Wer ist wer? Nicht-invasive Methoden zur Individuell Sex und Mark Nesthocker Chicks

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dieses Protokoll bietet eine bequeme Reihe von Methoden, die extrem schnelle, einfache, nicht-invasive, sichere und kostengünstige ermöglicht, molekulare Geschlechtsbestimmung der Vögel und ihrer nicht-invasiv, schnell, sicher und leicht erkennbare Kennzeichnung kurz nach dem Schlüpfen. Nur begrenzt Handhabung von Küken erforderlich. Diese praktische Toolbox von Methoden entspricht vollständig den RRR-Richtlinien.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Viele Experimente erfordern frühzeitige Bestimmung der Nachwuchs das Geschlecht sowie frühe Kennzeichnung von Neugeborenen für individuelle Anerkennung. Laut Tierschutz-Richtlinien sollten nicht-invasive Techniken anwendbar, wenn bevorzugt werden. In unserer Gruppe arbeiten wir auf verschiedenen Arten von Singvögel im Labor und auf dem Feld, und wir erfolgreich nicht-invasiven Methoden anwenden, um Sex und individuell markieren Küken. Dieser Beitrag stellt eine umfassende nicht-invasive Tool-Box. Geschlechtsbestimmung Vögel vor dem Ausdruck der sekundären Geschlechtsmerkmale erfordert die Sammlung von DNA-Lagermaterial für die PCR. Wir haben eine schnelle und einfache Methode, um Sex Vögel jeden Alters (post Schraffur) durch Extraktion von DNA aus Mundschleimhautabstrichen. Die Ergebnisse können innerhalb von 3 Stunden erreicht werden. Für Daunenfedern individuellen Kennzeichnung Küken werden in spezifischen Mustern ermöglicht eine schnelle Identifikation innerhalb der Schraffur um getrimmt. Dieser Satz von Methoden ist leicht anwendbar in einem Standard ausgestattetes Labor und besonders geeignet für Workinzur Abtastung und Speicherung g in dem Feld ohne spezielle Ausrüstung erforderlich. Handhabung von Küken minimiert und Markierung und Geschlechtsbestimmung Techniken sind nicht-invasiv, wodurch die RRR-Prinzip der Tierschutz-Richtlinien unterstützen.

Introduction

Individuelle Anerkennung, Geschlechtsbestimmung und Genotypisierung sind grundlegende Voraussetzungen in einer Vielzahl von experimentellen Studien. Gewinnung von DNA Lagermaterial und Kennzeichnung Themen eindeutig (auch in einem frühen Alter) sollte nur minimale Auswirkungen auf die Physiologie, das Verhalten und Überleben. Wann immer möglich, sollten invasive Verfahren nach dem Prinzip RRR 1 vermieden werden.

Nicht-invasive Verfahren sind nicht nur nützlich für das Tier, sondern könnte auch die erhaltenen Daten zu verbessern, wie die Tiere weniger von den Behandlungen betroffen.

Bei Vögeln können DNA-Geschlechtsbestimmung von einer Reihe von nicht-invasiv erhältlich Materialien wie Kot 2, Federn 3,4 oder Mundschleimhautabstrichen 3,5,9 durchgeführt werden. Unabhängig von Zustand und Alter Mundschleimhautabstrichen Subjekts sind die Methode der Wahl für die Vogel-Geschlechtsbestimmung, weil sie einfach durchzuführen sind, selten scheitern und die Behandlung ist kurz.

So weit, DNA aus Mundschleimhautabstrichenwurde entweder mit kommerziell erhältlichen Kits 3,6 oder zeitaufwendig Standard-DNA-Extraktionsprotokolle 3,6-8 extrahiert. Kits sind nicht nur ziemlich teuer, aber ihre Protokolle können Herausforderungen für die Feldarbeit zu verhängen. Einige Verfahrensdetails, zB Trocknen und Inkubation von Proben, nicht praktikabel sind im Feld. Gerade in einer Umgebung, wo experimentelle Protokolle erfordern Geschlecht abhängig von der Behandlung so früh wie ein paar Minuten nach dem Schlüpfen, gibt es fordern für eine schnelle, nicht-invasive, sichere und einfache Methode, um Ergebnisse zu erhalten.

Auf der Vogelgrippe Taxa eine erhebliche Toolbox zur Markierung Personen entwickelt worden 10. Die breite Palette an verfügbaren Techniken erklärt die Vielfalt der Forschungsziele, Arten und Budgets. Allerdings Kennzeichnung kleinen Nestlinge hat die Forscher mit weiteren Herausforderungen konfrontiert. Bei einigen Arten (zB Singvögel) Küken sind zu klein, um Beinbänder anzuwenden und erfordern alternative Verfahren, diekeine Eltern-Nachkommen Verhalten zu ändern. Da das Bewusstsein und Interesse an der Verbesserung des Tierschutzes und Techniken in der Feld-und Laborstudien wächst, ist die Verwendung von nicht-invasiven Techniken stark gefördert und bevorzugt.

Dieses Protokoll bietet eine nicht-invasive, schnell, leicht erkennbar und anhaltende Methode, um individuell zu kennzeichnen sehr jungen Nestlinge vor der Anwendung Beinbänder möglich ist. Diese Markierungsmethode ist auf einer der wichtigsten Vogel-Labormodell Arten, die Zebra-Fink (Taeniopygia guttata) 11-13 eingeführt. Das Protokoll entspricht allen bisher veröffentlichten Ziele für die einzelnen Markierungstechniken 10 und wurde bereits erfolgreich angewendet 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle Verfahren wurden in Übereinstimmung mit dem Deutschen Tierschutzgesetz (TierSchG) durchgeführt.

1. Vorbereitung der Reagenzien und Verbrauchsmaterial

  1. Eine 5% (w / w) Chelex-100-Lösung in der molekularen Grad Wasser. Aliquots von 200 ul in Standard 1,5 ml Reaktionsgefäße. Da die Chelex-Harz fällt schnell aus der Suspension ist es notwendig, erneut homogenisiert die Suspension ständig während der Herstellung der Teilmengen. Es ist ratsam, 50 ml oder mehr in einer Charge vorbereiten und halten die homogenisiert mit einem Magnetrührer Federung. Die Chelex-Lösung kann über Jahre bei Umgebungsbedingungen gelagert werden.
  2. Schnitten Stücke Whatman-Papier mit einer Breite kleiner als die Breite der Schnabel des Vogels zu prüfen. Die Länge des Papiers hängt von der Methode, die Probe zu nehmen:
    1. Mit einer Pinzette, sollte das Stück lange genug, um Probenentnahme ohne die Zange in die Schnabel des Vogels eingeführt ermöglichen. Alsgrobe Schätzung, für eine Schnabellänge von 0,5 cm ein Stück Papier mit der Länge von 1 cm sollte in Ordnung sein.
    2. Wenn nicht mit einer Pinzette, muss das Stück länger sein, aber die Steifigkeit des Teils sollte noch Probenahme von Epithelzellen zu ermöglichen.
  3. Vorbereitung eines Aliquots der PCR-Vormischung für jede zu analysierende Probe. Für eine PCR in einem Gesamtvolumen von 25 &mgr; l der Mischung enthält 0,18 mM dNTPs, 2 mM MgCl 2, 70 mM Tris-HCl, 17,25 mM Ammoniumsulfat, 0,1% Tween-20, 0,32 &mgr; M Primer P2 (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 Primer (CTCCCAAGGATGAGRAAYTG) 16 und 2 Einheiten Taq-Polymerase. Hausgemachte Taq-Polymerase 17 verwendet werden. Zusätzlich zu der maximalen Menge der DNA-Lösung zu ermöglichen, kann ein 6 &mgr; l Premix hergestellt und bei -20 ° C gelagert werden, für mehrere Wochen.

2. Probenentnahme

Das Tragen von Handschuhen ist nicht notwendig für die Aviäre Geschlechtsbestimmung, wie die PCR-Primer können nicht auf menschliche DNA anlagern. FürGenotypisierung andere Zwecke könnte es sinnvoll sein.

  1. Nehmen Sie den Vogel von Interesse und sanft halten sie in einer Hand, zB mit dem "Ringergriff" 18. Achten Sie darauf, den Vogel nicht zu drücken.
  2. Halten Sie ein Stück Whatman-Papier mit einer Pinzette und streichen Sie es mehrmals über die Innenseite der Wangen, der Zunge und der Choane. Proben werden in der Regel in weniger als 30 Sekunden erreicht.
    1. Erwachsene Tiere: abhängig von der Art könnte es schwierig sein, den Vogel auf seinem Schnabel öffnen zu bekommen. Normalerweise berühren die Seite der Schnabel und mit leichtem Druck arbeiten.
    2. Nestlings: Probenahme aus Jungtiere oder Nestlinge ist besonders einfach mit dieser Technik, da ihre Bettelverhalten bietet einfachen Zugang zum Inneren des Schnabels. Es könnte sogar möglich sein, die Probe ohne mit ihnen überhaupt zu erhalten, wie sie z. B. leicht zu bitten, wenn ihre Nistkasten geöffnet.
  3. Das Papier in einer vorbereiteten Reaktionsrohr Contai sofort speichernNing 200 ul 5% (w / w) Chelex-100-Lösung.

Wenn Sie beabsichtigen auch / müssen, um die Küken zu kennzeichnen, tun Sie es jetzt, wie in Abschnitt 6 beschrieben.

3. Lagerung der Proben vor der DNA-Extraktion

  1. Wenn im Labor arbeiten, Lagerung von Proben bei -20 ° C Wenn dies bei Umgebungstemperaturen nicht möglich oder schwierig (z. B. auf dem Gebiet) Proben.
  2. Proben für mehr als 3 Jahre bei Temperaturen im Bereich von Raumtemperatur bis -20 ° C gelagert werden

4. DNA-Extraktion

  1. Wenn die Probe eingefroren, aufgetaut bei Raumtemperatur.
  2. Sicherzustellen, dass das Stück Papier, auf dem Boden des Rohrs in der Chelex-100-Lösung eingetaucht.
  3. Proben für 15 min Inkubation bei 56 ° C.
  4. Vortex kurz auf und drehen Sie den Inhalt des Rohres.
  5. Die Proben für 8 min bei 100 ° C inkubieren
  6. Drehen Sie die Proben bei 15.000 g für 3 min.
  7. Verwenden Sie die supernatant für spätere Genotypisierung.

5. Molekulare Geschlechtsbestimmung

  1. Bereiten Sie ein PCR-Röhrchen mit 6 ul Vormischung pro Probe sowie zwei zusätzliche Rohre für die negative (obligatorisch) und Positivkontrolle (optional). Für Routinegeschlechtsbestimmung gehören eine Probe aus dem letzten erfolgreichen Geschlechtsbestimmung als positive Kontrolle.
  2. Add 19 ul des Überstands aus der DNA-Extraktion zu dem PCR-Vormischung. Achten Sie darauf, von der Oberfläche der Lösung pipettieren, um Verschleppung von Chelex Perlen zu vermeiden. Dies ist entscheidend, wie Chelex ein Kationenaustauscher ist und somit alle enzymatischen Reaktionen stark hemmt.
  3. Den folgenden PCR-Programm: Die Inkubation bei 94 ° C für 3 min, 45 Zyklen mit jeweils 30 sec Schmelzschritt 94 ° C, gefolgt von einem 30 Sekunden Annealing-Schritt bei 55 ° C, gefolgt von einem 45 Sekunden Verlängerung bei 72 ° C. In einem letzten Schritt vertreiben, werden die Reaktionen für 5 min bei 72 ° C inkubiert,
  4. Bereiten Sie eine 2%-Standard TBE oder TAE agaro se Gel auf der PCR-Produkte zu trennen.
  5. Führen Sie die Agarose-Gel mit entsprechenden Spannungseinstellungen.
  6. Visualisieren Sie die Banden unter UV-Licht und ein Bild. Stellen Sie sicher, dass die beiden Bands in den Proben von Frauen stammen, sind gut voneinander getrennt.
  7. Unterscheiden männlichen von den weiblichen Proben durch die Anwesenheit von einem (männlichen) oder zwei (weiblich) Bands.

6. Kennzeichnung Nestlings

  1. Überprüfen Nester für neu geschlüpften Küken auf einen Zeitplan für die entsprechenden Arten / Studie (zB tägliche Kontrollen in den Morgen wird empfohlen, da die meisten Küken schlüpfen dann).
  2. Schneiden Sie die Daunenfedern jedes Küken in einem Nest an einem anderen charakteristischen Lage. In Zebrafinken Büschel Tiefen wachsen vier charakteristischen und unterschiedlichen Gebieten in der Nestlings Körper (Abbildung 4A). Für jedes Küken schneiden einem Bereich (4B). Wenn es mehr als vier Küken in einem Nest, die einzigartigen vier "Haircuts" können kombiniert werden.
ove_content "> Für Zebrafinken: Bewerben Beinbänder um zehn Tage nach dem Schlüpfen, wenn Daunenfedern zu schwer zu erkennen und Nestlings Größe ermöglicht es klingelt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abstrichmaterial kann in einer Vielzahl von kleinen Vögeln verwendet, um DNA für die Geschlechtsbestimmung zu erhalten

Kanaren (Serinus canaria), Bengalen Finken (Lonchura striata), Nachtigallen (Luscinia megarhynchos), Kohlmeisen (Parus major) und Amseln (Turdus - Proben wurden von Zebrafinken (5 Jahre Taeniopygia guttata, 99 Personen, Alter 0 Tage) gesammelt Merula) (für alle anderen Arten: Stichprobengröße 1-3, Alter unbekannt) (Abbildung 1).

Bei Proben von Zebrafinken genommen, die Erfolgsrate für die PCR betrug 100%. Das PCR-Ergebnis immer abgestimmt, die durch vor (bei Erwachsenen) oder später (Nestlinge) phänotypische Untersuchung bestimmt Sex. Die Intensität der Banden nicht systematisch unterscheiden zwischen Nestlinge oder Erwachsene darauf hinweist, dass ähnliche Mengen an DNA-Lagermaterial sind aus allen Altersgruppen gewonnen.

Abbildung 1 "fo: content-width =" 6in "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Abbildung 1. Molekulare Geschlechtsbestimmung. Beispiele für Geschlechtsbestimmung ergibt sich aus Mundschleimhautabstrichen von verschiedenen Vogelarten erhalten. 2% Agarose-Gel mit Ethidiumbromid gefärbt. Von links nach rechts: Größenmarker, Zebrafinken-Männchen, Bengalen Finch weiblich, männlich Amsel, Kohlmeise männlich, männlich Nightingale, Kanarische männlich, Wasserkontrolle, Größenmarker.

Es ist wichtig, Chelex Verschleppung in den PCRs verhindern

Um die Wirkung von Chelex-Harz Verunreinigung in einer PCR-Reaktion zu demonstrieren, haben wir eine kleine Menge von Chelex Kügelchen in einer PCR-Reaktion (Fig. 2). Wie in 2A zu sehen ist, Verschleppung von Chelex Kügelchen verhindert die Amplifikation von DNA, die durch das Fehlen von Primer-Dimerbildung in der kontaminierten Probe (dargestellt <strong> 2B). In 2A Spur 2 verwendeten wir die gleiche Probe für die PCR ohne Durchführung über Chelex. Normalerweise kontaminierte Proben sind von dunklen Flecken in den Taschen des Agarose-Gel (2B) leicht zu erkennen.

Figur 2
2. Chelex Verunreinigungen. A) Chelex Verschleppung in die PCR-Reaktion hemmt die Amplifikation von DNA. Von links nach rechts:. Größenmarker, Zebrafinken-Männchen, Zebrafinken-Weibchen dieselbe Probe mit absichtlichen Übertragung von Chelex, Wasser-Kontrolle, Größe Markierung B) Chelex Perlen sind leicht als dunkle Färbung in der Tasche des Gels (links ohne Chelex sichtbar , rechts mit Chelex. Die schwere Hemmung der PCR-Reaktion in Gegenwart von Chelex wird auch durch die fehlende Primer d dargestelltenimer Bildung in der kontaminierten Probe.

Proben können bei Raumtemperatur vor der DNA-Extraktion für mehr als drei Jahre gelagert werden

Um zu untersuchen, ob erfolgreich Extraktion kann auch nach langer Lagerung durchgeführt werden, wurden die Proben immer wieder vom gleichen Vogel genommen und im Labor bei Raumtemperatur für maximal 3 Jahre gespeichert. Die Proben wurden in der Nähe von einem Fenster mit natürlichem Lichteinfall und Wärme von der Sonne gespeichert. Nach drei Jahren wurde DNA extrahiert und die Geschlechtsbestimmung PCR durchgeführt. Das Ergebnis entsprach dem eines drei Jahre zuvor (direkt nach der Probennahme) durchgeführt und hatte keine Auswirkungen der Lagerung (Abbildung 3) nicht an.

Fig. 3
3. Chelex ermöglicht langfristige Lagerung von Proben before und nach DNA-Extraktion. Proben von zwei Tieren (links Männchen, rechts Weibchen) wurden unter verschiedenen Bedingungen gespeichert, wie in der Tabelle angegeben. Signale wurden erfolgreich von allen Proben erhalten.

Fig. 4
Abbildung 4. Kennzeichnung der Küken. A) Schematische Darstellung und Nomenklatur der vier verschiedene Bereiche der Daune Wachstum in Zebrafinken Nestlinge:. A = Kopf, B = zurück, C = Flügel (beide), D = Flanken (beide) B) Beispielbilder der Nestlinge, die entweder erhielt einen der jeweiligen "Haircuts" (AD) oder keine "Haarschnitt" (E).

Extrahierte DNA kann für mehr als drei Jahre bei 4 ° C gelagert werden,

Zebrafink Proben aus dem ersten Experiment wurden für drei Jahre in einem Standard-Labor Fr. gespeichertDGE bei 4 ° C und erfolgreich getestet. Alle Proben ergaben die gleichen Ergebnisse wie PCR direkt nach der DNA-Extraktion (Abbildung 3).

Jungtiere können durch Trimmen ihre Daunenfedern, um individuelle Anerkennung von Brut auf aktivieren markiert werden

Kennzeichnung einzelner Nestlinge direkt nach dem Schlüpfen, indem sie ihre Daunenfedern machte sie leicht zu erkennen (Abbildungen 4, 5, 6). Daunenfedern haben eine flauschige Aussehen wie Widerhaken nicht miteinander verbunden sind, um einen reibungslosen Fahne bilden. Sie können noch in posthatch Tag 10 auf den Spitzen der Entwicklungs Federn, die dann durch Abdeckung des Körpers (5) erkannt werden. Ihre Abwesenheit an unterschiedlichen Standorten macht Anerkennung einfach, manchmal auch ohne die Handhabung der Nestlinge (Abbildung 6). Die Anwendung dieser so genannten `Haarschnitte" ist eine elegante Methode, die erfolgreich füllt die Lücke für die Zeit vom Schlüpfen bis zur Körpergröße eingebettet Zebra finches macht die Anwendung von Beinbänder machbar.

Figur 5
Abbildung 5. Markierte Zebra Finch Nestlinge am 10. Tag nach dem Schlüpfen. Bilder zeigen Nestlinge entweder mit (Schere) oder ohne (Pfeil) Markierungen. Ein Pfeil zeigt auf den Ort von Interesse nach der jeweiligen Nomenklatur der Daune "Haarschnitte": A = Kopf, B = zurück, C = Flügel, A = Flanken.

Fig. 6
Abbildung 6. Anerkennung markiert Nestlinge (Durchschnittsalter = 10 Tage) in der Geburtsnest nach der Nomenklatur.A = Kopf, einfach wegen seiner prominenten Daunenfedern zu erkennen, die nur auf dem Kopf fehlen. B = Rücken, Daunenfedern sichtbar an allen Standorten, sondern auf den Rücken. C = Flügel, braucht einen aufmerksamen Beobachter als beide Flügel fehlen Daunenfedern, macht aber eingebettet Haltung die Daunenfedern vom Kopf bedecken den rechten Flügel. D = Flanken, kann nur durch den Prozess der Beseitigung erkannt als seine Flanken kann nicht gesehen werden kann. Es kann sicher als D erkannt werden, da es zeigt deutlich, Daune Wachstum auf dem Kopf, der Rücken und die Flügel. E = eine Kombination von "Haarschnitte" Kopf (A) und zurück (B), ist leicht zu unterscheiden, wie sie Federn der Kopf und Rücken fehlen. F = eine Kombination von 'Haircuts' A (Kopf) und D (Flanken), die nur durch die Beseitigung andere Optionen als sein Kopf Markierung unterschieden werden kann, ist offensichtlich und keine andere, nicht identifizierte Nestling zeigt eine Kopf-Kennzeichnung. G = nicht tatenerhalten keine Markierungen und ist viel kleiner als seine Geschwister, wie es war der letzte, schlüpfen. Zusätzlich G ist ein gutes Beispiel für einen Nestling, die nicht exprimiert Daunenfedern an allen Standorten.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Geschlechtsbestimmung von Mundschleimhautabstrichen mit Chelex zeigten eine extrem hohe Erfolgsquote. Daunenfedern Schneidjungtier ermöglichte Differenzierung zwischen Nestlinge, bis Bein Streifenbildung möglich war.

Chelex-DNA-Extraktion aus Wangenschleimhautabstrichen ergab genug, um molekulare DNA Geschlechtsbestimmung erfolgreich durchzuführen. Geschlechtsbestimmung war 100% richtig, wie geschlechtsdimorphischen Gefieder validiert. Die Erfolgsrate hier berichtet wird, ist deutlich höher als die Rate von zwei früheren Studien berichtet, 7,9. Die DNA-Extraktion mit Chelex minimiert Pipettier-und Fällungsschritte in dem Material verloren werden kann. Doch einer der Studien zur Validierung unserer Protokoll in einer anderen Spezies (Apus apus) noch erreicht eine geringere Erfolgsraten von 89% 9 obwohl dies bereits deutlich höher als die 82% in Arima et al. 7.

Was könnte die Ursache sein? Der wichtigste Teil ist, aufmerksam folgen der protOcol, einschließlich des Teils, wie Sie Proben (Gewebe sanft Schlag mehrmals in den Mund) zu nehmen und Verschleppung von Chelex Perlen in der PCR-Reaktion zu verhindern. Chelex als ein Kationenaustauscher ist es stark hemmt die PCR-Amplifikation verhindert in kontaminierten Proben. Kontaminierte Proben können leicht durch Sicken in den Taschen der Agarose-Gele und der Mangel von Primer-Dimeren sichtbar erkannt werden.

Weniger wahrscheinlich Gründe für das Scheitern erfolgreich Sex Proben konnten auch aufgrund der Speziesunterschiede oder die Verwendung einer anderen Technologie, die Band Unterschied in den weiblichen Proben zu erkennen.

Schneiden Sie die Daunenfedern der Jungtier Zebrafinken ist ein sicherer Weg, um individuell zu markieren Themen. Diese "Haarschnitte" waren leicht zu erkennen, bis Nestlinge waren alt genug, um nummerierte Beinbänder (zB am Tag 10 in Zebrafinken) empfangen. Diese Kennzeichnung Technik kann leicht angepasst werden, um verschiedene experim erfüllenental Anforderungen, z. B. für Videoaufnahmen Markierungen auf den Kopf von Küken begrenzt werden. Kombinationen von Schnitten an zwei Positionen kann angewendet werden, wenn Nester sind größer als fünf Nestlinge. Die Aufrechterhaltung einer vorgegebenen Reihenfolge in der Anwendung "Haircuts" (z. B. das erste Jungtier in einem Nest erhält immer "Haarschnitt A ', der zweite erhält immer" Haarschnitt B' etc.) ermöglicht eine schnelle Anerkennung innerhalb der Ordnung im gesamten Brutnestlingsphase. Dies ermöglicht eine schnelle Identifikation, die zu reduzieren oder sogar verhindern Umgang mit Küken können. In Zebrafinken, kann ein Mangel an Tiefen an einem der vier Standorte aufgrund von Naturschwankungen auftreten können. Somit kann es nicht immer möglich sein, auf einen vordefinierten Markierungssequenz haften.

Selbst für jemanden, unerfahren im Umgang mit Nestlingen ist es ein schnell zu lernen, sicher und einfach Markierungstechnik, die Daunenfedern senken. Jedoch, wie die angeborene Reaktion der Nestlinge klaffenden Kopfbewegungen umfasst, einige Leute finden es schwieriger, mar legenKönige auf den Kopf. Fehler anfällig Identifizierung setzt auf präzise Markierungen. Es ist von eminenter Bedeutung, um gründlich zu schneiden die gesamte Daunenfedern zu einem bestimmten Ort, wie unvollkommen Markierungen / Einzel links aus Daunenfedern später verwirren Identität.

Dieser Satz von Methoden ermöglicht eine extrem schnelle, einfache, nicht-invasive, sichere und kostengünstige, Geschlechtsbestimmung der Vögel und ihrer nicht-invasiv, schnell, sicher und leicht erkennbare Kennzeichnung innerhalb von Minuten nach dem Schlüpfen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgements

Vielen Dank an Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch und Silke Voigt-Heucke für begeisterte Probensammlung im Feld, um Janett Birkenfeld für die weitere Unterstützung, um Ulla Kobalz für die schönen Gele und Tobias Krause für die moralische Unterstützung.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics