طريقتين لإنشاء أولي خلايا وانسجة بطانة الرحم الإنسان من استئصال الرحم العينات

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

إنشاء نظم الثقافة الابتدائية بطانة الرحم انسجة الخلايا من عينات استئصال الرحم هي تقنية البيولوجية قيمة وخطوة حاسمة قبل متابعة مجموعة واسعة من ويهدف البحث. هنا، نحن تصف طريقتين تستخدم لإنشاء الثقافات اللحمية من أنسجة بطانة الرحم جراحيا مقطوعة من المرضى من البشر.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وقد كرس الكثير من الجهود لإنشاء نظم في خلية ثقافة المختبر. تم تصميم هذه النظم في تصميم نموذج لعدد كبير من العمليات في الجسم الحي. نظم زراعة الخلايا الناشئة من عينات بطانة الرحم الإنسان ليست استثناء. وتتراوح التطبيقات من العمليات الفسيولوجية دوري طبيعية لأمراض الرحم مثل سرطانات أمراض النساء، والأمراض المعدية، وأوجه القصور الإنجابية. هنا، ونحن نقدم طريقتين لإنشاء خلايا انسجة بطانة الرحم الأساسي من مقطوعة جراحيا العينات استئصال الرحم بطانة الرحم. يشار الأسلوب الأول باسم "أسلوب تجريف"، ويتضمن تجريف الميكانيكية باستخدام شفرات الحلاقة أو الجراحية في حين يسمى الطريقة الثانية "طريقة التربسين." يستخدم هذا الأسلوب الأخير في النشاط الأنزيمي من التربسين لتعزيز الفصل بين الخلايا الأولية و ثمرة الخلية. نحن لتوضيح خطوة بخطوة منهجية من خلال الصور الرقمية والمجهري. ونحن كما قدمأمثلة الإلكترونية للتحقق من صحة بطانة الرحم خطوط الخلايا اللحمية في الوقت الحقيقي عبر تفاعلات البلمرة الكمية (QPCR) والمناعي (IF).

Introduction

ويتكون جسم الإنسان الرحم من ثلاث طبقات، وperimetrium (أو المصلية)، وعضل الرحم، وبطانة الرحم. تميز كل من هذه الطبقات هي خطوة مهمة لإنشاء خطوط الخلايا بطانة الرحم. وperimetrium هو الأكثر الخارجي طبقة من الرحم ويتكون من خلايا المصلية رقيقة. عضل الرحم هو، طبقة وسطى سميكة من الرحم وتتألف من خلايا العضلات الملساء. يتم التعرف على بطانة الرحم والطبقة الداخلية للرحم، ويشمل الظهارية وخلايا انسجة السكان.

تنقسم بطانة الرحم الى مزيد من الطبقة القاعدية التي هو الافتراض السكان الخلية لإعادة ملء طبقة طبقة وظيفية كل ما يقرب من 28 أيام 1 الجذعية. طبقة من بطانة الرحم وظيفي الإنسان يخضع لتغيرات كيميائية حيوية والصرفية كبير في استجابة لتعميم الهرمونات. وتستمد هذه الهرمونات من الغدة النخامية والمبايض.

الإنتاج منسقة والإفراج عن نتائج الهرمونات في دورة الإنجابية. تم تصميم دورة التكاثر لتحضير بطانة الرحم لغرس الجنين الأحداث المحتملة. في البشر، ومن المعروف أن دورة التكاثر باسم "الدورة الشهرية" وينقسم إلى ثلاث مراحل - التكاثري، إفرازية، والحيض. المرحلة التكاثري ينطوي على انتشار وظيفي طبقة بطانة الرحم في حين وضعت المرحلة إفرازية بواسطة ظيفي النضج. على وجه التحديد، والتعديلات خارج الخلية، إفرازات، وتمايز الخلايا يشير إلى غرس المحتملة. إذا لم تحدث زرع قبل نهاية المرحلة إفرازية، وتسليط طبقة بطانة الرحم وظيفي أثناء مرحلة الحيض. لا تزال قيد المناقشة على أهمية الحيض والأحداث التي تؤدي إلى سفك طبقة طبقة وظيفية. في البشر، وقد طرحت أن الحيض هو نتيجة لحدث معين منتصف المرحلة إفرازية التمايز المعروفكما "decidualization عفوية" 2. في هذا المخطوط، ونحن نقدم منهجية مفصلة لكلتا الطريقتين العزلة خلية انسجة بطانة الرحم، واستخدام مزيج من المناعي والصور الرقمية لإثبات فعالية هذه النهج. بالإضافة إلى ذلك، نحن نطبق التي يشيع استخدامها في نموذج المختبر من decidualization عفوية لتأكيد بطانة الرحم العزلة الخلايا اللحمية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تم جمع عينات استئصال الرحم المستخدمة في هذه المخطوطة في التوافق مع بروتوكول الأخلاق وافق الاتحاد الدولي للرجبي IRB الجامعة مرقمة-HSR # 14424.

1. شراء عينة من المصدر السريرية

  1. الحصول الحكومة والمبادئ التوجيهية الأخلاقية المستندة إلى المؤسسة وثائق الموافقة قبل بداية.
  2. إجراء جميع الخطوات في ظروف معقمة.
  3. الحفاظ على الأنسجة المشتقة من المريض في وسائل الإعلام (RPMI أو DMEM / ارتفاع الجلوكوز) في أنبوب 50 مل في 4 درجات مئوية إذا لا يمكن معالجة العينة في الثقافة على الفور. ويمكن تخزين العينات في هذه الدولة لمدة أقصاها 24 ساعة.
  4. غسل عينة الأنسجة ثلاث مرات مع 1X العقيمة الفوسفات مخزنة المالحة (PBS) وتجاهل الحل بين يغسل.

2. إعداد خطوط الخلية الأولية باستخدام طريقة القشط

  1. إضافة 4-10 مل من وسائط النمو (أو RPMI DMEM / ارتفاع الجلوكوز تستكمل مع 10٪ مصل بقري جنيني و 1٪ البنسلين، streptomyCIN) للأنسجة وإضافة Fungizone (0.25 ميكروغرام / مل تركيز النهائي) لمدة 30 دقيقة.
  2. تجاهل وسائل الاعلام النمو.
  3. غسل الأنسجة مرتين مع 1X PBS.
  4. وضع النسيج على لوحة الثقافة 6 سم خلية للتمييز بين عضل الرحم وبطانة الرحم طبقات (يرجى الرجوع إلى الأرقام 2A-2C لمزيد من الوصف). فصل بطانة الرحم.
  5. باستخدام مشرط أو شفرة حلاقة، القطع الأنسجة الى قطع صغيرة في حين الخدش على طبق ثقافة 6 سم الخلية. هذه الخدوش تيسير المرفق من خلايا بطانة الرحم الأولية الناشئة. مقارنة لطريقة التربسين، هناك حاجة إلى المزيد من الأنسجة (انظر الشكل 2D لتقريب).
  6. بلطف، إضافة 2 مل من وسائط النمو إلى طبق خدش (لن تكون مرئية شظايا الأنسجة ويجمد مثالي من الحركة الخدش).
  7. نقل لوحة (ق) إلى حاضنة الثقافة الخلية المعينة (37 درجة مئوية و 5٪ CO 2). تعيين مكان لخطوط الخلية الأولية، بعيدا عن الغيرإيه الأطباق ثقافة الخلية. الثقافات الأولية هي أكثر حساسية للعدوى والتلوث.
  8. فحص الخلايا تحت المجهر ضوء اليومية. يجب أن المجموعات الصغيرة من الخلايا تظهر بعد يوم اثنين أو ثلاثة من مختلف شرائح الأنسجة (انظر الشكل 3B).
  9. للحفاظ على الثقافات، وغسل بلطف مع 1X PBS وإضافة وسائط النمو الطازجة (2ML) كل ثلاثة أيام. عندما يزيد معدل الانتشار، وسائل الاعلام نمو إضافية (3-4 مل) يمكن أن تضاف إلى لوحة الثقافة 6 سم (ق).
    ملاحظة: أثناء الغسيل وسائل الاعلام التغييرات، ومن المحتمل أن يستنشق قطعة من الأنسجة. هذا لن يؤثر على نمو الخلايا الملتصقة. يجب أن يستنشق قطعة من الأنسجة التي كتبها الخطوة اللاحقة (2.10) كما من غير المرجح أن تظهر بعد أسبوع واحد مستعمرات جديدة.
  10. عندما 6 سم لوحة ما يقرب من 75-80٪ متموجة (انظر الشكل 3B)، والمرور باستخدام التربسين 0.05٪. الخلايا الأولية لا يمكن passaged إلى أجل غير مسمى - تجميد أسفل لوحة واحدة من الخلايا في أقرب وقت سنتين أو ثلاث لوحات أماهintained. إذا كانت هناك حاجة أكثر الممرات، اتبع بروتوكول تخليد (إعادة النظر في المرجع 3).

3. إعداد خطوط الخلية الأولية باستخدام الأسلوب التربسين

  1. وضع قطعة صغيرة من أنسجة بطانة الرحم (انظر الشكل 2D لتقريب) في 2 مل من 0.25٪ التربسين تستكمل مع كاناميسين (0.03 ملغ / مل تركيز النهائي).
  2. احتضان الأنسجة عند 37 درجة مئوية على منصة دوارة لمدة 30 دقيقة.
  3. لفترة وجيزة دوامة الأنسجة.
  4. أجهزة الطرد المركزي في العينة 200-400 x ج لمدة 2 دقيقة وتجاهل طاف.
  5. إضافة التربسين الطازجة وكاناميسين.
  6. احتضان الأنسجة عند 37 درجة مئوية في حين تناوب لساعة.
  7. دوامة النسيج لمدة 5-10 ثانية.
  8. إضافة 2ML من وسائط النمو (تستكمل مع 10٪ مصل بقري جنيني و 1٪ البنسلين الستربتوميسين) لتنشيط التربسين.
  9. أجهزة الطرد المركزي في الخلايا 200-400 x ج لمدة 2-3 دقيقة.
  10. تجاهل طاف وإضافة 2 مل من التربيةوسائل الإعلام عشر إلى الخلايا مكعبات.
  11. لوحة على طبق ثقافة 6 سم الخلية. تجريف لوحة كما في الخطوة 2.5 من إعداد خطوط الخلية الأولية باستخدام طريقة القشط ليست ضرورية، ولكن من شأنه أن يعزز المرفق وثمرة من الثقافات الأولية.
  12. مراقبة الخلايا تحت المجهر ضوء اليومية. وعادة ما تكون الخلايا مرئية تحت المجهر ضوء بعد 24-48 ساعة (انظر الشكل 3C).
  13. للحفاظ على الثقافات، ورصد الخلايا وسائل الإعلام تغيير كل 2-3 أيام كما في الخطوة 2.9.
  14. لمرور الخلايا، استخدم 0.05٪ أو 0.25٪ التربسين عندما تصل خلايا 75-80٪ confluency (انظر الشكل 3C).

4. حفظ الأنسجة إضافية لتحليل (عض التجميد والتثبيت الفورمالين)

  1. غسل العينة مرتين مع 1X PBS.
  2. نضح السائل بقدر الإمكان.
  3. التقط لتجميد، ضع عينة أنسجة بطانة الرحم في أنبوب الطرد المركزي 1.7 (انظر الأرقام و2F 2G). وضع 1.7أنبوب الطرد المركزي في النيتروجين السائل لمدة 10 ثانية أو حتى يمكن أن نرى أن الأنسجة جمدت أسفل.
    ملاحظة: الحرص على عدم لمس مباشرة النيتروجين السائل عند إعداد العينات. ويمكن تخزين العينات في -80 درجة مئوية حتى مزيد من المعالجة أو التحليل.
  4. لالفورمالين التثبيت، وقطع قطعة صغيرة من أنسجة بطانة الرحم (انظر الشكل 2H)، ويغرق في 10٪ مخزنة الفورمالين الزنك. بعد 24 ساعة، تجاهل الفورمالين وإضافة الايثانول 70٪ لعينات الأنسجة حتى مزيد من المعالجة.

5. المناعي (IF)

  1. تثبيت الخلية
    1. إعداد الخلايا على شريحة ثقافة أو لوحة.
    2. بلطف، وغسل الخلايا مع 1X PBS.
    3. إضافة قبل المبردة (4 ° C) الميثانول والأسيتون (مختلطة في نسبة 1:1) لمدة 5 دقائق.
    4. الهواء الجاف الشريحة قبل المتابعة. ويمكن تخزين الشرائح في 4 درجة مئوية لمدة 1-2 أسابيع إذا لزم الأمر.
  2. تجهيز IF
    1. ترطيب الخلايا مع برنامج تلفزيوني 1X لمدة 10 دقيقة. لFOالنماذج التالية الخطوات 1-6، وإجراء جميع يغسل وحضانات على منصة دوارة.
    2. كتلة باستخدام 1X PBS تستكمل مع 1٪ الأبقار مصل الزلال (BSA) والأنواع 1٪ مصل محددة (مصدر 2 الثانية الضد) لمدة 30 دقيقة في درجة حرارة الغرفة (RT).
    3. احتضان في الأجسام المضادة الأولية (انظر المصنعين توصيات لالتخفيفات الضد). الرجوع إلى مواد محددة الأجسام المضادة. تمييع الأجسام المضادة الأولية في عازلة تمنع جديدة كما في الخطوة 5.2.2. ويمكن إجراء هذه الحضانة لا يقل عن 2 ساعة على RT أو بين عشية وضحاها في 4 درجات مئوية.
    4. يغسل 3 مرات مع برنامج تلفزيوني 1X لمدة 5 دقائق لكل منهما.
    5. احتضان في الضد الثانوية (انظر المصنعين توصيات لالتخفيفات الضد). تمييع الضد الثانوية في عازلة تمنع جديدة كما في الخطوة 5.2.2. لمنع الصور تبيض، فمن المهم إجراء هذه الخطوات اللاحقة وفي غياب الضوء.
    6. يغسل 3 مرات مع برنامج تلفزيوني 1X لمدة 5 دقائق لكل منهما.
    7. Thoroughlذ تجفيف الشرائح.
    8. إضافة تصاعد وسائل الإعلام ودابي الحل counterstaining.
    9. تطبيق ساترة وختم الحواف باستخدام تسرب (ق). ويمكن تخزين الشرائح في 4 درجات مئوية في الظلام لمدة تصل الى 2 أسابيع.

6. استخراج الحمض النووي الريبي

  1. بيليه 1 × 10 7 الخلايا بواسطة الطرد المركزي. جميع المواد والكواشف في هذا البروتوكول يجب ريبونوكلياز الحرة.
  2. ليز الخلايا في 1 مل TRIZOL الكاشف، واحتضان العينات المتجانس لمدة 10 دقيقة في درجة حرارة الغرفة لاستكمال تفارق المجمعات البروتين النووي.
  3. إضافة 200 ميكرولتر من كلوروفورم لكل 1 مل من TRIZOL. هزة بقوة باليد لمدة 15 ثانية، واحتضان لمدة 2-3 دقيقة في RT.
  4. أجهزة الطرد المركزي في أقصى سرعة (15،000 x ج) لمدة 15 دقيقة في 4 درجات مئوية. وسوف ينتج ثلاث طبقات.
  5. نقل المرحلة المائية الأعلى في أنبوب microcentrifuge الطازجة. إضافة 1 ميكرولتر الجليكوجين لزيادة الغلة RNA؛ ومع ذلك، هذه الخطوة كانت ضرورية فقط عندما تكون صغيرةومن المتوقع كمية من الحمض النووي الريبي.
  6. إضافة 0.5 مل من ايزوبروبيل إلى الطبقة المائية، وعكس العينات 3-5 مرات. احتضان العينات في RT لمدة 10 دقيقة. لزيادة الغلة، وعينات يمكن وضعها في -20 درجة مئوية أو -80 درجة مئوية لمدة 30 دقيقة.
  7. أجهزة الطرد المركزي في أقصى سرعة لمدة 10 دقيقة في 4 درجات مئوية.
  8. عند هذه النقطة، يجب أن يكون بيليه صغيرة من الحمض النووي الريبي مرئية. تجاهل طاف.
  9. غسل الحمض النووي الريبي مع 1 مل من الإيثانول بنسبة 75٪.
  10. أجهزة الطرد المركزي في أقصى سرعة لمدة 5 دقائق وتجاهل طاف. يمكن غسلها العينات مرة أخرى لتخليص الملوثات غير العضوية، ولكن هذه الخطوة ليست ضرورية.
  11. لفترة وجيزة، وتجفيف بيليه الحمض النووي الريبي RNA حتى بيليه جافة (عادة ما يستغرق 7-10 دقيقة).
    ملاحظة: هناك خطوة إضافية يمكن استخدامها لتقليل المسألة غير العضوية وتقليل وقت التجفيف. بعد التخلص من طاف من غسل الإيثانول، وعينات تدور في أقصى سرعة لدقيقة إضافية ونضح السائل المتبقي. والحرص على عدم نضح بيليه.
  12. تذوب في الماء الحمض النووي الريبي ريبونوكلياز خالية، وهذا يتوقف على حجم بيليه الحمض النووي الريبي. وتتراوح أحجام عادة 10-50 ميكرولتر.
  13. احتضان العينات في 55 درجة مئوية لمدة 10 دقيقة، وقياس تركيز الحمض النووي الريبي.
  14. مخزن العينات في -20 درجة مئوية حتى مزيد من المعالجة.

7. عكس النسخ

  1. إحضار عينة الحمض النووي الريبي (1-3 ميكروغرام) إلى وحدة تخزين من 9 ميكرولتر مع H 2 O.
  2. RNA الحرارة إلى 70 درجة مئوية لمدة 10 دقيقة.
  3. لإنشاء مزيج الرئيسي AMV، والجمع بين الكواشف التالية: 5 ميكرولتر من dNTP (تركيز العمل من 50 ميكرومتر)، و 5 ميكرولتر من الحمض النووي oligos N6 (تركيز العمل من 80 ميكرومتر)، و 5 ميكرولتر من العازلة 5X AMV، و 1 ميكرولتر من AMV . تم تصميم هذا الحل مزيج الرئيسي في عينة واحدة.
  4. إضافة 16 ميكرولتر من مزيج الرئيسي إلى RNA ساخنة. فإن حجم رد الفعل النهائي سيكون رد فعل 25 ميكرولتر.
  5. استخدام الشروط التالية لPCR النسخ العكسي: (المرحلة 1) 42 درجة مئوية لمدة 90 دقيقة، (ستاجنرال الكتريك 2) 95 درجة مئوية لمدة 5 دقائق، و(المرحلة 3) 4 درجات مئوية حتى مزيد من المعالجة.

8. في الوقت الحقيقي PCR

  1. إجراء تفاعلات PCR باستخدام بادئات، ودرجات حرارة الصلب، وأرقام الدورة، والكواشف وجدت في الجدول 1.
    ملاحظة: هذا هو المثل الأعلى لاتباع إرشادات الشركة المصنعة عند استخدام الكواشف PCR (يرجى الرجوع إلى الشركة وكتالوج الأرقام في المواد).

9. في المختبر بروتوكول Decidualization (مشتقة من الرقم 4 و 5)

  1. لوحة خلايا بطانة الرحم.
  2. تنمو إلى confluency من 75-85٪.
  3. بعد أن تصبح خلايا متكدسة، ويغسل مرة واحدة مع 1X PBS.
  4. بسرعة، وإضافة وسائط خالية من هرمون (تستكمل الفينول RPMI مجانا مع 5٪ من الفحم قطاع FBS و 1٪ البنسلين الستربتوميسين).
  5. بعد 24 ساعة، إضافة هرمون حرة وسائل الإعلام تستكمل مع خلات ميدروكسي (MPA) في تركيز النهائي من 1 ميكرومتر و 8 bromoadenosine 3 '، 5'أحادي-دوري (المخيم) في تركيز النهائي من 0.5 ملم.
  6. بعد 48 ساعة على الأقل، ووقف رد الفعل وحفظ لوحة (ق) لمزيد من المعالجة.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

كما أكد في قسم البروتوكول، يجب التأكد من إجراء جميع الأساليب في ظل حكومة والمؤسسية، والمبادئ التوجيهية الأخلاقية عند التعامل مع وإعداد الأنسجة البشرية.

المدرجة في هذا المخطوط هو التوضيح من سير العمل العام "أسلوب تجريف" (الشكل 1A) و "طريقة التربسين" (الشكل 1B) تستخدم لإنشاء الثقافات بطانة الرحم الأولية. يتم وصف هذه الأساليب بالتفصيل في قسم البروتوكول (انظر أجزاء 1 - 3). كلتا الطريقتين يثبت نجاحها في نمو بطانة الرحم الثقافات الأولية. ميزة ل"طريقة كشط" هو الوقت اللازم لإعداد تقصير؛ ومع ذلك، فإن الوقت الذي يستغرقه لمراقبة خلايا قابلة للحياة هو عادة 2-4 مرات أطول مقارنة "طريقة التربسين."

المقدمة هي الصور الرقمية من الأنسجة البشرية الأولية الواردة من المشتريات الأنسجة. طبقات الرحم يمكن تمييزها من قبلخشونة طبقة، أي عضل الرحم سميكا والعضلات وبطانة الرحم رقيقة وأكثر من ذلك العائد. لقد سلط الضوء على طبقة سميكة، والعضلات الملساء (عضل الرحم) باللون الأبيض والخطوط العريضة لطبقة بطانة الرحم الاهتمام الأسود من عينتين استئصال الرحم مختلفة (أرقام 2A و 2B). في الشكل 2C، موجهة الأنسجة مع عضل الرحم مواجهة في حين يتم وضع بطانة الرحم إلى أسفل. تم مقطوعة رقيقة، وطبقة perimetrial جراحيا وليس سلط عليها الضوء في هذه الصور. من المهم أيضا أن نلاحظ أن حجم طبقة بطانة الرحم في هذه الصور الرقمية 2 الأبعاد يتم تحريف كطبقة 3 الأبعاد الفعلية رقيقة جدا مقارنة عضل الرحم.

خفض حجم الأنسجة المناسبة مهمة لكلا "طريقة القشط" و "طريقة التربسين." في الشكل 2D، وتتم تسمية الأحجام المناسبة لكل طريقة فوق عينة منها. باستخدام 0.5x0 واحد.5 X0.5 سم قطعة ل "طريقة التربسين" [يسار] كافية لإرساء ثقافة. الأنسجة انطلاق ممثل ل "طريقة القشط" [الحق] يشمل جميع طبقات الرحم. ويمثل المنتج النهائي ل "أسلوب تجريف" في الشكل 2E، ويوصى بأن 1x1x1 سم على الأقل من أنسجة بطانة الرحم استخدامها لإنشاء ثقافات قابلة للحياة. شرط لهذه العينة الأنسجة بكثير هو عيب "أسلوب تجريف."

وغالبا ما تستخدم الأنسجة المتبقية بطرق عديدة بما في ذلك البروتين وتحليل الحمض النووي الريبي. لضمان الحفاظ على جودة النسيج، من المهم أن استخدام أسلوب "تجميد المفاجئة" كما هو الحال في قسم البروتوكول (انظر 4). ويتضح هذا الأسلوب أيضا في الشكل والشكل 2F 2G. حفظ الأنسجة اضافية من قبل التثبيت الفورمالين هو أيضا ممارسة شائعة من الأطباء والباحثين. يوصف إعداد الأنسجة لالفورمالين التثبيت في بروتوكول الشكل 2H.

المجهر الضوئي ضروري لرصد الثقافات بطانة الرحم الأولية. خلايا انسجة بطانة الرحم فرد أن يحمل مورفولوجيا الخلايا الليفية (الشكل 3A). "طريقة كشط" عادة يولد مجموعات من الخلايا الناشئة في وقت مبكر، في المقام الأول على طول الناجم عن مشرط الخدوش (الشكل 3B، يوم 2). "الأسلوب التربسين" يولد كل من الكتلة وفرقت أنماط نمو الخلايا (الشكل 3C، يوم 4). أدرجنا العديد من الصور ممثل من الطلاء الأولي (يوم 0) لمرور الأول من كل طريقة (الشكل 3B و 3C).

وتعرف العديد من الأنسجة عن طريق التعبير عنها من علامات الأنسجة محددة مثل الأكتين العضلات الملساء (SMA) عن العضلات الملساء، CD34 عن الخلايا الجذعية المناعي، الخ في حين أجريت التجارب الجينات والبروتينات التعبير عن بطانة الرحم 6-11، حماماعلامة الخلية اللحمية dometrial محددة لم يتم اكتشافها. بدلا من ذلك، الباحثين تقييم بطانة الرحم عادة سدى النقاء من خلال قياس العلامات من الملوثات الخلية المحتملة. على سبيل المثال، تستخدم علامات cytokeratin لإظهار السكان الظهارية. ومع ذلك، فإنه هو أقل أهمية، وذلك لأن إنشاء وصيانة ظهائر بطانة الرحم وعادة ما يصعب اختيارها ضد (المرجع 12 والشكل 4A). إذا كانت العينات التي يمكن الحصول عليها خلال فترة الحمل، والتعبير الإيجابي للHLA-A، B-،-C يوضح الجرثومية، وخلايا الأرومة الغاذية 13. من ناحية أخرى، مثل الخلايا الليفية الوسيطة الأخرى، خلايا انسجة بطانة الرحم التعبير عن vimentin (CDH1). علينا أن نظهر مع المناعي، والتعبير عن vimentin وغياب cytokeratin وE كادهيرين (CDH1) في منطقتنا أنشأت خلايا انسجة بطانة الرحم (الشكل 4B).

أخيرا، ونحن نقدم أدلة وظيفية للثقافة بطانة الرحم الأولية عن طريق ط ن المختبر عفوية decidualization الفحص. وقد تم تكييف هذا الأسلوب من الرقم 4 و وينطوي العلاج الثقافات مع مزيج من ميدروكسي خلات (MPA) و 8 - bromoadenosine 3 '، أحادي 5'-دوري (المخيم) (الموصوفة في 9 في المختبر بروتوكول Decidualization وعلى غرار. في الشكل 5A). بحضور MPA ومخيم، وخلايا انسجة بطانة الرحم يحمل تغييرا كبيرا ملامح التعبير الجيني (إعادة النظر في المرجع 14). علامات decidualization عفوية نشرت في كثير من الأحيان هي البرولاكتين (PRL) وعامل النمو الذي يشبه الانسولين ملزم بروتين 1 (IGFBP1) (إعادة النظر في المرجع 14). استجابة لهذه الجينات اثنين MPA والمخيم هي مؤشرات قوية من كلا decidualization عفوية وإنشاء الناجح للثقافة انسجة بطانة الرحم. علينا أن نظهر هذا في الشكل 5B.

ther.within صفحة = "دائما"> الشكل 1
الشكل 1. تخطيطي طريقتين العزلة بطانة الرحم الأولية. (أ) الخطوات 2،1-2،10 للأسلوب تجريف المعروضة في مخطط هيكلي. (B) الخطوات 3،1-3،14 للأسلوب التربسين المعروضة في مخطط هيكلي. اضغط هنا لمشاهدة صورة أكبر.

الرقم 2
الشكل 2. معالجة الأنسجة الرحم. (AC) عينات من الرحم السريرية اثنين من المرضى الإناث. وتستمد A & C من المريض 1 ومشتق من B المريض 2. مستأصل جراحيا أنسجة الرحم (يسار) وhighlighteطبقات د الرحم (يمين). (A & B) وحلقت في عضل الرحم وبطانة الرحم والأبيض في الأسود. (C) وعضل الرحم يواجه الكاميرا. (D) وأشار ممثل أحجام عينة بطانة الرحم الأولية لكلتا الطريقتين العزلة. يتطلب أسلوب التربسين الخالص بطانة الرحم قبل إضافة التربسين في حين أن طريقة كشط يمكن أن يستخدم العينات الرحم بأكمله. (E) مثال على عينة بطانة الرحم المصنعة للأسلوب تجريف. (F & G) صورة المتبقية أنسجة الرحم الذي يجري إعداده لالتقط تجميد. أظهرت هو وعاء معدني من صنع مختبر استخدامها لهذا الأسلوب. (H) الفورمالين التثبيت من عينة بطانة الرحم. اضغط هنا لمشاهدة صورة أكبر.

الرقم 3 الرقم 3. الصور المجهري الخفيفة من الثقافات بطانة الرحم الأولية. (أ) وصور الممثل من بطانة الرحم مزارع الخلايا اللحمية التي اتخذت على مختلف القوى وconfluency (B) وصور الممثل للأسلوب تجريف (أيام 0-16) التي اتخذت من صحن الثقافة نفسها، والمدعوم في 10X ملاحظة: خطوط البصرية تشير الخدوش من شفرة جراحية (C) وصور الممثل للطريقة التربسين. (أيام 0-16) التي اتخذت من صحن الثقافة نفسها، والمدعوم في 10X اضغط هنا لمشاهدة صورة أكبر.

الرقم 4
الشكل 4. الصور المناعي من خلايا انسجة بطانة الرحم. (A) المناعيالثقافات بطانة الرحم الأولية معزولة عبر أسلوب تجريف. الصور تثبت فقدان cytokeratin بين مرور 2 (P2) ومرور 5 (P5). واستخدمت البروتين اللوكيميا (حزب الرابطة الاسلامية) البروتين النووي وتلطيخ دابي والضوابط. (B) الصور تثبت تلطيخ إيجابية للعلامة الوسيطة Vimentin. تظهر الصور أيضا تلطيخ السلبية لE كادهيرين (CDH1) وCytokeratin. تلطيخ دابي لوالبرولمفوسيت البروتين سرطان الدم (حزب الرابطة الاسلامية) وقدمت والضوابط. اضغط هنا لمشاهدة صورة أكبر.

الرقم 5
الرقم 5. decidualization العفوي اثنين من خلايا انسجة بطانة الرحم الأولية. (أ) الخطوط العريضة للإجراءات التجريبية. (B) Upregulation من البرولاكتين (PRL) وعامل النمو الذي يشبه الانسولين ملزم بروتين 1 (IGFBP1) التعبير الجيني في استجابة لMPA والمخيم. وتم قياس النتائج عبر RT-QPCR، وكان التعبير لتطبيع GAPDH. تم حساب أهمية استخدام الطلاب اختبار t (P <0.001 *** وP <0.0001 ****). تم عزل كل من خطوط الخلايا باستخدام طريقة تجريف. اضغط هنا لمشاهدة صورة أكبر.

كتاب تمهيدي تسلسل الصلب درجة الحرارة (° C) دورات فحص
البرولاكتين (PRL) إلى الأمام CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
البرولاكتين (PRL) عكسي TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
بروتين ملزمة عامل النمو الذي يشبه الانسولين 1 (IGFBP1)إلى الأمام TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
بروتين ملزمة عامل النمو الذي يشبه الانسولين 1 (IGFBP1) عكسي GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH غير محدد (انظر القائمة كاشف) 60 40 Taqman

الجدول 1. ظروف PCR لعلامات decidualization.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

وقد وصفت جماعات أخرى وتكييفها منهجية لإعداد الثقافات انسجة بطانة الرحم، وهي في معظمها تستخدم كولاجيناز 4،12،13،15-18. في هذا المخطوط، قدمنا ​​المنهجية والدليل على طريقتين مبسطة الأولية بطانة الرحم الثقافة اللحمية، وكلاهما تستخدم من قبل مختبرنا لأسباب اقتصادية وتوافر مريحة من التربسين و / أو شفرة حلاقة.

عند المقارنة بين طريقتين لدينا، سواء بنجاح توليد الثقافات الأولية قابلة للحياة. الأسلوب المفضل لدينا هو الأسلوب التربسين كما أن هناك عادة عائدات أعلى مع أصغر متطلبات حجم العينة. ومع ذلك، إذا إعداد الوقت محدود، يتطلب أسلوب تجريف 30 دقيقة بينما طلي الخلايا باستخدام طريقة التربسين يأخذ أكثر من ساعة ونصف.

الجدير بالذكر أيضا هو أن علينا أن نظهر هذه الأساليب مع عينات استئصال الرحم بدلا من الخزعات بطانة الرحم. الحيوي بطانة الرحمتؤخذ psies دون تدخل كبير وتميل إلى إنتاج عينات أصغر. لا يزال، يجب أن الطرق الموضحة في هذه المخطوطة (وخاصة طريقة التربسين) تسفر الثقافات من الخزعات بطانة الرحم.

هناك تطبيقات عديدة لخلايا انسجة بطانة الرحم الأولية. مقارنة الثقافات انسجة بطانة الرحم من الإنسان مقابل الثدييات الأخرى يمكن أن توفر أدلة على الأسئلة التي تم مناقشتها لعدة قرون حول لماذا البشر تحيض. وهناك غيرها من الدراسات التي تتطلب علم وظائف الأعضاء غير مستكشفة في الثقافة المختبر. ذات أهمية خاصة هي الاكتشافات التي توفر نظرة ثاقبة الأحداث دورة التكاثر مثل هذه النتائج التي ربطت الأحداث الجزيئية جينية للأحداث الفنية للدورة التكاثر 19،20، 21، واستعرضت في المرجع 11.

سوف تستفيد كثيرا من الأطباء الذين يدرسون ثقافة انسجة بطانة الرحم وتحديد العلامات البيولوجيةو في حالات الاضطرابات الإنجابية والأورام الخبيثة السرطان. بين عامي 2006 و 2010، أفيد أن 7.4 مليون من النساء وشركائهم استخدام خدمات العقم في الولايات المتحدة 22. ويرجع ذلك إلى فشل decidualization 23 في المئة كبيرة من العقم. علاوة على ذلك، إلا في الآونة الأخيرة يجري تقييم العلاقة بين أمراض بطانة الرحم مثل تضخم بطانة الرحم وإلى العقم. القدرة على دراسة سرطان الرحم الرحم في المختبر من خلال النمذجة هو أيضا لا تقدر بثمن لأنه حتى وإن ساركوما بطانة الرحم المتقدمة أمر نادر الحدوث، يمكن أن تكون قاتلة. من خلال إنشاء المختبر في الثقافات الأولية، ونحن دراسة تأثير الأحداث الجزيئية المرتبطة بالأمراض ويمكن أن تولد التطبيقات السريرية المفترضة.

في الختام، وتوليد ممثل وفعالة في النماذج الحية لكثير من هذه التطبيقات أمر صعب. وهذا يجعل وضع فيالمختبر الثقافات بطانة الرحم الأولية لدراسة العديد من الوظائف في الجسم الحي حرجة. هذه طريقتين العزلة بطانة الرحم، "طريقة القشط" و "طريقة التربسين،" سوف تساعد على توفير موطئ قدم لفهمنا للعلم وظائف الأعضاء وعلم الأمراض بطانة الرحم.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

والكتاب ليس لديهم ما الإفصاح.

Acknowledgements

نشكر الجهود التعاونية الدكتور ثاو دانغ وأعضاء مختبر لها لاستخدام معدات التصوير والمجهر بهم. كما نشكر Biorepository والأنسجة مرفق البحوث (BTRF) الأساسية، جيف هاربر، والمقيمين في جامعة فيرجينيا لتزويدنا أنسجة الرحم. نشكر كارول Szlachta للمساعدة في تخطيطي لمحة عامة.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics