapmak kolay, çünkü ne olursa olsun kişinin durumu ve yaşı yanak bezlerden kuş cinsiyet tayini için tercih edilen yöntem nadiren başarısız ve işleme kısa, vardır.

Bukkal sürüntü Şimdiye kadar, DNAya da ticari olarak temin edilebilir kitler 3,6 veya zaman, standart DNA ekstre etme protokolleri 3,6-8 alıcı ile ekstre edilmiştir. Kitler sadece oldukça pahalı, ancak bunların protokolleri alan çalışması için zorluklar getirebilir. Bazı usul bilgilerini, örneğin kurutma ve numune inkübasyonu, alanında pratik değildir. Özellikle deneysel protokolleri gibi erken bir kaç dakika sonrası kuluçka gibi seks bağımlı tedavi gerektiren bir ortamda, sonuçlar elde etmek için hızlı, non-invaziv, güvenilir ve kolay bir yöntem için teşvik var.

Kuş takson karşısında işaretleme kişiler için önemli bir araç 10 geliştirilmiştir. Mevcut tekniklerin geniş bir dizi araştırma hedefleri, türlerin ve bütçelerin çeşitli hesapları. Ancak, küçük yavrumuz işaretleme ek zorluklar araştırmacıların karşı karşıya gelmiştir. Bazı türlerde (örneğin ötücü) Civcivler bacak bantları uygulamak için çok küçük ve alternatif yöntemler, gerektirenebeveyn-çocuk davranışını değiştirmez. Bilinci ve hayvan refahı ve saha ve laboratuvar çalışmalarında tekniklerini geliştirmeye ilgi büyüyor gibi, non-invaziv tekniklerin kullanımı önemle teşvik ve tercih edilmektedir.

Bu protokol tek bacak bantları uygulamadan önce çok genç yavrumuz işaretlemek için bir non-invaziv, hızlı kolayca tanınabilir ve kalıcı yöntem sağlar mümkündür. Bu işaretleme yöntemi en önemli kuş laboratuar model türlerinden biri, Zebra Finch (canlıdır Taeniopygia guttata) 11-13 tanıtıldı. Bu protokol tek işaretleme teknikleri 10 için daha önce yayınlanan hedefleri her uygundur ve daha önce başarılı bir şekilde 14,15 uygulanmıştır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tüm işlemler hayvan koruma (TierSchG) için Alman yasalarına uygun olarak yapılmıştır.

Reaktifler ve Sarf 1. Hazırlanması

  1. Moleküler sınıf su içinde% 5 (a / a) Chelex-100 çözeltisi hazırlayın. Standart 1.5 ml'lik tepkime tüpleri içinde 200 ul alikotları hazırlayın. Chelex reçine süspansiyondan hızla çökelir olarak, alikotları hazırlanması sırasında sürekli olarak yeniden homojenize süspansiyon için gereklidir. Bu, bir toplu 50 ml ya da daha fazla hazırlamak ve manyetik bir karıştırıcı kullanılarak homojenize süspansiyon tutmak için tavsiye bulunuyor. Chelex Çözelti, ortam şartlarında yıl boyunca saklanabilir.
  2. Test edilecek olan kuşun gaga genişliğinden daha küçük bir genişliğe sahip Whatman kağıt parçaları kesin. Kağıdın uzunluğu örnek almak için yönteme bağlıdır:
    1. Forseps kullanılarak, parça kuşun gaga sokulmaksızın forseps olmadan örnek toplama işlemini sağlamak için yeterince uzun olmalıdır. Askaba bir tahmin, 0.5 cm'lik bir gaga uzunluğu boyunca 1 cm uzunluğundaki bir kağıt parçası ince olmalıdır.
    2. Forseps kullanarak değil ise, parça daha uzun olması gerekir, ancak parçanın sertliği yine de epitel hücrelerinin örnekleme izin vermelidir.
  3. Analiz edilecek her bir örnek için PCR ön-karışımın bir kısım hazırlayın. 25 ul bir toplam hacim içinde bir PCR için, karışım 0.18 mM dNTP, 2 mM MgCl2, 70 mM Tris-HCI, 17.25 mM amonyum sülfat,% 0.1 Tween-20, 0.32 uM P2 primer (TCTGCATCGCTAAATCCTTT), 0.32 uM P8 içerir primer (CTCCCAAGGATGAGRAAYTG) 16 ve 2 birim Taq polimerazi. Ev yapımı Taq polimeraz 17 kullanılabilir. DNA-çözeltisi azami miktarının ilave edilmesini sağlamak için, bir ön-karışım, 6 ul birkaç hafta içinde hazırlanır ve -20 ° C'de muhafaza edilebilir.

2.. Örnek Toplama

Eldivenleri giyerek, PCR primerleri, insan DNA tavlanacak değil gibi kuş cinsiyet tespiti için gerekli değildir. IçinDiğer genotiplendirme amaçlar bu tavsiye olabilir.

  1. Ilgi kuş yakalama ve yavaşça 'ringer kavrama' 18 ile bir yandan örneğin tutun. Kuş sıkmak için değil emin olun.
  2. Forseps ile Whatman bir parça kağıt tutun ve yanaklar, dil ve kohananın iç çapında bunu birkaç kez kuvvetlice vurun. Genellikle numuneleri en az 30 saniye içinde elde edilir.
    1. Yetişkin hayvanlar: türe bağlı olarak bu gagasını açmak için kuş almak zor olabilir. Genellikle gaga yan dokunmadan ve nazik bir basınç uygulayarak çalışır.
    2. Yavrusu: yavru veya nestlings gelen Örnekleme kendi yalvarıyor davranışları gaga iç kolay erişim sağladığı gibi, bu tekniği kullanarak özellikle kolaydır. Onların nestbox açıldığında onlar kolayca örneğin dilenmek gibi Hatta hiç ellemeden olmadan numunesi elde etmek mümkün olabilir.
  3. Hemen hazırlanmış bir reaksiyon tüpü contai kağıdı saklayın% 5 lama 200 ul (a / a) Chelex-100 çözeltisi.

Ayrıca / düşünüyorsanız 6. bölümde anlatıldığı gibi şimdi bunu yapmak, civciv işaretlemek gerekir.

DNA Ekstraksiyon önce Örnekleri 3. Depolama

  1. -20 ° C'de laboratuvarda çalışan, mağaza örnekleri Bu ortam sıcaklıklarında mağaza örnekleri mümkün veya (alanında) örneğin zor değilse.
  2. Numuneler, oda sıcaklığı ila 20 ° C arasında değişen bir sıcaklıkta en fazla 3 yıl boyunca saklanabilir

4. DNA Ekstraksiyon

  1. Numune donmuş ise, oda sıcaklığında çözdürün.
  2. Kağıt parçası Chelex-100 çözeltisine batırılmış tüp alt olduğundan emin olun.
  3. 56 ° C'de 15 dakika boyunca inkübe edin
  4. Vortex kısaca ve tüpün içeriğini aşağı doğru döndürün.
  5. 100 ° C'de 8 dakika boyunca inkübe edin
  6. 3 dakika boyunca 15,000 xg'de örnekleri Spin.
  7. S kullanındaha sonra genotipleme için upernatant.

5.. Moleküler Seks Tayini

  1. Numune başına 6 ul premiks artı negatif (zorunlu) ve pozitif kontrol (opsiyonel) için iki ek tüpleri ile bir PCR tüpü hazırlayın. Rutin cinsiyet tayini için bir pozitif kontrol olarak son başarılı cinsiyet tayini bir örnek sayılabilir.
  2. PCR ön-karışıma DNA ekstraksiyon gelen süpernatan 19 ul ekle. Chelex boncuk taşınmasını önlemek için bir çözüm yüzeyinden pipetle emin olun. Chelex bir katyon değiştirici olduğunu ve bu yüzden ciddi bir şekilde tüm enzimatik reaksiyonları inhibe eder, bu durum çok önemlidir.
  3. 3 dakika, 72 ° C de 45 saniye uzama adımı ve ardından 55 ° C de 30 saniye tavlama adımı, ardından 30 saniye erime aşama 94 ° C, 45 döngü her biri için 94 ° C 'de inkübasyon: Aşağıdaki PCR programı çalıştır C. Bir son aşama takip kapalı olarak, reaksiyonlar, 72 ° C'de 5 dakika boyunca kuluçkalanır
  4. % 2 standart TBE veya TAE Agaro hazırlayın PCR ürünleri ayırmak için jel se.
  5. Uygun voltaj ayarları ile agaroz jel çalıştırın.
  6. UV ışık altında bantları görselleştirmek ve bir resim çekin. Kadınlarda kaynaklı örneklerde iki bant iyi ayrılmış olduğundan emin olun.
  7. Bir (erkek) ya da iki (kadın) bantların varlığı ile kadın örnekleri erkek ayırt.

6.. Yavrumuz İşaretleme

  1. Türler / çalışma için bir zamanlama uygun üzerinde yeni yumurtadan civciv için yuvalarını kontrol edin (en civcivler sonra yumurtadan gibi sabahları örneğin günlük kontroller tavsiye edilir).
  2. Farklı karakteristik bir yerde bir yuva içinde her civciv aşağı tüyleri kesin. Zebra ispinoz içinde çıkışlar püskülleri yavru vücut (Şekil 4A) genelinde dört karakteristik ve farklı alanlarda büyür. Her civciv için bir alan (Şekil 4B) kesti. Bir yuvanın içinde dörtten fazla civciv varsa, benzersiz dört 'kesimi' kombine edilebilir.
zebra ispinoz için> "ove_content: aşağı tüyleri algılamak ve yavru boyutu zil verir zor olunca, aşılamadan on gün de bacak bantları uygulayın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bukkal çubuklar küçük kuş çeşitli seks belirlenmesi için DNA elde etmek için kullanılabilir

, Kanaryalar (Serinus Canaria), Bengalese Finches (Lonchura striatalar), Bülbüller (Luscinia megarhynchos), Büyük Göğüsler (Parus major) ve Karatavuk (Turdus - Numuneler Zebra Finches (5 yıl canlıdır Taeniopygia guttata, 99 bireyler, yaş 0 gün) toplandı merula) (diğer tüm türler için: örneklem büyüklüğü 1-3 yaş bilinmiyor) (Şekil 1).

Zebra Finches alınan numuneler için, PCR'ler için başarı oranı% 100 idi. PCR sonucu her zaman (nestlings in) fenotipik muayene (erişkinlerde) önce veya daha sonra tarafından belirlenen seks eşleşti. Bantlarının yoğunluğu DNA taşıyan malzemenin benzer miktarları her yaştan itibaren elde belirten nestlings veya yetişkin arasında sistematik bir fark yoktu.

Şekil 1 "fo: İçerik-width =": / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>" src = fo "6in
Şekil 1.. Moleküler cinsiyet tayini. Çeşitli kuş türlerinden elde yanak sürüntü cinsiyet tayini sonuçlarının örnekleri. % 2 agaroz jeli, etidyum bromür ile boyanmıştır. Soldan sağa: boyut işaretleyici, Zebra Finch erkek, Bengalese Finch kadın, Blackbird erkek, Büyük Baştankara erkek, Nightingale erkek, Kanarya erkek, su kontrolü, boyut işaretleyici.

Bu PCR reaksiyonlarında Chelex kontaminasyon önlemek için önemlidir

Bir PCR reaksiyonunda Chelex reçine kirlilik etkisini göstermek için, bir PCR reaksiyonunda Chelex boncuk küçük bir miktar (Şekil 2) dahildir. Şekil 2A'da görüldüğü gibi, Chelex boncuk kontaminasyon ayrıca, kirlenmiş numunede primer dimer formasyonu (eksikliği ile görüntülenmiştir DNA amplifikasyon <önlerstrong> Şekil 2B). Şekil 2A, şerit 2'de, Chelex üzerinde taşıyan olmaksızın PCR için aynı örnek kullanılır. Genellikle kontamine örnekler agaroz jel (Şekil 2B) ceplerinde karanlık noktalar ile kolayca tanınır.

Şekil 2,
Şekil 2.. Chelex kirlenme. A) PCR reaksiyonu içine Chelex ertelenmiş DNA'nın amplifikasyonunu inhibe eder. Soldan sağa:. Boyutu işaretleyici, Zebra Finch erkek, Zebra Finch kadın, Chelex kasıtlı taşınmadan aynı numune, su kontrolü, boyut işaretleyici B) Chelex boncuk Chelex olmadan sol jel cebinde koyu boyama (gibi kolayca görülebilir Sağ Chelex ile. Chelex mevcudiyetinde PCR reaksiyonunun ciddi inhibisyonu ayrıca eksik primer d görüntülenmiştirkirlenmiş numunede imer oluşumu.

Numuneler üç yıldan fazla DNA ekstre edilmeden önce, oda sıcaklığında saklanabilir

Başarılı bir şekilde uzaklaştırılması yine de uzun süreli depolama sonrası gerçekleştirilebilir olup olmadığını incelemek için, örneğin aynı kuş alındı ​​ve art arda maksimum üç yıl çevre sıcaklıklarında laboratuarda muhafaza edilmiştir. Numuneler, güneş ışığı ve ısı doğal maruz kalma ile yakın bir pencereye depolanmıştır. Üç yıl sonra DNA ekstre edilmiş ve sexing PCR gerçekleştirildi. Sonuç olarak bir ila üç yıl önce (sağ numune alındıktan sonra) yapıldı ve depolama etkisi (Şekil 3) işaret etmemiştir eşleşti.

Şekil 3,
Şekil 3.. Chelex befo örneklerinin uzun süreli depolanmasına olanakTabloda gösterildiği gibi, iki hayvan (male sol, sağ dişi) ve DNA yeniden-ekstraksiyon işleminden sonra. Örnekler, farklı koşullar altında depolanmıştır. İşaretler Tüm örneklerde başarıyla elde edilmiştir.

Şekil 4,
Şekil 4. Civciv işaretlenmesi. A) şematik gösterimi ve zebra ispinoz nestlings aşağı tüy büyüme dört farklı alanlarda isimlendirilmesi:. Nestlings A = başkanı, B = geri, C = kanatlar (her ikisi de), D = yanları (her ikisi de) B) Örnek resim ya da hangi ilgili 'saç kesimleri' (AD) veya 'hayır' saç traşı '(E) birini aldı.

Edilen DNA 4 ° C'de üç yıldan fazla süreyle saklanabilir

İlk deneyde Zebra ispinoz numuneleri standart bir laboratuvar Cum üç yıl boyunca saklandı4 ° C 'de ve başarılı bir şekilde dge yeniden test edilir. Bütün örnekler, doğrudan DNA ekstraksiyonu (Şekil 3) sonra, aynı PCR sonuçları vermiştir.

Yavru çıkım bireysel tanıma sağlamak için onların aşağı tüyleri kırparak tarafından işaretlenmiş olabilir

Sağ onların aşağı tüyleri kesim tarafından yumurtadan çıktıktan sonra tek tek yavrumuz İşaretleme (Şekil 4, 5, 6) bunları kolayca tanınabilir yaptı. Aşağı tüy kendi dikenler gibi yumuşak bir görünüme sahip düzgün bir kanatçığı oluşturmak üzere bir araya değildir. Onlar hala o zaman vücut (Şekil 5) kapsayacak gelişmekte olan tüyler, ipuçları posthatch 10. günde kabul edilebilir. Farklı yerlerde Onların yokluğu hatta bazen yavrularını (Şekil 6) taşıma olmadan, tanıma kolaylaştırır. Bu sözde `saç kesimi 'uygulayarak başarıyla zebra FINC yavru vücut büyüklüğüne kadar kuluçkalık zaman boşluğu dolduruyor zarif bir tekniktir,hes bacak bantları uygulanması mümkün hale getirir.

Şekil 5,
Mesajı ambar 10. günde Şekil 5.. İşaretli Zebra Finch Yavrusu. Resimler (makas) ile veya (ok) işaretleri olmadan ya yavrumuz göstermektedir. A = kafa, B = geri, C = kanatlar, D = yanları: Bir ok tüyü 'saç kesimleri' arasında kendi terminolojisine göre ilgi konuma işaret.

Şekil 6,
Terminolojisine göre doğum yuva içinde işaretlenmiş nestlings Şekil 6. Tanıma (yaş = 10 gün demek).Iki kanadı eksik olarak sadece kafasına eksik nedeniyle yaptığı önemli tüyü fark etmek kolay A = kafa,. B = geri, aşağı tüyler tüm görünür yerlerde ama geri. C = kanatlarında, bir özenli gözlemci ihtiyacı tüyler aşağı, ama en yavru duruş kafasından aşağı tüyler sağ kanadı kapak yapar. kendi fıçılar görülemez gibi D = fıçılar, sadece eleme süreci tarafından kabul edilebilir. O baş aşağı berrak tüy büyüme gösterir gibi güvenilir D olarak kabul edilebilir, sırt ve kanatları. E Geri (B) 'saç tıraşı' başı (A) ve bir arada = ilgili olarak aşağı tüyleri ayırt etmek kolaydır baş ve sırt eksik. F yalnızca işaretleme onun başkanı olarak, diğer seçenekleri eleme yoluyla ayırt edilebilir 'saç tıraşı' A (baş) ve D (yanları), bir arada = açıktır ve hiçbir diğer tanımlanamayan yavru işaretleme kafa sergiler. G = vermediherhangi bir işaret almak ve yumurtadan son olarak kardeşleri çok daha küçüktür. Ayrıca G, tüm lokasyonlarda tüyleri aşağı ifade etmeyen bir yuvalama için iyi bir örnektir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Chelex kullanarak bukkal sürüntü sexing son derece yüksek bir başarı oranı gösterdi. Bacak bantlama mümkün oldu kadar kesme yavru aşağı tüyleri nestlings arasındaki farklılaşmayı sağladı.

Bukkal sürüntü Chelex-DNA ekstraksiyon başarıyla moleküler cinsiyet tayini yapmak için yeterli DNA vermiştir. Cinsiyet tayini dimorfik tüyleri tarafından doğrulandığı gibi% 100 doğru idi. Burada bildirilen başarı oranı iki önceki çalışmalarda 7,9 tarafından bildirilen orandan belirgin yüksektir. Chelex ile DNA izolasyonu malzemesi kaybolabilir hangi pipetleme ve çökeltme adımları en aza indirir. Ancak, farklı türlerde bizim protokol doğrulama çalışmalardan biri (Apus apus) yine de bu zaten Arima ark bildirilen 82% daha belirgin bir şekilde yüksek olmasına rağmen 89% 9 daha düşük başarı oranları elde etti. 7..

Ne neden olabilir? En önemli kısmı dikkatle prot takip etmektirocol, örnekleri (ağızda yavaşça tokatlamak doku birkaç kez) almak ve PCR reaksiyon içine Chelex boncuk carry-over önlemek için nasıl bir kısmını dahil. Chelex bir katyon değiştirici olarak, çok kirli bir örneklerinde amplifikasyon önlenmesi PCR reaksiyonu inhibe eder. Kirlenmiş örnekleri kolayca agaroz jel cepler ve astar dimerlerinin eksikliği görülebilir boncuk tarafından kabul edilebilir.

Yetmezliği için daha az olası sebebi başarıyla cinsel örnekleri ayrıca, türlerin farklılıklarını veya kadın numunelerdeki bant farkı tespit etmek için başka bir teknoloji kullanımı nedeniyle olabilir için.

Yavru zebra ispinoz aşağı tüyleri kesim ayrı ayrı konuları işaretlemek için güvenli bir yoldur. Yavrusu numaralı bacak bantları (örneğin zebra ispinoz olarak 10. günde) almak için yeterince yaşlı dek bu 'saç kesimi' tanımak kolay. Bu işaret, teknik hali hazırda farklı experim karşılayacak şekilde ayarlanabilirental talepleri; örn. video kayıtları için işaretler civciv kafasına sınırlı olabilir. Yuvalar beş yavru kuşlar daha büyük ise, iki pozisyonda kesik kombinasyonları uygulanabilir. 'Saç kesimi' uygulayarak önceden tanımlı bir dizi tutulması (bir yuva örneğin ilk yavru hep, 'saç kesimi A' aldığı ikinci daima vb 'saç kesimi B' alır) yavru aşaması boyunca kuluçka düzen içinde hızlı tanınmasını sağlar. Bu azaltmak ve hatta civciv işlenmesini önlemek hızlı tespit edilmesini sağlar. Zebra ispinoz yılında, dört konumlardan birinde çıkışlar olmaması nedeniyle doğal dalgalanmalar oluşabilir. Bu nedenle, her zaman önceden belirlenmiş bir işaret dizisine sadık mümkün olmayabilir.

Hatta yavrumuz ele deneyimsiz birisi için aşağı tüyleri kesmek için, güvenli ve kolay işaretleme tekniği öğrenmek için bir hızlı olduğunu. Nestlings doğuştan şaşkın tepki baş hareketleri içerir Ancak, bazı insanlar daha zor mar yer bulmakbaş papaz. Hata eğilimli kimlik kesin işaretler dayanır. Bu kusurlu işaretler / tek sol-aşağı ve dışarı tüyler daha sonra kimliğini karıştırmayın olabilir iyice, belli bir noktada tüyler tamamını kesmek seçkin önem taşımaktadır.

Yöntemler bu set son derece hızlı, kolay, non-invaziv, güvenilir ve düşük maliyetli, kuşların cinsiyet tayini ve non-invaziv, hızlı, güvenli ve kolayca tanınabilir yumurtadan çıktıktan sonra birkaç dakika içinde işaretleme sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgements

Moral desteği için güzel jeller ve Tobias Krause Ulla Kobalz için sürekli yardım için Janett Birkenfeld alanında coşkulu örnek toplama, Silke Kipper, Sarah Kiefer, Michael Weiss, Conny Bartsch ve Silke Voigt-Heucke çok teşekkürler.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics