गर्भाशय के नमूनों से प्राथमिक मानव एंडोमेट्रियल stromal कोशिकाओं की स्थापना के लिए दो तरीके

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

गर्भाशय नमूनों से प्राथमिक एंडोमेट्रियल stromal सेल संस्कृति प्रणालियों की स्थापना से पहले अनुसंधान करना है की एक विशाल सरणी का पीछा करने के लिए एक मूल्यवान जैविक तकनीक और एक महत्वपूर्ण कदम है. यहाँ, हम मानव रोगियों की शल्य चिकित्सा resected एंडोमेट्रियल ऊतकों से stromal संस्कृतियों की स्थापना के लिए प्रयोग किया जाता दो विधियों का वर्णन.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

कई प्रयासों के लिए इन विट्रो सेल संस्कृति सिस्टम में स्थापित करने के लिए समर्पित किया गया है. इन पद्धतियों में विवो प्रक्रियाओं की एक बड़ी संख्या के लिए मॉडल तैयार कर रहे हैं. मानव एंडोमेट्रियल नमूने से उत्पन्न होने वाली सेल संस्कृति सिस्टम कोई अपवाद नहीं हैं. अनुप्रयोग सामान्य चक्रीय शारीरिक प्रक्रियाओं से ऐसे स्त्रीरोगों कैंसर, संक्रामक रोगों, और प्रजनन की कमी के रूप में एंडोमेट्रियल विकृतियों को लेकर. यहाँ, हम शल्य चिकित्सा resected एंडोमेट्रियल गर्भाशय नमूनों से प्राथमिक एंडोमेट्रियल stromal कोशिकाओं की स्थापना के लिए दो तरीके प्रदान. पहली विधि "scraping विधि" के रूप में जाना जाता है और दूसरा तरीका करार दिया है जबकि शल्य चिकित्सा या रेज़र ब्लेड का उपयोग मैकेनिकल scraping शामिल है "trypsin विधि." यह बाद विधि कोशिकाओं की जुदाई और प्राथमिक बढ़ावा देने के लिए trypsin के enzymatic गतिविधि का उपयोग करता है सेल परिणाम. हम डिजिटल छवियों और माइक्रोस्कोपी के माध्यम से कदम दर कदम कार्यप्रणाली को दर्शाता है. हम यह भी प्रदानमात्रात्मक वास्तविक समय पोलीमरेज़ चेन प्रतिक्रियाओं (qPCR) और immunofluorescence (यदि) के माध्यम से एंडोमेट्रियल stromal सेल लाइनों मान्य करने के लिए ई उदाहरण.

Introduction

मानव गर्भाशय कोष तीन परतों, perimetrium (या serosa), myometrium, और अंतर्गर्भाशयकला के शामिल है. इन परतों में से प्रत्येक भेद एंडोमेट्रियल सेल लाइनों की स्थापना के लिए एक महत्वपूर्ण कदम है. perimetrium गर्भाशय की सबसे बाहरी परत है और पतली, तरल कोशिकाओं से बना. myometrium मोटी, मध्य गर्भाशय की परत और चिकनी मांसपेशियों की कोशिकाओं से मिलकर बना है. अंतर्गर्भाशयकला गर्भाशय की भीतरी परत के रूप में पहचान की है और उपकला और stromal सेल आबादी शामिल है.

अंतर्गर्भाशयकला आगे जिसका स्टेम सेल की आबादी लगभग हर 28 दिन 1 functionalis परत फिर से आबाद करने के लिए धारणा है बैसालिस परत में विभाजित है. मानव अंतर्गर्भाशयकला की functionalis परत हार्मोन परिसंचारी के जवाब में महत्वपूर्ण जैव रासायनिक और morphological परिवर्तन आए. ये हार्मोन पिट्यूटरी ग्रंथि और अंडाशय से निकाली गई है.

एक प्रजनन चक्र में समन्वित उत्पादन और हार्मोन के परिणाम की रिहाई. प्रजनन चक्र संभावित भ्रूण आरोपण घटनाओं के लिए अंतर्गर्भाशयकला तैयार बनाया गया है. मनुष्यों में प्रजनन चक्र "मासिक धर्म चक्र" के रूप में जाना जाता है और तीन चरणों में बांटा गया - proliferative, स्रावी, और मासिक धर्म. स्रावी चरण functionalis परिपक्वता द्वारा चिह्नित किया गया है, जबकि proliferative चरण functionalis एंडोमेट्रियल परत के प्रसार शामिल है. विशेष रूप से, बाह्य परिवर्तन, स्राव, और सेलुलर भेदभाव एक संभावित आरोपण संकेत. आरोपण स्रावी चरण के अंत से पहले नहीं होती है, functionalis एंडोमेट्रियल परत मासिक धर्म चरण के दौरान बहाया है. मासिक धर्म और functionalis परत का बहा कि ट्रिगर घटनाओं के महत्व को अभी भी बहस किया जा रहा है. मनुष्यों में यह मासिक धर्म में जाना एक विशिष्ट मध्य स्रावी चरण भेदभाव घटना का परिणाम है कि समक्ष रखी किया गया है"सहज decidualization" के रूप में 2. इस पांडुलिपि में, हम दोनों एंडोमेट्रियल stromal सेल अलगाव तरीकों के लिए विस्तृत कार्यप्रणाली प्रदान करते हैं, और इन तरीकों की प्रभावकारिता प्रदर्शित immunofluorescence और डिजिटल छवियों का एक संयोजन का उपयोग करें. इसके अलावा, हम लागू सामान्यतः एंडोमेट्रियल stromal सेल अलगाव की पुष्टि के लिए सहज decidualization की इन विट्रो मॉडल में इस्तेमाल एक.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

इस पांडुलिपि में इस्तेमाल गर्भाशय नमूनों आईआरबी HSR # 14424 गिने एक विश्वविद्यालय आईआरबी को मंजूरी दी नैतिकता प्रोटोकॉल के साथ सामंजस्य में एकत्र किए गए थे.

क्लीनिकल स्रोत से 1. नमूना अधिग्रहण

  1. शुरुआत से पहले सरकार और संस्था आधारित नैतिक दिशा निर्देशों और अनुमोदन प्रलेखन प्राप्त करते हैं.
  2. बाँझ शर्तों के सभी चरणों का संचालन.
  3. नमूना तुरंत संस्कृति में संसाधित नहीं किया जा सकता है अगर 4 डिग्री सेल्सियस पर एक 50 मिलीलीटर ट्यूब में मीडिया (RPMI या DMEM / उच्च ग्लूकोज) में रोगी व्युत्पन्न ऊतक को बचाना. नमूने 24 घंटे की एक अधिकतम के लिए इस राज्य में संग्रहित किया जा सकता है.
  4. 1X बाँझ फॉस्फेट buffered खारा (पीबीएस) के साथ ऊतक नमूना तीन बार धोएं और washes के बीच समाधान त्यागें.

Scraping विधि का उपयोग प्राथमिक सेल लाइन्स के 2. तैयारी

  1. विकास मीडिया (RPMI या 10% भ्रूण गोजातीय सीरम और 1% पेनिसिलीन streptomy के साथ पूरक DMEM / उच्च ग्लूकोज की 4-10 मिलीलीटर जोड़ेंसीआईएन) ऊतक के लिए और 30 मिनट के लिए Fungizone (0.25 माइक्रोग्राम / एमएल अंतिम एकाग्रता) जोड़ें.
  2. विकास मीडिया त्यागें.
  3. 1X पीबीएस के साथ दो बार ऊतक धो लें.
  4. Myometrium और अंतर्गर्भाशयकला परतों (आंकड़ों के आगे विवरण के लिए 2A -2 सी देखें) के बीच भेद करने के लिए एक 6 सेमी सेल संस्कृति की थाली पर ऊतक रखें. अंतर्गर्भाशयकला अलग करें.
  5. 6 सेमी सेल संस्कृति पकवान पर scratching जबकि एक स्केलपेल या रेजर ब्लेड का प्रयोग, छोटे टुकड़ों में ऊतक आड़ा. इन खरोंच उभर प्राथमिक एंडोमेट्रियल कोशिकाओं की कुर्की की सुविधा. Trypsin विधि की तुलना में, अधिक ऊतक (एक सन्निकटन के लिए चित्रा 2 डी देखें) की जरूरत है.
  6. धीरे, खरोंच पकवान (ऊतक टुकड़े दिखाई और आदर्श scratching गति से स्थिर हो जाएगा) विकास मीडिया के 2 मिलीलीटर जोड़ें.
  7. एक नामित सेल कल्चर इनक्यूबेटर प्लेट (ओं) स्थानांतरण (37 डिग्री सेल्सियस और 5% सीओ 2). दूर अन्य संगठनों से, प्राथमिक सेल लाइनों के लिए एक जगह को नामितसेल संस्कृति व्यंजन एर. प्राथमिक संस्कृतियों के संक्रमण और प्रदूषण के प्रति संवेदनशील हैं.
  8. दैनिक एक प्रकाश खुर्दबीन के नीचे कोशिकाओं की जांच. कोशिकाओं की छोटी आबादी (3B चित्रा देखें) कटा हुआ ऊतकों भर से दिन में दो या तीन से उभरना चाहिए.
  9. , संस्कृतियों को बनाए रखने 1X पीबीएस के साथ धीरे धोने और हर तीन दिन ताजा वृद्धि मीडिया (2ml) जोड़ने के लिए. प्रसार दर बढ़ जाती है, अतिरिक्त विकास मीडिया (3-4 मिलीलीटर) 6 सेमी संस्कृति प्लेट (ओं) को जोड़ा जा सकता है.
    नोट: धोने और मीडिया परिवर्तन के दौरान, ऊतक के टुकड़े होने की संभावना aspirated किया जाएगा. इस पक्षपाती कोशिकाओं के विकास को प्रभावित नहीं करेगा. नई कालोनियों में एक सप्ताह के बाद उभरने की संभावना नहीं के रूप में ऊतक के टुकड़े बाद के कदम (2.10) से aspirated किया जाना चाहिए.
  10. 0.05% trypsin का उपयोग कर 80% मिला हुआ (3B चित्रा देखें), मार्ग - 6 सेमी थाली लगभग 75 है. प्राथमिक कोशिकाओं को अनिश्चित काल के passaged नहीं किया जा सकता - दो या तीन प्लेटों माँ हैं जैसे ही कोशिकाओं की एक प्लेट नीचे फ्रीजintained. अधिक मार्ग की आवश्यकता है, (रेफरी 3 में समीक्षा) एक अमरता प्रोटोकॉल का पालन करें.

Trypsin विधि का उपयोग प्राथमिक सेल लाइन्स के 3. तैयारी

  1. Kanamycin (0.03 मिलीग्राम / एमएल अंतिम एकाग्रता) के साथ पूरक 0.25% trypsin के 2 मिलीलीटर में एंडोमेट्रियल ऊतक का एक छोटा सा टुकड़ा (एक सन्निकटन के लिए चित्रा 2 डी देखें) रखें.
  2. 30 मिनट के लिए मंच घूर्णन पर 37 डिग्री सेल्सियस पर ऊतक सेते हैं.
  3. संक्षेप में ऊतक भंवर.
  4. 2 मिनट के लिए 200-400 XG पर नमूना अपकेंद्रित्र और सतह पर तैरनेवाला त्यागने.
  5. ताजा trypsin और kanamycin जोड़ें.
  6. एक घंटे के लिए घूर्णन जबकि 37 डिग्री सेल्सियस पर ऊतक सेते हैं.
  7. 5-10 सेकंड के लिए ऊतक भंवर.
  8. Trypsin निष्क्रिय करने के लिए (10% भ्रूण गोजातीय सीरम और 1% पेनिसिलिन स्ट्रेप्टोमाइसिन के साथ पूरक) विकास मीडिया के 2ml जोड़ें.
  9. 2-3 मिनट के लिए 200-400 XG पर अपकेंद्रित्र कोशिकाओं.
  10. सतह पर तैरनेवाला त्यागें और बढ़ने के 2 एमएल जोड़नेpelleted कोशिकाओं को वें मीडिया.
  11. एक 6 सेमी सेल संस्कृति पकवान पर थाली. Scraping विधि का उपयोग प्राथमिक सेल लाइन्स की तैयारी की 2.5 कदम के रूप में थाली scraping आवश्यक नहीं है, लेकिन प्राथमिक संस्कृतियों का लगाव और परिणाम को बढ़ाता है.
  12. दैनिक एक प्रकाश खुर्दबीन के नीचे कोशिकाओं मॉनिटर. कोशिकाओं (चित्रा -3 सी देखें) 24-48 घंटे के बाद एक प्रकाश माइक्रोस्कोप के तहत आम तौर पर दिखाई दे रहे हैं.
  13. संस्कृतियों को बनाए रखने के लिए, कोशिकाओं की निगरानी और कदम 2.9 में के रूप में हर 2-3 दिनों मीडिया बदल जाते हैं.
  14. कोशिकाओं 75-80% confluency (चित्रा -3 सी देखें) तक पहुंच जाने के पारित होने के लिए कोशिकाओं, 0.05% या 0.25% trypsin का उपयोग करें.

4. अतिरिक्त विश्लेषण के लिए ऊतक (स्नैप ठंड और Formalin फिक्सेशन) सेविंग

  1. 1X पीबीएस के साथ दो बार नमूना धो लें.
  2. संभव के रूप में महाप्राण के रूप में ज्यादा तरल.
  3. स्नैप ठंड के लिए, (आंकड़े 2 एफ और 2 जी देखें) एक 1.7 अपकेंद्रित्र ट्यूब में एंडोमेट्रियल ऊतक नमूना जगह है. 1.7 रखेंअपकेंद्रित्र ट्यूब में 10 सेकंड के लिए तरल नाइट्रोजन में या जब तक यह ऊतक नीचे जमे हुए है कि देखा जा सकता है.
    नोट: नमूने तैयार करते समय सीधे तरल नाइट्रोजन को छूने के लिए नहीं ख्याल रखना. नमूने आगे की प्रक्रिया या विश्लेषण तक -80 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है.
  4. Formalin निर्धारण के लिए, एंडोमेट्रियल ऊतक (चित्रा 2H देखें) का एक छोटा सा टुकड़ा काट, और 10% बफर जस्ता formalin में डूब. 24 घंटे के बाद, formalin त्यागने और आगे की प्रक्रिया जब तक ऊतकों के नमूनों को 70% इथेनॉल जोड़ें.

5. Immunofluorescence (यदि)

  1. सेल निर्धारण
    1. एक संस्कृति स्लाइड या थाली पर कोशिकाओं को तैयार है.
    2. धीरे, 1X पीबीएस के साथ कोशिकाओं को धो लें.
    3. 5 मिनट के लिए (एक 1:1 के अनुपात में मिश्रित) पूर्व ठंडा (4 डिग्री सेल्सियस) मेथनॉल और एसीटोन जोड़ें.
    4. एयर आगे बढ़ने से पहले स्लाइड सूखी. अगर जरूरत स्लाइड 1-2 सप्ताह के लिए 4 डिग्री सेल्सियस पर भंडारित किया जा सकता है.
  2. प्रसंस्करण अगर
    1. 10 मिनट के लिए 1X पीबीएस के साथ कोशिकाओं rehydrate. के लिए के लिएllowing घूर्णन एक मंच पर सभी washes और incubations आचरण, 1-6 कदम.
    2. 1X पीबीएस का उपयोग कर ब्लॉक 1% गोजातीय सीरम albumin (BSA) के साथ पूरक और कमरे के तापमान (आर टी) पर 30 मिनट के लिए 1% प्रजातियों विशिष्ट सीरम (2 एन डी एंटीबॉडी का स्रोत).
    3. (एंटीबॉडी dilutions के लिए निर्माताओं की सिफारिशों को देखें) प्राथमिक एंटीबॉडी में सेते हैं. विशिष्ट एंटीबॉडी के लिए सामग्री का संदर्भ लें. चरण 5.2.2 में के रूप में नए सिरे से अवरुद्ध बफर में प्राथमिक एंटीबॉडी पतला. इस ऊष्मायन आरटी पर या रातोंरात 4 डिग्री सेल्सियस पर कम से कम 2 घंटे के लिए आयोजित किया जा सकता है
    4. 5 मिनट प्रत्येक के लिए 1X पीबीएस के साथ 3 बार धोएं.
    5. (एंटीबॉडी dilutions के लिए निर्माताओं की सिफारिशों को देखें) माध्यमिक एंटीबॉडी में सेते हैं. चरण 5.2.2 में के रूप में नए सिरे से अवरुद्ध बफर में माध्यमिक एंटीबॉडी पतला. तस्वीर विरंजन रोकने के लिए, यह प्रकाश के अभाव में यह और बाद के चरणों का संचालन करने के लिए महत्वपूर्ण है.
    6. 5 मिनट प्रत्येक के लिए 1X पीबीएस के साथ 3 बार धोएं.
    7. ThoroughlY स्लाइड सूखी.
    8. बढ़ते मीडिया और DAPI counterstaining समाधान जोड़ें.
    9. Coverslip लागू करें और सीलेंट () का उपयोग करके किनारों को सील. स्लाइड करने के लिए 2 सप्ताह के लिए अंधेरे में 4 डिग्री सेल्सियस पर भंडारित किया जा सकता है.

6. शाही सेना निष्कर्षण

  1. Centrifugation द्वारा 1 10 x 7 गोली कोशिकाओं. इस प्रोटोकॉल में सभी सामग्री और अभिकर्मकों मुक्त RNase किया जाना चाहिए.
  2. 1 मिलीलीटर Trizol अभिकर्मक, और nucleoprotein परिसरों की हदबंदी को पूरा करने के लिए कमरे के तापमान पर 10 मिनट के लिए homogenized नमूने सेते में lyse कोशिकाओं.
  3. TRIzol के 1 मिलीलीटर प्रति क्लोरोफॉर्म की 200 μl जोड़ें. 15 सेकंड के लिए हाथ से सख्ती से हिला और आरटी पर 2-3 मिनट के लिए सेते हैं.
  4. 4 डिग्री सेल्सियस पर 15 मिनट के लिए अधिकतम गति (15,000 XG) पर अपकेंद्रित्र तीन परतों परिणाम होगा.
  5. एक ताजा microcentrifuge ट्यूब में शीर्ष जलीय चरण हस्तांतरण. शाही सेना उपज बढ़ाने के लिए 1 μl ग्लाइकोजन जोड़ें; हालांकि, इस कदम केवल आवश्यक है जब एक छोटे सेशाही सेना की राशि अनुमान है.
  6. जलीय परत को isopropyl शराब के 0.5 मिलीलीटर जोड़ें, और नमूने 3-5 बार पलटना. 10 मिनट के लिए आरटी पर नमूने सेते हैं. उपज बढ़ाने के लिए, नमूने 30 मिनट के लिए -20 डिग्री सेल्सियस या -80 डिग्री सेल्सियस में रखा जा सकता है.
  7. 4 डिग्री सेल्सियस पर 10 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र
  8. इस बिंदु पर, शाही सेना की एक छोटी सी गोली दिखाई जानी चाहिए. सतह पर तैरनेवाला त्यागें.
  9. 75% इथेनॉल के 1 एमएल के साथ शाही सेना को धो लें.
  10. 5 मिनट के लिए अधिकतम गति पर अपकेंद्रित्र और सतह पर तैरनेवाला त्यागने. नमूने एक बार अकार्बनिक contaminants से मुक्त करने के लिए और अधिक धोया जा सकता है, लेकिन यह चरण आवश्यक नहीं है.
  11. शाही सेना गोली सूखी है जब तक संक्षेप में, (आमतौर पर 7-10 मिनट लगते हैं) आरएनए गोली सूखी.
    नोट: एक अतिरिक्त कदम अकार्बनिक पदार्थ कम होती है और सुखाने के समय को कम करने के लिए इस्तेमाल किया जा सकता है. एक अतिरिक्त मिनट और महाप्राण अवशिष्ट तरल के लिए अधिकतम गति से इथेनॉल धोने, स्पिन के नमूनों से सतह पर तैरनेवाला discarding के बाद. गोली महाप्राण नहीं ख्याल रखना.
  12. शाही सेना गोली के आकार पर निर्भर करता है, RNase मुक्त पानी में शाही सेना भंग. वॉल्यूम आमतौर पर 10-50 μl से लेकर.
  13. 10 मिनट के लिए 55 डिग्री सेल्सियस पर नमूने सेते हैं, और शाही सेना की एकाग्रता को मापने.
  14. आगे की प्रक्रिया जब तक -20 डिग्री सेल्सियस पर स्टोर नमूनों.

7. रिवर्स प्रतिलेखन

  1. एच 2 ओ के साथ 9 μl की एक मात्रा के लिए नमूना शाही सेना (1-3 ग्राम) लाओ
  2. 10 मिनट के लिए 70 डिग्री सेल्सियस तक गर्मी आरएनए.
  3. DNTP के 5 μl (50 माइक्रोन से काम कर रहे एकाग्रता), N6 डीएनए oligos के 5 μl (80 माइक्रोन से काम कर रहे एकाग्रता), 5X AMV बफर के 5 μl, और AMV की 1 μl: एक AMV मास्टर मिश्रण उत्पन्न करने के लिए निम्न अभिकर्मकों गठबंधन . इस मास्टर मिश्रण समाधान एक नमूना प्रति बनाया गया है.
  4. गरम शाही सेना के लिए मास्टर मिश्रण के 16 μl जोड़ें. अंतिम प्रतिक्रिया मात्रा 25 μl प्रतिक्रिया होगी.
  5. (स्टेज 1) 90 मिनट के लिए 42 डिग्री सेल्सियस, (एसटीए: रिवर्स प्रतिलेखन के लिए निम्नलिखित पीसीआर शर्तों का उपयोग करें5 मिनट, और आगे की प्रक्रिया जब तक (स्टेज 3) 4 डिग्री सेल्सियस के लिए जीई 2) 95 डिग्री सेल्सियस.

8. रीयल टाइम पीसीआर

  1. तालिका 1 में पाया प्राइमरों, annealing तापमान, चक्र संख्या, और अभिकर्मकों का उपयोग पीसीआर प्रतिक्रियाओं का संचालन.
    नोट: यह (माल में कंपनी और सूची की संख्या को देखें) पीसीआर अभिकर्मकों का उपयोग करते समय निर्माता निर्देशों का पालन करने के लिए आदर्श है.

9. (रेफरी 4 और 5 से प्राप्त) इन विट्रो Decidualization प्रोटोकॉल

  1. एंडोमेट्रियल कोशिकाओं थाली.
  2. 75-85% की एक confluency करने के लिए आगे बढ़ें.
  3. कोशिकाओं मिला हुआ बनने के बाद, 1X पीबीएस के साथ एक बार धोने.
  4. जल्दी, (Phenol मुक्त RPMI 5% का कोयला पट्टी FBS और 1% पेनिसिलिन स्ट्रेप्टोमाइसिन के साथ पूरक) हार्मोन मुक्त मीडिया जोड़ें.
  5. 24 घंटे के बाद, 1 माइक्रोन और 8 bromoadenosine 3 के एक अंतिम एकाग्रता में medroxyprogesterone एसीटेट (एमपीए) के साथ पूरक हार्मोन स्वतंत्र मीडिया ', 5' जोड़0.5 मिमी की एक अंतिम एकाग्रता में चक्रीय monophosphate (शिविर).
  6. कम से कम 48 घंटे के बाद, प्रतिक्रिया बंद करो और आगे की प्रक्रिया के लिए प्लेट (ओं) को बचाने के.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

नयाचार अनुभाग में बल के रूप में, मानव ऊतक से निपटने और तैयार करते समय सभी संस्थागत सरकार के अधीन तरीकों, और नैतिक दिशा निर्देशों का संचालन सुनिश्चित करें.

"Scraping विधि" का सामान्य कार्यप्रवाह का एक उदाहरण (चित्रा 1 ए) और प्राथमिक एंडोमेट्रियल संस्कृतियों की स्थापना के लिए प्रयोग किया जाता "trypsin विधि" (चित्रा 1 बी) इस पांडुलिपि में शामिल है. इन विधियों प्रोटोकॉल अनुभाग में विस्तार से वर्णन किया गया हैं (भाग 1 देख -. 3.). दोनों तरीकों प्राथमिक एंडोमेट्रियल संस्कृतियों के विकास में सफल साबित होते हैं. लाभ "scraping विधि" छोटा तैयारी समय है करने के लिए; की तुलना में 4 गुना ज्यादा समय - हालांकि, यह व्यवहार्य कोशिकाओं का पालन करने के लिए लगने वाले समय 2 आमतौर पर है "trypsin विधि."

ऊतक खरीद से प्राप्त प्रारंभिक मानव ऊतक के डिजिटल छवियों हैं प्रदान की है. गर्भाशय परतों से प्रतिष्ठित किया जा सकतापरत की बेअदबी, myometrium यानी मोटी और मांसल है और अंतर्गर्भाशयकला पतली और अधिक उपज देने वाली है. हम सफेद में मोटी, चिकनी मांसपेशियों की परत (myometrium) पर प्रकाश डाला और दो ​​अलग गर्भाशय के नमूने (आंकड़े 2A और 2 बी) से ब्लैक में ब्याज की एंडोमेट्रियल परत रेखांकित किया है. चित्रा -2 में, ऊतकों अंतर्गर्भाशयकला नीचे तैनात है जबकि myometrium सामना करना पड़ रहा से उन्मुख होते हैं. पतली, perimetrial परत शल्य चिकित्सा resected और इन छवियों में नहीं डाला गया था. यह इन डिजिटल 2 आयामी चित्र में एंडोमेट्रियल परत के आकार वास्तविक 3 आयामी परत myometrium की तुलना में बहुत पतली है के रूप में प्रचारित किया जाता है कि नोट के लिए भी महत्वपूर्ण है.

उचित ऊतक आकार काटने "scraping विधि" और दोनों के लिए महत्वपूर्ण है "trypsin विधि." चित्रा 2 डी में, उचित आकार संबंधित नमूना ऊपर प्रत्येक विधि के लिए नामित कर रहे हैं. एक 0.5x0 का प्रयोग"Trypsin विधि" [बाएं] के लिए .5 x0.5 सेमी टुकड़ा एक संस्कृति की स्थापना के लिए पर्याप्त है. "scraping विधि" [अधिकार] के लिए प्रतिनिधि प्रारंभिक ऊतक सभी गर्भाशय परतें शामिल हैं. "scraping विधि" के लिए अंतिम उत्पाद चित्रा 2 ई में प्रतिनिधित्व किया है, और यह एंडोमेट्रियल ऊतक के कम से कम 1x1x1 सेमी व्यवहार्य संस्कृतियों की स्थापना के लिए इस्तेमाल किया जा सिफारिश की है. इतना ऊतक के नमूने लिए आवश्यकता का एक नुकसान यह है "scraping विधि."

शेष ऊतक अक्सर प्रोटीन सहित और शाही सेना का विश्लेषण करती है कई मायनों में इस्तेमाल किया जाता है. ऊतक गुणवत्ता का संरक्षण सुनिश्चित करने के लिए, यह (4 देखें.) प्रोटोकॉल अनुभाग में के रूप में एक "ठंड तस्वीर" विधि का उपयोग करने के लिए महत्वपूर्ण है. यह विधि भी चित्रा 2 एफ और चित्रा 2 जी में सचित्र है. Formalin निर्धारण से अतिरिक्त ऊतक सहेजा जा रहा है भी पैथोलॉजिस्ट और शोधकर्ताओं की एक आम बात है. Formalin निर्धारण के लिए तैयारी ऊतक प्रोटोकॉल में वर्णित है चित्रा 2H में सचित्र.

लाइट माइक्रोस्कोपी प्राथमिक एंडोमेट्रियल संस्कृतियों की निगरानी के लिए आवश्यक है. व्यक्तिगत एंडोमेट्रियल stromal कोशिकाओं fibroblast आकारिकी (चित्रा 3) का प्रदर्शन करना चाहिए. "Scraping विधि" आमतौर पर मुख्य रूप से छुरी प्रेरित खरोंच (चित्रा 3 बी, 2 दिन) के साथ, जल्दी उभर कोशिकाओं के समूहों उत्पन्न करता है. "Trypsin विधि" क्लस्टर और छितरी सेल के विकास पैटर्न (चित्रा -3 सी, 4 दिन) दोनों को उत्पन्न करता है. हम प्रत्येक विधि (चित्रा 3 बी और 3 सी) के पहले पारित होने के लिए प्रारंभिक चढ़ाना (0 दिन) से कई प्रतिनिधि छवियों को शामिल किया है.

जीन और प्रोटीन अभिव्यक्ति प्रयोगों अंतर्गर्भाशयकला 6-11, एक एन के लिए आयोजित किया गया है जबकि कई ऊतकों आदि प्रतिरक्षा स्टेम कोशिकाओं के लिए चिकनी पेशी, CD34 के लिए चिकनी पेशी actin (SMA), के रूप में ऊतक विशेष मार्कर की उनकी अभिव्यक्ति के द्वारा परिभाषित कर रहे हैंdometrial stromal सेल विशिष्ट मार्कर की खोज अभी तक किया जाना है. इसके बजाय, शोधकर्ताओं आमतौर पर संभावित सेल contaminants से मार्कर को मापने के द्वारा एंडोमेट्रियल stroma पवित्रता का आकलन करें. उदाहरण के लिए, cytokeratin मार्करों उपकला आबादी को दिखाने के लिए उपयोग किया जाता है. स्थापना और एंडोमेट्रियल epithelia मुश्किल है और आमतौर पर (रेफरी 12 और चित्रा -4 ए) के खिलाफ चयनित हैं बनाए रखने हालांकि, क्योंकि यह एक चिंता का कम है. नमूने गर्भावस्था, एचएलए एक की सकारात्मक अभिव्यक्ति के दौरान प्राप्त किया जा रहे थे, बी, सी रोगाणु, ट्रोफोब्लास्ट कोशिकाओं 13 दर्शाता है. दूसरी ओर, अन्य mesenchymal fibroblasts की तरह, एंडोमेट्रियल stromal कोशिकाओं vimentin (CDH1) व्यक्त करते हैं. हम immunofluorescence, vimentin की अभिव्यक्ति और हमारे स्थापित एंडोमेट्रियल stromal कोशिकाओं (चित्रा 4 बी) में cytokeratin और ई cadherin (CDH1) के अभाव के साथ प्रदर्शित करता है.

अंत में, हम एक मैं के माध्यम से प्राथमिक एंडोमेट्रियल संस्कृति के कार्यात्मक सबूत प्रदानn सहज decidualization परख इन विट्रो. इस विधि रेफरी 4 और 5 से अनुकूलित, और medroxyprogesterone एसीटेट (एमपीए) और 8 के संयोजन के साथ संस्कृतियों का उपचार शामिल किया गया था - bromoadenosine 3 ', 5'-चक्रीय मोनोफास्फेट 9 में वर्णित (शिविर) (इन विट्रो Decidualization प्रोटोकॉल और मॉडलिंग की. चित्रा 5A में). एमपीए और शिविर की उपस्थिति में, एंडोमेट्रियल stromal कोशिकाओं (रेफरी 14 में समीक्षा) काफी बदल जीन की अभिव्यक्ति प्रोफाइल दिखा रहे हैं. अक्सर प्रकाशित सहज decidualization मार्करों प्रोलैक्टिन (पीआरएल) कर रहे हैं और प्रोटीन 1 (IGFBP1) बाइंडिंग इंसुलिन की तरह विकास फैक्टर (रेफरी 14 में समीक्षा). एमपीए और शिविर के लिए इन दो जीनों की प्रतिक्रिया सहज decidualization और एक एंडोमेट्रियल स्ट्रोमल संस्कृति की सफल स्थापना दोनों के मजबूत संकेतक होते हैं. हम चित्रा 5B में यह प्रदर्शित करता है.


चित्रा 1. दो प्राथमिक एंडोमेट्रियल अलगाव तरीकों के योजनाबद्ध. (ए) (बी). एक संगठन चार्ट में प्रदर्शित scraping विधि का 2.1-2.10 कदम एक संगठन चार्ट में प्रदर्शित trypsin विधि का 3.1-3.14 कदम. बड़ी छवि को देखने के लिए यहां क्लिक करें.

चित्रा 2
चित्रा 2. गर्भाशय ऊतक प्रसंस्करण. दो महिला मरीजों से (एसी) क्लीनिकल गर्भाशय के नमूने. एक और सी रोगी 1 से निकाली गई है और हजारों रोगी 2 से ली गई है. शल्य चिकित्सा resected गर्भाशय ऊतक (बाएं) और highlighteडी गर्भाशय परतों (दाएं). (ए और बी) myometrium काले रंग में सफेद और अंतर्गर्भाशयकला में परिक्रमा कर रहा है. (सी) myometrium कैमरे का सामना करना पड़ रहा है. (डी) दोनों अलगाव के तरीकों के लिए प्रारंभिक प्रतिनिधि एंडोमेट्रियल नमूना आकार संकेत कर रहे हैं. स्क्रैप विधि पूरे गर्भाशय नमूनों का उपयोग करता है सकते हैं, जबकि trypsin विधि trypsin के अलावा पहले शुद्ध अंतर्गर्भाशयकला की आवश्यकता है. scraping विधि का संसाधित एंडोमेट्रियल नमूना (ई) उदाहरण. (एफ एंड जी) स्नैप के लिए तैयार किया जा रहा शेष गर्भाशय ऊतक की छवि बर्फ़ीली. दिखाया गया कि इस विधि के लिए उपयोग एक प्रयोगशाला बनाया धातु कंटेनर है. (एच) एंडोमेट्रियल नमूना की Formalin निर्धारण. बड़ी छवि को देखने के लिए यहां क्लिक करें.

चित्रा 3 चित्रा 3. प्राथमिक एंडोमेट्रियल संस्कृतियों की लाइट माइक्रोस्कोपी छवियों. . (ए) विभिन्न शक्तियों और confluency में लिया एंडोमेट्रियल stromal सेल संस्कृतियों के प्रतिनिधि छवियों (बी) scraping विधि (दिनों 0-16) के प्रतिनिधि छवियाँ 10x पर संचालित एक ही संस्कृति पकवान, का लिया नोट:. विजुअल लाइनों से खरोंच से संकेत मिलता है सर्जिकल ब्लेड trypsin विधि (सी) प्रतिनिधि छवियाँ.. (दिनों 0-16) 10x पर संचालित एक ही संस्कृति पकवान, का लिया बड़ी छवि को देखने के लिए यहां क्लिक करें.

चित्रा 4
चित्रा 4. एंडोमेट्रियल stromal कोशिकाओं की Immunofluorescence छवियों. (ए) Immunofluorescenceप्राथमिक एंडोमेट्रियल संस्कृतियों से scraping विधि के माध्यम से अलग किया. छवियाँ बीतने 2 (P2) और पारित होने के 5 (पी -5) के बीच cytokeratin की हानि प्रदर्शित करता है. प्रोमाईलोसाईटिक ल्यूकेमिया प्रोटीन (पीएमएल) परमाणु प्रोटीन और DAPI धुंधला नियंत्रण के रूप में इस्तेमाल किया गया. (बी) छवियाँ mesenchymal मार्कर vimentin के लिए सकारात्मक धुंधला प्रदर्शित करता है. छवियाँ भी ई cadherin (CDH1) और cytokeratin के लिए नकारात्मक धुंधला दिखा. DAPI और प्रोमाईलोसाईटिक ल्यूकेमिया प्रोटीन (पीएमएल) के लिए धुंधला नियंत्रण के रूप में प्रदान किया गया. बड़ी छवि को देखने के लिए यहां क्लिक करें.

चित्रा 5
चित्रा 5. दो प्राथमिक एंडोमेट्रियल stromal कोशिकाओं का सहज decidualization. प्रयोगात्मक प्रक्रिया की (ए) को रेखांकित करें. (बी) प्रोलैक्टिन की upregulation (पीआरएल) औरएमपीए और शिविर के लिए प्रतिक्रिया में प्रोटीन 1 (IGFBP1) जीन अभिव्यक्ति बंधन इंसुलिन की तरह विकास फैक्टर. परिणाम RT-qPCR के माध्यम से मापा गया, और अभिव्यक्ति GAPDH को सामान्यीकृत था. महत्व छात्रों टी परीक्षण (पी <0.001 *** और पी <0.0001 ****) का उपयोग कर की गणना की गई. दोनों सेल लाइनों scraping पद्धति का उपयोग करके अलग थे. बड़ी छवि को देखने के लिए यहां क्लिक करें.

भजन की पुस्तक अनुक्रम Annealing तापमान (डिग्री सेल्सियस) साइकिल परख
प्रोलैक्टिन (पीआरएल) आगे CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
प्रोलैक्टिन (पीआरएल) रिवर्स TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
इंसुलिन की तरह वृद्धि कारक बाध्यकारी प्रोटीन 1 (IGFBP1)आगे TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
इंसुलिन की तरह वृद्धि कारक बाध्यकारी प्रोटीन 1 (IGFBP1) रिवर्स GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH अनिर्दिष्ट (अभिकर्मक सूची देखें) 60 40 TaqMan

Decidualization मार्करों के लिए तालिका 1. पीसीआर की स्थिति.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

अन्य समूहों collagenase 4,12,13,15-18 उपयोग जिनमें से अधिकांश एंडोमेट्रियल स्ट्रोमल संस्कृतियों की तैयारी के लिए कार्यप्रणाली का वर्णन किया और ढाल लिया है. इस पांडुलिपि में, हम किफायती कारणों और trypsin और / या एक रेजर ब्लेड की सुविधाजनक उपलब्धता के लिए हमारी प्रयोगशाला द्वारा उपयोग किया जाता है, जो दोनों के दो सरलीकृत प्राथमिक एंडोमेट्रियल स्ट्रोमल संस्कृति विधियों, के लिए कार्यप्रणाली और सबूत मुहैया कराए गए हैं.

हमारे दो तरीकों की तुलना, दोनों सफलतापूर्वक व्यवहार्य प्राथमिक संस्कृतियों उत्पन्न करते हैं. एक छोटे आकार के नमूने की आवश्यकता के साथ एक उच्च उपज आम तौर पर वहाँ के रूप में हमारे पसंदीदा विधि trypsin विधि है. तैयारी के समय सीमित है, तो trypsin विधि का उपयोग कोशिकाओं चढ़ाना एक घंटे और एक आधे से अधिक लेता है, जबकि हालांकि, scraping विधि 30 मिनट की आवश्यकता है.

यह भी उल्लेखनीय है एंडोमेट्रियल बायोप्सी के लिए विरोध के रूप में हम गर्भाशय के नमूनों के साथ इन तरीकों का प्रदर्शन करता है. एंडोमेट्रियल बायोpsies महत्वपूर्ण घुसपैठ के बिना लिया और छोटे नमूनों का उत्पादन करते हैं. फिर भी, इस पांडुलिपि (विशेष रूप से trypsin विधि) में वर्णित तरीकों एंडोमेट्रियल बायोप्सी से संस्कृतियों उपज चाहिए.

प्राथमिक एंडोमेट्रियल stromal कोशिकाओं के लिए कई आवेदन कर रहे हैं. अन्य स्तनधारियों की तुलना में मानव से एंडोमेट्रियल स्ट्रोमल संस्कृतियों की तुलना करना मनुष्य रजस्वला के बारे में क्यों सदियों के लिए बहस की गई है कि सवाल सुराग दे सकता है. इन विट्रो संस्कृति में आवश्यकता है कि अन्य बेरोज़गार फिजियोलॉजी अध्ययन कर रहे हैं. खास रुचि इस तरह के प्रजनन चक्र 19,20, 21 के कार्यात्मक घटनाओं को epigenetic आणविक घटनाओं जुड़ा है, और रेफरी 11 में समीक्षा की है कि निष्कर्ष के रूप में प्रजनन चक्र की घटनाओं में अंतर्दृष्टि प्रदान कि खोजों हैं.

चिकित्सकों एंडोमेट्रियल स्ट्रोमल संस्कृति का अध्ययन करने और biomarker की पहचान करने से बहुत लाभ होगाप्रजनन विकारों और कैंसर दुर्दमताओं के मामलों में है. 2006 और 2010 के बीच, यह 7.4 करोड़ महिलाओं और उनके पार्टनर्स संयुक्त राज्य अमेरिका के 22 में बांझपन सेवाओं का इस्तेमाल किया है कि सूचना मिली थी. बांझपन का एक महत्वपूर्ण प्रतिशत decidualization 23 की विफलता की वजह से है. इसके अलावा, इस तरह के बांझपन के लिए hyperplasia और endometriosis के रूप में एंडोमेट्रियल बीमारियों के बीच संबंध केवल हाल ही में मूल्यांकन किया जा रहा है. उन्नत एंडोमेट्रियल सार्कोमा दुर्लभ है, भले ही यह घातक हो सकता है क्योंकि इन विट्रो मॉडलिंग के माध्यम से गर्भाशय स्त्रीरोगों कैंसर का अध्ययन करने की क्षमता भी अमूल्य है. इन विट्रो प्राथमिक संस्कृतियों में स्थापना करके, हम बीमारियों के साथ जुड़े आणविक घटनाओं के प्रभाव का अध्ययन करने और ख्यात नैदानिक ​​अनुप्रयोगों उत्पन्न कर सकते हैं.

अंत में, इन आवेदनों में से कई के लिए प्रतिनिधि और vivo मॉडल में प्रभावोत्पादक पैदा करने के लिए मुश्किल है. इस में से विकास करता हैकई में विवो कार्यों गंभीर अध्ययन करने के लिए प्राथमिक एंडोमेट्रियल संस्कृतियों विट्रो. इन दो एंडोमेट्रियल अलगाव तरीकों, "scraping विधि" और "trypsin विधि," एंडोमेट्रियल शरीर विज्ञान और विकृति विज्ञान के बारे में हमारी समझ के लिए पैर जमाने प्रदान करने में मदद करेगा.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgements

हम उनके इमेजिंग और माइक्रोस्कोप उपकरणों के उपयोग के लिए डॉ. Thao डांग और उसे प्रयोगशाला के सदस्यों के सामूहिक प्रयास धन्यवाद. हम यह भी गर्भाशय ऊतक के साथ हमें प्रदान करने के लिए biorepository और ऊतक अनुसंधान सुविधा (BTRF) कोर, जेफ हार्पर, और वर्जीनिया विश्वविद्यालय में निवासियों को धन्यवाद. हम योजनाबद्ध सिंहावलोकन के साथ मदद के लिए करोल Szlachta धन्यवाद.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics