Два Методы Создание первичных клеток человека эндометрия стромальных от гистерэктомии образцов

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Создание первичных эндометрия системы стромальных клеточных культур от гистерэктомии образцов является ценным биологическим техника и решающим шагом до проводит широкий спектр исследований направлена. Здесь мы описываем два методы, используемые для установления стромальных культур из хирургически удаленных эндометрия тканях больных людей.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Много усилий было посвящено установить в пробирке системах клеточных культур. Эти системы предназначены для моделирования огромное количество естественных условиях процессов в. Клеточные культуры системы, вытекающие из эндометрия образцов человека не являются исключением. Область применения простирается от нормальных циклических физиологических процессов в эндометрии патологий, таких как гинекологического рака, инфекционных заболеваний, а также репродуктивных недостатков. Здесь мы предоставляем два метода для создания первичных эндометрия стромальных клеток из хирургически удаленных эндометрия гистерэктомии образцов. Первый метод называют "методом очищающего" и включает в себя механическое выскабливание с помощью хирургических или бритвенных лезвий в то время как второй метод называют "метод трипсин". Этот последний метод использует ферментативную активность трипсина, чтобы способствовать отделению клеток и первичных клетки вырост. Проиллюстрируем шаг за шагом методологии с помощью цифровых изображений и микроскопии. Мы также Providпримеры е для проверки эндометрия линии стромальных клеток с помощью количественных реального времени полимеразной цепной реакции (КПЦР) и иммунофлюоресценции (ИФ).

Introduction

Человеком матки корпус состоит из трех слоев, в периметрий (или серозной), миометрия и эндометрия. Отличительные каждый из этих слоев является важным шагом для установления эндометрия клеточных линий. Периметрий является самой внешней слой матки и состоит из тонких, серозных клеток. Миометрия является толстый, средний слой матки и состоит из гладкомышечных клеток. Эндометрий идентифицируется как внутреннего слоя матки и включает эпителиальные и стромальных клеток населения.

Эндометрий далее подразделяется в базального слоя которого стволовых клеток населения Предполагается для повторного заполнения functionalis слой примерно каждый 28 дней 1. Functionalis слой человеческого эндометрия претерпевает значительные биохимические и морфологические изменения в связи с циркулирующих гормонов. Эти гормоны являются производными от гипофиза и яичников.

координирует производство и выброс гормонов приводит к репродуктивного цикла. Репродуктивный цикл предназначен для подготовки эндометрия для потенциальных событий имплантации эмбриона. У людей, репродуктивный цикл известен как "менструального цикла" и делится на три этапа - пролиферативная, секреторных и менструальных. Пролиферативная фаза включает в себя пролиферацию functionalis эндометрия слоя в то время как секреторная фаза отмечена functionalis созревания. В частности, внеклеточные изменения, выделениями и клеточная дифференцировка сигнал потенциального имплантации. Если имплантация не происходит до конца секреторную фазу, functionalis эндометрия слой пролить в течение менструального фазы. Важность менструации и событий, которые вызывают пролития на functionalis слоя все еще обсуждаются. В организме человека он был поставлен что менструации является результатом конкретного события середины секреторную фазу дифференцировки известнойкак "спонтанное decidualization" 2. В этой рукописи, мы предоставляем подробную методологию для обеих эндометрия методов изоляции стромальных клеток, и использовать комбинацию иммунофлюоресценции и цифровых изображений, чтобы продемонстрировать эффективность этих подходов. Кроме того, мы применяем обычно используют искусственное модели спонтанного decidualization для подтверждения изоляции эндометрия стромальных клеток.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Гистерэктомия образцы, используемые в этой рукописи были собраны в соответствии с Университетом IRB-утвержденным протоколом этики пронумерованных IRB-HSR # 14424.

1. Приобретение Образец от клинической Источник

  1. Получить правительство и учреждение на основе этических принципов и документацию утверждения перед началом.
  2. Провести все шаги в стерильных условиях.
  3. Сохранение пациента, полученных ткани в медиа-среде RPMI (или DMEM с высоким содержанием глюкозы /) в 50 мл пробирку при 4 ° С, если образец не может быть обработан в культуре немедленно. В течение максимум 24 часов Образцы могут храниться в этом состоянии.
  4. Промыть образец ткани три раза стерильной 1X фосфатно-буферным раствором (PBS) и отменить решение между стирок.

2. Подготовка первичных клеточных линий с использованием очищающего метод

  1. Добавить 4-10 мл питательной среды (RPMI или DMEM с высоким содержанием глюкозы /, дополненной 10% фетальной бычьей сыворотки и 1% пенициллин-streptomyCIN) в ткани и добавить Fungizone (0,25 мкг / мл конечная концентрация) в течение 30 мин.
  2. Откажитесь от средств массовой информации роста.
  3. Вымойте ткань дважды 1X PBS.
  4. Поместите ткань на планшет для культивирования 6 см клеток различать миометрия и эндометрия слоев (см. рис 2А-2С также описание). Отделите эндометрий.
  5. Использование скальпеля или лезвия бритвы, секут ткани на мелкие кусочки, почесывая на блюдо 6 см клеточной культуре. Эти царапины облегчить присоединение развивающихся первичных клеток эндометрия. По сравнению с методом трипсина, больше ткани требуется (см. рисунок 2D для приближения).
  6. Аккуратно добавьте 2 мл питательной среды для поцарапал блюдо (фрагменты ткани будут видны и в идеале иммобилизованных от движения царапин).
  7. Передача пластину (ы) для назначенного инкубаторе для клеточных культур (37 ° C и 5% CO 2). Назначить место для линий первичных клеточных, от др.э клеточных культур блюда. Первичные культуры более чувствительны к инфекции и контаминации.
  8. Осматривают клетки под световым микроскопом ежедневно. Небольшие популяции клеток должна выйти на второй или третий день со всего нарезанных тканей (см. рис 3B).
  9. Для поддержания культуры, мыть осторожно с 1X PBS и добавить свежей питательной средой (2 мл) каждые три дня. При увеличении скорости пролиферации, дополнительные носители роста (3-4 мл) можно добавить к 6 см культуральный планшет (ы).
    Примечание: Во время стирки и СМИ изменений, кусочки ткани, вероятно, будет атмосферный. Это не повлияет на рост ненужных клеток. Кусочки ткани следует всасывается последующей стадии (2.10), поскольку новые колонии вряд ли появится после одной недели.
  10. Когда 6 см пластины составляет примерно 75 - 80% сливной (см. рисунок 3B), прохождение с помощью 0,05% трипсина. Первичные элементы не могут быть пассировать на неопределенный срок - заморозить вниз на одну тарелку клеток, как только два или три пластины маintained. Если несколько каналов требуется, выполните протокол увековечении (обзор в работе 3).

3. Подготовка первичных клеточных линий с использованием трипсин метод

  1. Поместите небольшой кусочек ткани эндометрия (см. рис 2D для приближения) в 2 мл 0,25% трипсина с добавлением канамицина (0,03 мг / мл конечная концентрация).
  2. Инкубируйте ткани при 37 ° С на вращающихся платформу в течение 30 мин.
  3. Кратко вихрь ткани.
  4. Центрифуга образца при 200-400 мкг в течение 2 мин и отбросить супернатант.
  5. Добавить свежий трипсин и канамицин.
  6. Инкубируйте ткани при 37 ° С при вращении в течение часа.
  7. Vortex ткани для 5-10 сек.
  8. Добавить 2 мл питательной среды (с добавлением 10% эмбриональной телячьей сыворотки и 1% пенициллин-стрептомицин), чтобы отключить трипсина.
  9. Центрифуга клетки при 200-400 мкг в течение 2-3 мин.
  10. Удалите супернатант и добавить 2 мл Growй СМИ к гранулированных клеток.
  11. Пластина на чашку 6 см клеточной культуре. Зачистка тарелку, как в шаге 2.5 Подготовка первичных клеточных линий с использованием очищающего метод не является необходимым, но усиливает привязанность и разрастание первичных культурах.
  12. Монитор клетки под световым микроскопом ежедневно. Клетки обычно видны под световым микроскопом после 24-48 часов (см. фиг.3С).
  13. Для поддержания культур, мониторинг клетки и изменить медиа каждые 2-3 дня, как в шаге 2.9.
  14. Для прохождения клетки, используйте 0,05% или 0,25% трипсин, когда клетки достигают 75-80% слияния (см. рис 3в).

4. Сохранение дополнительных ткани для анализа (SNAP Холодильные и формалина крепление)

  1. Вымойте образец дважды 1X PBS.
  2. Аспирируйте столько жидкости, сколько возможно.
  3. Для оснастки замораживания поместите образец ткани эндометрия в 1,7 трубки центрифуги (см. рис 2F и 2G). Наведите 1,7центрифужную пробирку в жидком азоте в течение 10 сек или до можно видеть, что ткань замораживали.
    Примечание: Будьте осторожны, не прикасайтесь непосредственно жидкого азота при подготовке образцов. Образцы можно хранить при -80 ° С до дальнейшей обработки или анализа.
  4. Для формалина фиксации, вырезать небольшой кусочек ткани эндометрия (см. рис 2H), и погрузите в 10% буферном цинка формалина. Через 24 ч отбрасывать формалин и добавить 70% этанола в образцах ткани до дальнейшей обработки.

5. Иммунофлуоресценции (ИФ)

  1. Фиксация Сотовый
    1. Подготовка клеток на культуральной слайда или пластины.
    2. Осторожно, мыть клетки с 1X PBS.
    3. Добавить предварительно охлажденной (4 ° С) метанола и ацетона (смешивали в соотношении 1:1) в течение 5 мин.
    4. Воздух сухой слайд прежде чем продолжить. Slide можно хранить при температуре 4 ° С в течение 1-2 недель, если это необходимо.
  2. Обработка ЕСЛИ
    1. Увлажняет клетки с 1X PBS в течение 10 мин. Для FOllowing шаги 1-6, проводить все моет и инкубации на вращающейся платформе.
    2. Блок использованием 1X PBS с добавлением 1% бычьего сывороточного альбумина (BSA) и 1% видов конкретных сыворотки (источник 2-й антитела) в течение 30 мин при комнатной температуре (RT).
    3. Выдержите в первичных антител (см. производителей рекомендации для разведения антител). См. Материалы для специфических антител. Развести первичных антител в свежем буфере блокирующего как на шаге 5.2.2. Это инкубирование может быть проведено в течение по крайней мере 2 ч при комнатной температуре или в течение ночи при 4 ° С.
    4. Промыть 3 раза с 1X PBS в течение 5 мин каждый.
    5. Выдержите в вторичными антителами (см. производителей рекомендации для разведения антител). Развести вторичного антитела в свежем буфере блокирующего, как в шаге 5.2.2. Для предотвращения фото-отбеливание, важно проводить это и последующие шаги в отсутствие света.
    6. Промыть 3 раза с 1X PBS в течение 5 мин каждый.
    7. Thoroughlу высохнуть слайды.
    8. Добавить монтажные СМИ и DAPI контрастного решение.
    9. Применить покровное и запечатать края с использованием герметика (ы). Слайды можно хранить при температуре 4 ° С в темноте в течение до 2 недель.

6. Экстракция РНК

  1. Гранул 1 × 10 7 клеток путем центрифугирования. Все материалы и реагенты в этом протоколе должны быть РНКазы.
  2. Клетки лизируют в 1 мл реагента TRIZOL и инкубировать гомогенизированных образцов в течение 10 мин при комнатной температуре до полной диссоциации комплексов нуклеопротеидных.
  3. Добавить 200 мкл хлороформа на 1 мл TRIzol. Встряхивать вручную в течение 15 с и инкубировать в течение 2-3 мин при комнатной температуре.
  4. Центрифуге при максимальной скорости (15000 мкг) в течение 15 мин при 4 ° С. Три слоя приведет.
  5. Передача верхнюю водную фазу в свежую пробирку микроцентрифужных. Добавить 1 мкл гликогена увеличить выход РНК; Однако, этот шаг необходим только когда маленькийколичество РНК ожидается.
  6. Добавить 0,5 мл изопропилового спирта к водному слою, и инвертировать образцы в 3-5 раз. Инкубируйте образцы при комнатной температуре в течение 10 мин. Чтобы увеличить выход, образцы могут быть помещены в -20 ° С или -80 ° С в течение 30 мин.
  7. Центрифуге при максимальной скорости в течение 10 мин при 4 ° С.
  8. В этот момент, небольшой осадок РНК должны быть видны. Удалите супернатант.
  9. Вымойте РНК с 1 мл 75% этанола.
  10. Центрифуге при максимальной скорости в течение 5 мин и отбросить супернатант. Образцы можно мыть больше, чтобы избавиться неорганические загрязнения один раз, но этот шаг не является необходимым.
  11. Вкратце, высушить РНК гранул до осадок РНК не высохнет (обычно занимает 7-10 мин).
    Примечание: Еще один шаг может быть использован для уменьшения неорганические вещества и уменьшить время сушки. После удаления супернатанта из этанола стирки, образцов спиновых на максимальной скорости за дополнительную минуту и ​​аспирации остаточной жидкости. Будьте осторожны, не аспирации осадок.
  12. Растворить в РНК РНКазы без воды, в зависимости от размера гранул РНК. Объемы обычно составляет от 10-50 мкл.
  13. Инкубируйте образцы при 55 ° С в течение 10 мин, и измерения концентрации РНК.
  14. Храните образцы при -20 ° С до дальнейшей обработки.

7. Обратной транскрипции

  1. Доведите образца РНК (1-3 мкг) до объема 9 мкл Н 2 О.
  2. Тепло РНК до 70 ° С в течение 10 мин.
  3. Чтобы создать основной смеси AMV, объединить следующие реагенты: 5 мкл дНТФ (рабочий концентрация 50 мкМ), 5 мкл олигонуклеотидов ДНК (N6 работает концентрации 80 мкМ), 5 мкл 5X из AMV буфера и 1 мкл AMV . Это решение мастером микс предназначен в одном образце.
  4. Добавить 16 мкл мастер-микс к нагретой РНК. Конечный реакционный объем будет 25 мкл реакции.
  5. Используйте следующие ПЦР условия для обратной транскрипции: (1 этап) 42 ° C в течение 90 мин, (STAGE 2) 95 ° C в течение 5 мин, и (Этап 3) 4 ° С до дальнейшей обработки.

8. Настоящее ПЦР Время

  1. Проведение ПЦР-реакции с использованием праймеров, температуры отжига номера цикла, и реагенты, найденные в таблице 1.
    Примечание: Это идеальное место, чтобы следовать инструкциям производителя при использовании ПЦР реагенты (см. каталог компании и чисел в материалах).

9. Экстракорпоральное Decidualization протокол (полученный из работы 4 и 5)

  1. Plate клетки эндометрия.
  2. Расти к слияния 75-85%.
  3. После клетки становятся сливающиеся, мыть один раз с 1X PBS.
  4. Быстро, добавить гормонов без СМИ (Фенол бесплатно RPMI с добавлением 5% угля полосы FBS и 1% пенициллин-стрептомицина).
  5. После 24 часов, добавить гормональные бесплатно среде с медроксипрогестеронацетата (MPA) в конечной концентрации 1 мкМ и 8-bromoadenosine 3 ', 5'-Циклического монофосфата (цАМФ) в конечной концентрации 0,5 мМ.
  6. После по меньшей мере 48 ч, остановить реакцию и сохранить пластину (ы) для дальнейшей обработки.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Как подчеркивается в разделе протокола, обязательно проводить все методы в рамках государственных, институциональных и этических принципов при обращении и подготовки ткани человека.

В эту рукопись является иллюстрацией общего процесса по методу "очищающего" (Фиг.1А) и "метод трипсин" (фиг.1В) используется для установления первичных культур эндометрия. Эти методы подробно описаны в разделе протокола (см. детали 1 -. 3.). Оба метода окажутся успешными в росте первичных эндометрия культур. Преимущество "метод выскабливание" является сокращенное время подготовка; Однако, время, которое требуется, чтобы наблюдать жизнеспособных клеток, как правило, 2 - 4 раза больше по сравнению с "методом трипсина."

При условии, цифровые образы начальной человеческой ткани, полученной от закупок тканей. Маточные слои можно отличить поГрубость слоя, т.е. миометрия толстая и мускулистая, эндометрий тонкий и более урожайный. Мы отметили толстый, гладкий слой мышц (миометрии) в белом и описано эндометрия слой интерес в черный из двух разных образцов гистерэктомию (фиг.2А и 2В). На рисунке 2C, ткани ориентированы миометрия вверх в то время как эндометрий позиционируется вниз. Тонкий, perimetrial слой хирургическим резекцию, а не выделены этих образов. Важно также отметить, что размер эндометрия слоя в этих цифровых 2-мерных изображений неверно, как фактический 3-мерный слой является очень тонким по сравнению с миометрии.

Резка подходящий размер ткани имеет важное значение как "методом очищающего" и "метода трипсина." На рисунке 2D, соответствующие размеры предназначены для каждого метода выше соответствующего образца. Использование одного 0.5x00,5 x0.5 см кусок для "метода трипсина» [левой] достаточно для создания культуры. Представитель отправной ткани для "метода очищающего" [прямо] включает в себя все матки слоев. Конечный продукт для "метода очищающего" представлена ​​на рисунке 2Е, и рекомендуется, чтобы по крайней мере 1x1x1 см ткани эндометрия быть использованы для установления жизнеспособных культур. Требование этого много образца ткани является недостатком "методом очищающего».

Оставшееся ткань часто используются в различных способов, включая белка и РНК анализа. В целях обеспечения сохранности качества ткани, важно использовать "оснастки замораживания" метод, как в разделе протокола (см. 4).. Этот метод также показано на рисунке 2F и 2G рис. Сохранение дополнительную ткань, формалина фиксации также общая практика патологоанатомов и исследователей. Подготовка ткани для формалина фиксации описан в Протоколе рисунке 2H.

Световая микроскопия имеет важное значение для мониторинга основных эндометрия культур. Индивидуальные эндометрия стромальных клеток должны проявлять фибробластов морфологии (рис. 3А). "Метод выскабливание", как правило, порождает кластеры начале развивающихся клеток, главным образом на скальпель, вызванной царапин (рис. 3В, День 2). "Метод трипсин" генерирует как кластер и распределенных модели роста клеток (рис. 3C, день 4). Мы включили несколько представительных изображения с первоначального посева (день 0) в первом прохождении каждого метода (рис. 3В и 3С).

Многие ткани определяются их экспрессии тканеспецифических маркеров, таких как актин гладких мышц (SMA) для гладких мышц, CD34 для иммунных стволовых клеток, и т.д. В то время как эксперименты экспрессии генов и белков были проведены для эндометрия 6-11 ваннойспецифическим маркером dometrial стромальных клеток до сих пор не обнаружены. Вместо этого, исследователи обычно оценивают эндометрия чистоту стромы путем измерения маркеры из потенциальных загрязнителей клеток. Например, Цитокератин маркеры используются, чтобы показать эпителиальные населения. Тем не менее, это меньше беспокойства, потому что создание и поддержание эндометрия эпителия трудно и обычно выбирается против (Ref 12 и рисунке 4A). Если образцы были быть получены во время беременности, положительный экспрессии HLA-A,-B,-C демонстрирует зародыш, клетки трофобласта 13. С другой стороны, как и другие мезенхимные фибробластов, эндометрия стромальные клетки экспрессируют виментин (CDH1). Мы демонстрируем с иммунофлюоресценции, выражения виментина и отсутствие цитокератина и E кадхерина (CDH1) на форуме установленных эндометрия стромальных клеток (рис. 4б).

Наконец, мы предоставляем функциональное доказательство первичного эндометрия культуры через Iн пробирке спонтанное decidualization анализа. Этот метод был адаптирован из работы 4 и 5, и включает обработку культур с комбинацией медроксипрогестеронацетата (MPA) и 8 - bromoadenosine 3 ', 5'-циклического монофосфата (цАМФ) (описано в 9 Экстракорпоральное Decidualization протокол и моделируется. на рисунке 5А). В присутствии MPA и цАМФ, эндометрия стромальные клетки обладают значительно измененные профили экспрессии генов (см. обзор в работе 14). В опубликованных часто спонтанные маркеры decidualization являются пролактина (PRL) и инсулиноподобный фактор роста Binding Protein 1 (IGFBP1) (см. обзор в работе 14). Реакция этих двух генов в МПА и цАМФ являются убедительным свидетельством как спонтанного decidualization и успешного создания эндометрия стромы культуры. Покажем это на фиг.5В.


Рисунок 1. Принципиальная из двух основных эндометрия методов изоляции. (А) Шаги 2.1-2.10 метода очищающего изображена в организационной диаграмме. (В) Шаги 3.1-3.14 метода трипсина, отображаемой в организационной диаграмме. Кликните здесь, чтобы посмотреть увеличенное изображение.

Рисунок 2
Рисунок 2. Обработка ткани матки. (AC) Клинические образцы матки от двух пациенток. & C являются производными от пациента 1 и В является производным от пациента 2. хирургически удаленных ткани матки (слева) и highlighteг маточные слои (справа). (A & B) Миометрий обведен белым и эндометрия в черном цвете. (С) Миометрий смотрят в камеру. (D) Первоначальные представительные эндометрия размеры выборки для обоих методов изоляции указаны. Способ трипсин требует чистого эндометрий перед добавлением трипсина в то время как метод выскабливание может использует весь матки образцов. (E) Пример обработанного образца эндометрия метода очищающего. (F & G) Изображение оставшейся ткани матки готовится к застежкой Замораживание. Показана лабораторного сделал металлический контейнер используется для этого метода. (Н) в формалине фиксация эндометрия образца. Кликните здесь, чтобы посмотреть увеличенное изображение.

Рисунок 3 Рисунок 3. Световой микроскопии образы первичных эндометрия культур. . (А) Типичные изображения эндометрия культур стромальных клеток, принятых на различных полномочий и слияния (В) Типичные изображения методом очищающего (Дни 0 - 16), взятых из той же культуры блюдо, питание в 10 раз. Примечание: Визуальные линии показывают царапины от хирургические лезвия (C) Представитель изображения методом трипсина.. (дни 0 - 16) приняты той же культуры блюдо, питание на 10x Кликните здесь, чтобы посмотреть увеличенное изображение.

Рисунок 4
Рисунок 4. Иммунофлуоресценции образы эндометрия стромальных клеток. (А) Иммунофлуоресценциипервичных эндометрия культур изолированы с помощью метода очищающего. Изображения демонстрируют потерю цитокератина между прохода 2 (P2) и канал 5 (P5). Promyelocytic белок лейкоз (PML) ядерный белок и окрашивание DAPI использовали в качестве контролей. (B) изображения демонстрируют положительное окрашивание на мезенхимальных маркера Виментин. Изображения также показывают отрицательную окрашивание на E кадхерина (CDH1) и цитокератину. Окрашивание для DAPI и промиелоцитарного белка лейкоза (PML) были предоставлены в качестве контроля. Кликните здесь, чтобы посмотреть увеличенное изображение.

Рисунок 5
Рисунок 5. Спонтанное decidualization из двух первичных стромальных клеток эндометрия. (А) Схема экспериментальной процедуры. (В) Upregulation пролактина (ПРЛ) иИнсулиноподобный фактор роста Binding Protein 1 (IGFBP1) экспрессии гена в ответ на МПА и цАМФ. Результаты были измерены с помощью RT-КПЦР, и выражение, нормированная на GAPDH. Значение была рассчитана с использованием студентов Т-теста (р <0,001 *** и р <0,0001 ****). Обе клеточные линии были изолированы с помощью метода выскабливание. Кликните здесь, чтобы посмотреть увеличенное изображение.

Грунтовка Последовательность Отжиг температура (° С) Циклы Анализ
Пролактин (ПРЛ) Вперед CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
Пролактин (ПРЛ) Обратный TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
Фактор инсулиноподобный роста связывающий белок 1 (IGFBP1)Вперед TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
Инсулиноподобный фактор роста-связывающий белок 1 (IGFBP1) Обратный GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
ГАФДГ Не указано (см. список реагентов) 60 40 Taqman

Таблица 1. Условия ПЦР для decidualization маркеров.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Другие группы описали и адаптированы методологии для подготовки эндометрия стромальных культур, большинство из которых используют коллагеназы 4,12,13,15-18. В этой рукописи, мы обеспечили методику и доказательства в течение двух упрощенных первичных стромальных эндометрия методов культуры, оба из которых используемых нашей лаборатории по экономическим причинам и удобной доступности трипсина и / или лезвием бритвы.

При сравнении наших двух методов, как успешно генерировать жизнеспособные первичных культур. Наша предпочтительным методом является метод трипсин, поскольку, как правило, более высокий выход с меньшим требованием размера образца. Однако, если ограничено время приготовления, метод выскабливание требуется 30 минут, тогда как покрытие клетки с помощью метода трипсина занимает более полутора часов.

Следует также отметить, что мы демонстрируем эти методы с образцами гистерэктомии в отличие от эндометрия биопсии. Эндометрия биоpsies взяты без существенных вторжения и, как правило, дают меньшие образцы. Тем не менее, способы, описанные в этой рукописи (особенно метода трипсин) должно дать культуры эндометриальных биопсий.

Есть множество приложений для первичных эндометрия стромальных клеток. Сравнивая эндометрия стромальных культур от человека по сравнению с другими млекопитающими поможет понять на вопросы, которые были обсуждены на протяжении веков о том, почему люди менструации. Есть и другие неисследованные физиология исследования, которые требуют в пробирке культуру. Особый интерес представляют находки, которые обеспечивают понимание событий репродуктивного цикла, таких как выводы, которые связаны эпигенетические молекулярных событий в функциональных событий репродуктивного цикла 19,20, 21, и отзывы в работе 11.

Клиницисты бы извлечь большую пользу из изучения эндометрия стромы культуру и выявления биомаркеровс в случаях репродуктивных расстройств и злокачественных раковых. Между 2006 и 2010, было сообщено, что 7,4 миллиона женщин и их партнеров использовать лечение бесплодия в Соединенных Штатах 22. Значительный процент бесплодия из-за отказа decidualization 23. Кроме того, взаимосвязь между эндометрия заболеваний, таких как гиперплазия и эндометриоз к бесплодию только недавно оценивается. Способность учиться матки гинекологических рака путем моделирования в пробирке также неоценима, потому что даже при том, что передовые эндометрия саркома встречается редко, она может привести к летальному исходу. Устанавливая в пробирке первичных культурах, мы изучаем влияние молекулярных событий, связанных с заболеваниями и может генерировать предполагаемые клинические применения.

В заключение генерации представительным и эффективным в моделях естественных условиях для многих из этих приложений трудно. Это делает разработку вVitro первичные эндометрия культур для изучения несколько естественных условиях функции в критической. Эти два эндометрия методы изоляции, "метод выскабливание" и "метод трипсин," поможет обеспечить плацдарм для нашего понимания эндометрия физиологии и патологии.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего раскрытия.

Acknowledgements

Мы благодарим совместные усилия доктора Тао Данг и членов своей лаборатории за использование их изображений и микроскопа оборудования. Мы также благодарим Biorepository и тканей исследований фонда (BTRF) основной, Джефф Харпер и жителей в университете Вирджинии за предоставление нам ткани матки. Мы благодарим Karol шляхты за помощь с схематический обзор.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics