Vem är vem? Icke-invasiva metoder för att individuellt Sex och Mark altricial Chicks

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Protokollet ger en bekväm uppsättning metoder, som möjliggör extremt snabb, enkel, icke-invasiv, pålitlig och billig, molekylär könsbestämning av fåglar och deras icke-invasiv, snabb, säker och lätt att känna igen markering strax efter kläckning. Endast begränsad hantering av kycklingar krävs. Denna praktiska verktygslåda av metoder överensstämmer helt med de RRR-riktlinjerna.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Många försök kräver tidig bestämning avkommor kön samt tidig markering av nyfödda för enskilda erkännande. Enligt riktlinjer för djurskydd, bör icke-invasiva metoder att föredra när det är tillämpligt. I vår grupp arbetar vi på olika arter av sångfåglar i labbet och på fältet, och vi lyckas tillämpa icke-invasiva metoder för att kön och individuellt markera kycklingar. Denna uppsats presenterar en omfattande icke-invasiv verktygslåda. Att könsbestämma fåglarna före uttrycket av sekundära sexuella egenskaper kräver insamling av DNA-lagermaterial för PCR. Vi etablerade en snabb och enkel metod för sex fåglar i alla åldrar (inlägget kläckning) genom att extrahera DNA från buckala kompresser. Resultat kan erhållas inom tre timmar. För individuell märkning chick s dunfjädrar trimmas i ett specifikt mönster som möjliggör snabb identifiering inom kläckning ordning. Denna uppsättning metoder är lätt tillämplig i en standard utrustat laboratorium och särskilt lämplig för working på området eftersom ingen speciell utrustning krävs för provtagning och lagring. Hantering av kycklingar minimeras och märkning och könsbestämning tekniker är icke-invasiv sätt stödja RRR-principen om riktlinjer för djurskydd.

Introduction

Individuell erkännande, könsbestämning och genotypning är grundläggande förutsättningar i olika experimentella studier. Skaffa DNA lagermaterial och märkning ämnen entydigt (även i tidig ålder) ska ha minimal inverkan på fysiologi, beteende och överlevnad. Om möjligt bör ingrepp undvikas enligt principen RRR 1.

Icke-invasiva metoder är inte bara fördelaktigt för djuret, utan också kan förbättra de erhållna data som djur påverkas mindre av behandlingarna.

Hos fåglar kan DNA könsbestämning utföras på ett antal icke-invasivt erhållbara material som spillning 2, fjädrar 3,4 eller buckala kompresser 3,5,9. Oberoende av patientens tillstånd och ålder buckala kompresser är den viktigaste metoden för aviär könsbestämning, eftersom de är lätta att utföra, sällan misslyckas och hantering är kort.

Hittills DNA från buckala kompresservar antingen extraheras med kommersiellt tillgängliga kit 3,6 eller tidskrävande standard DNA extraktion protokoll 3,6-8. Kit är inte bara ganska dyrt, men deras protokoll kan införa utmaningar för fältarbete. Vissa processuella detaljer, till exempel torkning och odling av prover, är inte praktiskt i fält. Särskilt i en miljö där experimentella protokoll kräver könsberoende behandling från så tidigt som några minuter efter kläckning, det finns suget efter en snabb, icke-invasiv, tillförlitlig och enkel metod för att få resultat.

Över aviär taxa betydande verktygslåda för märkning individer har utvecklats 10. Det breda utbud av tillgängliga tekniker står för olika forskningsmål, arter och budgetar. Men märkning små ungar har konfronterats forskare med ytterligare utmaningar. I vissa arter (t.ex. tättingar) kycklingar som är för små för att tillämpa benband och kräva att alternativa metoder som ärändrar inte förälder-avkomma beteende. Som medvetenhet och intresse av att förbättra djurens välbefinnande och tekniker i fält-och laboratoriestudier växer, är användningen av icke-invasiva tekniker uppmuntras och att föredra.

Protokollet ger en icke-invasiv, snabb, lätt att känna igen och ihållande metod att individuellt märka mycket unga ungar innan de ansöker benband är genomförbart. Denna märkningsmetod införs på en av de viktigaste fågellaboratoriemodellarter, Zebra Finch (Taeniopygia guttata) 11-13. Protokollet uppfyller alla de tidigare publicerade målen för enskilda märkningsteknik 10 och har redan med framgång tillämpats 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla förfaranden genomfördes i enlighet med den tyska lagstiftningen för djurskydd (TierSchG).

1. Beredning av reagens och förbrukningsvaror

  1. Bered en 5% (vikt / vikt) Chelex-100-lösning i molekylär kvalitet vatten. Förbered alikvoter av 200 pl i standard 1,5 ml reaktionsrören. Som Chelex harts fälls snabbt från suspensionen är det nödvändigt att återhomogenisera suspensionen konstant under utarbetandet av de alikvoter. Det är lämpligt att bereda 50 ml eller mer i en sats och hålla suspensionen homogeniserades med användning av en magnetomrörare. The Chelex lösning kan lagras i flera år vid omgivningsbetingelser.
  2. Skär bitar av Whatman-papper med en bredd mindre än den näbb bredden av fågel som skall testas. Längden hos papperet beror på den metod för att ta provet:
    1. Använd pincett, ska verket vara tillräckligt lång för att möjliggöra provtagning utan pincett förs in i näbben på fågeln. Som ettgrov uppskattning, för en näbb längd på 0,5 cm ett papper med längden 1 cm ska vara bra.
    2. Om inte med hjälp av pincett, måste bit vara längre, men styvheten i bit bör ändå tillåta provtagning av epitelceller.
  3. Förbered en alikvot av PCR-förblandning för varje prov som skall analyseras. För en PCR i en total volym av 25 | il blandningen innehåller 0,18 mM dNTP, 2 mM MgCl2, 70 mM Tris-HCl, 17,25 mM ammoniumsulfat, 0,1% Tween-20, 0,32 | iM P2 primer (TCTGCATCGCTAAATCCTTT), 0,32 pM P8 primer (CTCCCAAGGATGAGRAAYTG) 16 och 2 enheter Taq-polymeras. Hemgjord Taq-polymeras 17 kan användas. För att tillåta tillägg av den maximala mängden DNA-lösning, kan en 6 pl förblandning förberedas och förvaras vid -20 ° C under flera veckor.

2. Provtagning

Att bära handskar är inte nödvändigt för aviär könsbestämning som PCR-primers inte kan para till mänskligt DNA. Förandra genotypning ändamål kan det vara lämpligt.

  1. Fånga fågeln av intresse och försiktigt hålla den i en hand, t.ex. med "ring grepp" 18. Se till att inte pressa fågeln.
  2. Håll en bit Whatman papper med en tång och dra det flera gånger över hela insidan av kinderna, tungan och choana. Vanligtvis sampel erhålls inom mindre än 30 sekunder.
    1. Vuxna djur: beroende på art kan det vara svårt att få fågeln att öppna näbben. Vanligtvis rör vid sidan av näbb och ett lätt tryck kommer att fungera.
    2. Ungarna: Provtagning från kycklingar eller ungarna är särskilt lätt att använda denna teknik, eftersom deras tiggande beteende ger lätt tillgång till insidan av näbben. Det kan även vara möjligt att få provet utan hantera dem alls, eftersom de tigger lätt t.ex. när deras rede öppnas.
  3. Omedelbart förvara papper i ett förberett reaktion rör behållarenning 200 pl av 5% (vikt / vikt) Chelex-100-lösning.

Om du också tänker / måste markera kycklingar, gör det nu så som beskrivs i avsnitt 6.

3. Förvaring av prover före DNA Extraction

  1. Om arbetet i labbet, lagra proverna vid -20 ° C. Om detta inte är möjligt eller svårt (t.ex. i fält) lagra prover vid rumstemperatur.
  2. Prover kan förvaras under mer än tre år vid temperaturer som sträcker sig från rumstemperatur till -20 ° C.

4. DNA-extraktion

  1. Om provet är fryst, tina den i rumstemperatur.
  2. Se till att pappret ligger på botten av röret nedsänkt i Chelex-100-lösning.
  3. Inkubera proverna i 15 min vid 56 ° C.
  4. Vortex kort och spinn ner innehållet i tuben.
  5. Inkubera proverna för 8 minuter vid 100 ° C.
  6. Centrifugera proverna vid 15000 x g under 3 min.
  7. Använd supernatant för efterföljande genotypning.

5. Molekylär könsbestämning

  1. Förbered en PCR-rör med 6 pl förblandning per prov plus två extra rör för den negativa (obligatoriskt) och positiv kontroll (tillval). För rutinkönsbestämning innefattar ett prov från den senaste framgångsrika könsbestämning som en positiv kontroll.
  2. Lägg till 19 l av supernatanten från DNA-extraktion till PCR-förblandning. Se till att pipettera från ytan av lösningen för att undvika överföring av Chelex kulor. Detta är viktigt, eftersom Chelex är en katjonbytare och därmed hämmar allvarligt alla enzymatiska reaktioner.
  3. Kör följande PCR-program: Inkubation vid 94 ° C under 3 min, 45 cykler vardera med en 30 sek smältningssteg 94 ° C, följt av en 30 sek glödgningssteg vid 55 ° C, följt av en 45 sek förlängningssteg vid 72 ° C. I ett sista chase off steg Reaktionerna inkuberades under 5 min vid 72 ° C.
  4. Bered en 2% standard TBE eller TAE Agaro se-gel för att separera PCR-produkter.
  5. Kör agarosgel med lämpliga inställningar spänning.
  6. Visualisera banden under UV-ljus och ta en bild. Se till att de två banden i proverna som kommer från kvinnor är väl separerade.
  7. Skilj hane från kvinnliga prover genom närvaron av en (manlig) eller två (kvinnliga) band.

6. Märkning Ungarna

  1. Kolla bon för nykläckta kycklingar på ett schema lämplig för arten / studien (t.ex. dagliga kontroller på morgonen rekommenderas eftersom de flesta kycklingar kläcks sedan).
  2. Skär dunfjädrar för varje brud i ett bo på en annan karakteristisk plats. I sebrafink knippen av nedgångar växa i fyra karakteristiska och olika områden över hela ungen kropp (Figur 4A). För varje kyckling skära ett område (figur 4B). Om det finns fler än fyra kycklingar i ett bo, de unika fyra "haircuts" kan kombineras.
ove_content "> För sebrafink: Applicera benband på tio dagar efter kläckning när dunfjädrar blir svåra att upptäcka och ungen storlek tillåter ringer.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Buckala kompresser kan användas för att erhålla DNA för könsbestämning i en mängd olika småfåglar

Prover togs från zebrafinkar (Taeniopygia guttata, 99 individer, ålder 0 dagar - 5 år), Kanarieöarna (Serinus canaria), Bengalese Finches (Lonchura striata), näktergal (Luscinia megarhynchos), talgoxar (Parus major) och Blackbirds (Turdus merula) (för alla andra arter: urvalsstorlek 1-3 år) (Figur 1).

För prover från zebrafinkar, andelen framgångsrika för PCR var 100%. PCR-resultat alltid matchade kön bestäms av tidigare (hos vuxna) eller senare (i ungarna) fenotypisk inspektion. Intensiteten av banden inte systematiskt skiljer mellan ungar och vuxna som visar att liknande mängder DNA bärande material erhålls från alla åldrar.

Figur 1 "fo: innehåll-width =" 6in "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figur 1. Molecular könsbestämning. Exempel på könsbestämning resultat från buckala kompresser erhållna från olika fågelarter. 2% agarosgel färgad med etidiumbromid. Från vänster till höger: storleksmarkör, Zebra Finch manliga, Bengalese Finch kvinnliga, Blackbird manliga, talgoxe manliga, Nightingale manliga, Canary manliga, vatten kontroll, storleksmarkör.

Det är viktigt att förhindra att Chelex överföring föroreningar i PCR

För att demonstrera effekten av Chelex kontamination harts i en PCR-reaktion inkluderade vi en liten mängd av Chelex pärlor i en PCR-reaktion (figur 2). Såsom kan ses i figur 2A, överföringskontamination av Chelex pärlor förhindrar amplifiering av DNA som ytterligare illustreras genom avsaknaden av primer-dimer-bildning i den förorenade prov (<strong> Figur 2B). I figur 2A lane 2 använde vi samma prov för PCR utan att över Chelex. Vanligtvis kontaminerade prover är lätt att känna igen med mörka fläckar i fickorna på agarosgel (Figur 2B).

Figur 2
Figur 2. Chelex kontamination. A) Chelex överföring in i PCR-reaktion inhiberar amplifiering av DNA. Från vänster till höger:. Storleksmarkör, Zebra Finch manliga, Zebra Finch kvinnliga, samma prov med avsiktlig överföring av Chelex, vatten kontroll, storlek markör B) Chelex pärlor är lätt synliga som mörka fläckar i fickan av gelen (vänster utan Chelex , rätt med Chelex. Den svåra hämning av PCR-reaktionen i närvaro av Chelex illustreras också av den saknade primer dimer bildning i den kontaminerade prov.

Prover kan förvaras i rumstemperatur innan DNA-extraktion för mer än tre år

För att undersöka om framgångsrika utvinning fortfarande kan utföras efter lång lagring, togs prover upprepade gånger från samma fågel och lagras i labbet vid omgivningstemperaturer upp till max tre år. Proven lagrades i närheten av ett fönster med naturlig exponering för ljus och värme från solen. Efter tre år DNA extraherades och könsbestämning PCR. Resultatet matchade den som utförde tre år tidigare (direkt efter provtagning) och visade inte någon effekt av lagring (Figur 3).

Figur 3
Figur 3. Chelex tillåter långvarig lagring av prover before och efter DNA-extraktion. Prover av två djur (manliga vänster, kvinn höger) lagrades under olika förhållanden som anges i tabellen. Signaler erhölls framgångsrikt från alla prover.

Figur 4
Figur 4. Märkning av kycklingar. A) Schematisk representation och nomenklatur för de fyra olika områdena ner fjäder tillväxt i zebra finch ungarna:. A = huvud, B = baksida, C = vingar (båda), D = flanker (båda) B) Exempel bilder på ungar som antingen erhöll en av de respektive 'hårklippning' (AD) eller nej "frisyr" (E).

Extraherade DNA kan lagras i mer än tre år vid 4 ° C

Zebra finch prover från det första försöket lagrades i tre år i ett standardlaboratorium freDGE vid 4 ° C och framgångsrikt testas igen. Alla prover gav samma PCR-resultat som direkt efter DNA-extraktion (fig 3).

Ungar kan markeras genom att trimma sina dunfjädrar för att möjliggöra individuell erkännande från kläckning på

Märkning enskilda ungarna direkt efter kläckning genom att skära sina dunfjädrar gjorde dem lätta att känna igen (figurerna 4, 5, 6). Ner fjädrar har ett fluffigt utseende som sina hullingar är inte sammanfogade för att bilda en slät vane. De kan fortfarande kännas igen på posthatch dag 10 på tips av utvecklings fjädrar, som då täcker kroppen (Figur 5). Deras frånvaro på skilda platser gör erkännande lätt, ibland till och med utan att hantera ungarna (Figur 6). Att tillämpa dessa så kallade `frisyrer" är en elegant teknik, som framgångsrikt fyller gapet för tiden från kläckningen till kroppsstorlek inbäddat zebra FiUhes som gör tillämpningen av benband genomförbart.

Figur 5
Figur 5. Marked SEBRAFINCH ungarna vid post hatch dag 10. Bilderna visar ungarna antingen med (sax) eller utan (pil) markeringar. En pil pekar på platsen av intresse enligt respektive nomenklatur dun fjäder "haircuts": A = huvud, B = baksida, C = vingar, D = flanker.

Figur 6
Figur 6. Erkännande av markerade ungar (medelålder = 10 dagar) inom det natal boet enligt nomenklaturen.A = huvud, lätt att upptäcka på grund av hans framträdande dunfjädrar, som bara saknas på huvudet. B = baksida, dunfjädrar synlig på alla ställen, men på baksidan. C = vingar, behöver en uppmärksam observatör som båda vingarna saknas dunfjädrar, gör men inbäddad hållning de dunfjädrar från huvudet täcka högerkanten. D = flankerna, kan endast kännas igen genom uteslutningsmetoden eftersom dess flanker inte syns. Det kan på ett tillförlitligt sätt redovisas som D eftersom den visar tydligt nedåt fjäder tillväxt på huvudet, ryggen och vingarna. E = en kombination av "haircuts" huvud (A) och baksida (B), är lätt att skilja så dunfjädrar på huvudet och ryggen saknas. F = en kombination av "haircuts" A (huvud) och D (flanken), som endast kan differentieras genom att eliminera andra alternativ som dess huvud-märkning är självklart och ingen annan oidentifierad Nestling uppvisar ett huvud-märkning. G = inteemot några markeringar och är mycket mindre än sina syskon som det var den sista att kläckas. Dessutom G är ett bra exempel för bounge som inte uttrycker ner fjädrar på alla platser.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Att könsbestämma från buckala kompresser använder Chelex visade ett extremt bra resultat. Skärhatchling s dunfjädrar aktiverat differentiering mellan ungarna tills benet banding var möjligt.

Chelex-DNA-extraktion från buckala kompresser gav tillräckligt med DNA för att framgångsrikt utföra molekylär könsbestämning. Könsbestämning var 100% rätt som validerats av sexuellt dimorphic fjäderdräkt. Framgången rapporteras här är markant högre än den ränta som rapporteras av två tidigare studier 7,9. DNA-extraktion med Chelex minimerar pipetter och fällningssteg där materialet kan förloras. Men en av de studier för validering våra protokoll inom en annan art (Apus apus) fortfarande uppnådde en lägre svarsfrekvens 89% 9 trots att detta redan var markant högre än de 82% rapporterats i Arima et al. 7.

Vad kan vara orsaken? Den mest avgörande delen är att uppmärksamt följa protocol, inklusive del för hur man tar prover (försiktigt svepa vävnads flera gånger i munnen) och för att förhindra överföring av Chelex pärlor i PCR-reaktionen. Som Chelex är en katjonbytare det allvarligt hämmar PCR-reaktionen förhindrar förstärkning i förorenade prover. Förorenade prov kan lätt igen på pärlor synliga i fickorna på agarosgeler och bristen på primer dimerer.

Mindre troliga orsaker till misslyckande att framgångsrikt sex prover kan också bero på artskillnader eller att använda en annan teknik för att upptäcka bandet skillnaden i de kvinnliga proverna.

Kapning av dunfjädrar av hatchling sebrafink är ett säkert sätt att individuellt märka ämnen. Dessa "haircuts" var lätta att känna igen, tills ungarna var gamla nog att få numrerade benband (t.ex. vid dag 10 i zebra finkar). Denna märkningsteknik kan lätt anpassas för att möta olika experimental krav, t.ex. för videoinspelningar markeringar kan begränsas till chefen för kycklingar. Kombinationer av nedskärningar på två positioner kan tillämpas om bon är större än fem ungar. Att hålla en fördefinierad sekvens av att tillämpa "haircuts" (t.ex. den första hatchling i ett bo alltid får "haircut A", den andra får alltid "haircut B" etc.) möjliggör snabb erkännande inom kläckning ordning hela ungen fasen. Detta möjliggör snabb identifiering, vilket kan minska eller till och med förhindra hantering av kycklingar. I zebra finkar, kan brist på nedgångar på en av de fyra platser uppstå på grund av naturliga variationer. Således kan det inte alltid är möjligt att hålla sig till en fördefinierad märkningssekvens.

Även för någon oerfaren i hanteringen ungar är det en snabbt att lära sig, säker och enkel märkning teknik för att skära ner fjädrar. Men som den medfödda gapande svar av ungar omfattar huvudrörelser, en del människor tycker att det är svårare att placera markkungar på huvudet. Fel benägen identifiering bygger på exakta markeringar. Det är av yttersta vikt att noggrant skära hela dunfjädrar vid en given plats, som ofullkomliga markeringar / enkel vänster-out dunfjädrar senare kan förvirra identitet.

Denna uppsättning metoder möjliggör extremt snabb, enkel, icke-invasiv, pålitlig och billig, könsbestämning av fåglar och deras icke-invasiv, snabb, säker och lätt att känna igen märkning inom minuter efter kläckningen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgements

Stort tack till Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch och Silke Voigt-Heucke för entusiastiska provtagning i fält, till Janett Birkenfeld för fortsatt bistånd till Ulla Kobalz för de vackra geler och Tobias Krause för moraliskt stöd.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics