Deux méthodes de fixation des cellules humaines de l'endomètre stromales primaires de spécimens hystérectomie

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Établir des systèmes primaires de l'endomètre stromales de cellules de culture à partir d'échantillons hystérectomie est une technique biologique précieux et une étape cruciale avant de poursuivre une vaste gamme de recherche vise. Ici, nous décrivons deux méthodes utilisées pour établir les cultures stromales de tissus de l'endomètre résection chirurgicale des patients humains.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Beaucoup d'efforts ont été consacrés à établir des systèmes de culture cellulaire in vitro. Ces systèmes sont conçus pour modéliser un grand nombre de procédés in vivo. systèmes de culture cellulaire résultant de l'endomètre échantillons humains ne font pas exception. Les applications vont de processus physiologiques cycliques normales à des pathologies de l'endomètre telles que les cancers gynécologiques, les maladies infectieuses et les carences en matière de reproduction. Ici, nous proposons deux méthodes pour établir des cellules stromales de l'endomètre primaires à partir d'échantillons d'hystérectomie endomètre résection chirurgicale. Le premier procédé est appelé «le procédé de raclage" et intègre raclage mécanique à l'aide des lames chirurgicales ou rasoir tandis que le second procédé est appelé «le procédé de la trypsine." Cette dernière méthode utilise l'activité enzymatique de la trypsine, de promouvoir la séparation des cellules et primaire excroissance cellulaire. Nous illustrons la méthodologie étape par étape à travers des images numériques et la microscopie. Nous également providexemples de e pour la validation des lignées de cellules stromales de l'endomètre par des réactions quantitatives en temps réel de la chaîne de la polymérase (qPCR) et immunofluorescence (IF).

Introduction

Le corpus de l'utérus humain est composé de trois couches, la perimetrium (ou séreuse), le myomètre et l'endomètre. Distinguer chacune de ces couches est une étape importante pour établir des lignées cellulaires de l'endomètre. Le perimetrium est la couche la plus externe de l'utérus et composée de fines cellules séreuses. Le myomètre est la couche intermédiaire épaisse de l'utérus et le composé de cellules musculaires lisses. L'endomètre est identifié en tant que couche intérieure de l'utérus et comprend des populations de cellules épithéliales et stromales.

L'endomètre est encore subdivisé en couche basalis dont la tige population cellulaire est l'hypothèse de repeupler la couche de functionalis environ tous les 28 jours 1. La couche de functionalis de l'endomètre humain subit des modifications biochimiques et morphologiques importantes en réponse aux hormones circulant. Ces hormones sont dérivées de la glande pituitaire et les ovaires.

Laproduction coordonnée et la libération d'hormones entraîne un cycle de reproduction. Le cycle de reproduction est conçu pour préparer l'endomètre pour les événements potentiels d'implantation embryonnaire. Chez les humains, le cycle de reproduction est connu comme "le cycle menstruel" et divisé en trois phases - proliférative, sécrétoires, et menstruels. La phase proliférative implique la prolifération de l'endomètre functionalis couche tandis que la phase sécrétoire est marquée par functionalis maturation. Plus précisément, les modifications extracellulaires, les sécrétions, et la différenciation cellulaire signalent une implantation potentielle. Si l'implantation ne se produit pas avant la fin de la phase de sécrétion, la couche functionalis de l'endomètre est éliminée au cours de la phase menstruel. L'importance de la menstruation et les événements qui déclenchent l'effusion de la couche de functionalis sont encore en discussion. Chez l'homme, il a été posé que la menstruation est le résultat d'un événement à mi-sécrétoire différenciation de phase spécifique connuecomme "décidualisation spontanée» 2. Dans ce manuscrit, nous proposons une méthodologie détaillée pour les deux méthodes d'isolement de cellules stromales de l'endomètre, et utilisons une combinaison de l'immunofluorescence et des images numériques pour démontrer l'efficacité de ces approches. En outre, nous appliquons un modèle couramment utilisé dans vitro de décidualisation spontanée pour confirmer l'isolement de cellules stromales de l'endomètre.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Spécimens hystérectomie utilisés dans ce manuscrit ont été recueillies en concordance avec un protocole d'éthique de l'Université de la CISR approuvé numérotée IRB-RSS # 14424.

1. Acquisition des échantillons de clinique Source

  1. Obtenir gouvernement et des principes éthiques en établissement et de la documentation d'approbation avant de commencer.
  2. Réaliser toutes les étapes des conditions stériles.
  3. Préserver le tissu dérivé du patient dans les médias (RPMI ou DMEM / High glucose) dans un tube de 50 ml à 4 ° C si l'échantillon ne peut pas être traitée dans la culture immédiatement. Les échantillons peuvent être stockés dans cet état pendant un maximum de 24 heures.
  4. Laver échantillon de tissu trois fois avec 1X stérile tamponnée au phosphate (PBS) et jeter la solution entre les lavages.

2. Préparation de lignées cellulaires primaires à l'aide de la méthode Grattage

  1. Ajouter 4-10 ml de milieu de croissance (RPMI ou DMEM / High Glucose supplémenté avec 10% de sérum bovin fœtal et 1% de pénicilline-streptomycin) de tissu et ajouter Fungizone (0,25 ug / ml de concentration finale) pendant 30 min.
  2. Jeter le milieu de croissance.
  3. Laver le tissu deux fois avec du PBS 1X.
  4. Placer le tissu sur une plaque de culture de 6 cm de cellules de distinguer entre les couches myomètre et l'endomètre (se référer aux figures 2A à 2C pour une description plus détaillée). Séparer l'endomètre.
  5. L'utilisation d'un scalpel ou une lame de rasoir, sectionner le tissu en petits morceaux en grattant sur la boîte de culture de 6 cm de cellule. Ces rayures faciliter la fixation des cellules de l'endomètre primaires émergents. Par rapport à la méthode de la trypsine, plus le tissu est nécessaire (voir la figure 2D pour une approximation).
  6. Doucement, ajouter 2 ml de milieu de croissance à plat rayé (fragments de tissus seront visibles et idéalement immobilisé à partir du mouvement de grattage).
  7. Transférer la plaque (s) à un incubateur de culture cellulaire désignée (37 ° C et 5% CO 2). Désigner un lieu pour les lignes de cellules primaires, loin de OTHer des boîtes de culture cellulaire. Les cultures primaires sont plus sensibles à l'infection et de contamination.
  8. Examiner les cellules au microscope optique quotidien. De petites populations de cellules devraient émerger de deux ou trois jours autour des tissus tranches (voir la figure 3B).
  9. Pour maintenir les cultures, laver délicatement avec du PBS 1X et ajouter un milieu de croissance frais (2 ml) tous les trois jours. Lorsque l'augmentation du taux de prolifération, des milieux de croissance supplémentaire (3-4 ml) peuvent être ajoutés à la plaque de culture de 6 cm (s).
    Remarque: Pendant le lavage et médias changements, des morceaux de tissu seront probablement aspiré. Ceci n'affectera pas la croissance de cellules adhérentes. Des morceaux de tissu doivent être aspirés par l'étape ultérieure (2,10) en tant que nouvelles colonies sont peu susceptibles d'apparaître après une semaine.
  10. Lorsque la plaque de 6 cm est d'environ 75 - 80% de confluence (voir la figure 3B), passage en utilisant 0,05% de trypsine. Cellules primaires ne peuvent pas être passées indéfiniment - geler bas une plaque de cellules dès que deux ou trois plaques sont maintained. Si plusieurs passages sont nécessaires, conformément à un protocole d'immortalisation (revue dans Ref 3).

3. Préparation de lignées cellulaires primaires à l'aide de la méthode de la trypsine

  1. Placer un petit morceau de tissu endométrial (voir la figure 2D pour un rapprochement) dans 2 ml de trypsine à 0,25% additionné de kanamycine (0,03 mg / ml de concentration finale).
  2. Incuber les tissus à 37 ° C sur une plateforme rotative pendant 30 minutes.
  3. Vortex brièvement le tissu.
  4. Centrifuger l'échantillon à 200-400 g pendant 2 min et jeter le surnageant.
  5. Ajouter trypsine frais et à la kanamycine.
  6. Faire incuber le tissu à 37 ° C tout en tournant pour un hr.
  7. Vortex le tissu pour 5-10 sec.
  8. Ajouter 2 ml de milieu de croissance (supplémenté avec 10% de sérum bovin fœtal et 1% de pénicilline-streptomycine) pour désactiver la trypsine.
  9. Centrifuger les cellules à 200-400 g pendant 2-3 min.
  10. Jeter le surnageant et ajouter 2 ml de grandire médias à le culot cellulaire.
  11. Plaque sur une boîte de culture de 6 cm de cellule. Grattage de la plaque comme dans l'étape 2.5 de préparation de lignées cellulaires primaires en utilisant la méthode Grattage n'est pas nécessaire, mais améliore la fixation et l'excroissance de cultures primaires.
  12. Surveillance de cellules sous un microscope optique quotidien. Les cellules sont généralement visibles au microscope optique après 24-48 heures (voir la figure 3C).
  13. Pour maintenir les cultures, de surveiller les cellules et changer de support tous les 2-3 jours comme dans l'étape 2.9.
  14. Pour le passage des cellules, utilisez 0,05% ou 0,25% de trypsine lorsque les cellules atteignent 75-80% de confluence (voir la figure 3C).

4. Sauvegarde tissu supplémentaire pour l'analyse (Snap congélation et la fixation au formol)

  1. Laver l'échantillon deux fois avec du PBS 1X.
  2. Aspirer autant de liquide que possible.
  3. Snap congélation, placer l'échantillon de tissu de l'endomètre dans un tube de 1,7 centrifugeuse (voir les figures 2F et 2G). Placez le 1.7tube de centrifugeuse dans l'azote liquide pendant 10 secondes ou jusqu'à ce qu'il puisse être considéré que le tissu a gelé le bas.
    Remarque: Prenez soin de ne pas toucher directement l'azote liquide lors de la préparation des échantillons. Les échantillons peuvent être conservés à -80 ° C jusqu'à leur traitement ultérieur ou d'analyse.
  4. Pour la fixation au formol, couper un petit morceau de tissu endométrial (voir la figure 2H), et plonger dans 10% du formol tamponné de zinc. Après 24 heures, éliminer le formol et ajouter de l'éthanol à 70% des échantillons de tissu jusqu'à ce que le traitement ultérieur.

5. Immunofluorescence (IF)

  1. Cellule fixation
    1. Préparer les cellules sur une lame de culture ou de la plaque.
    2. Doucement, laver les cellules avec du PBS 1X.
    3. Ajouter pré-réfrigéré (4 ° C) et de l'acétone Methanol (mélangés dans un rapport 1:1) pendant 5 min.
    4. Air sécher la lame avant de poursuivre. Glisser peut être stocké à 4 ° C pendant 1 à 2 semaines si nécessaire.
  2. Traitement SI
    1. Réhydrater les cellules avec du PBS 1X pendant 10 min. Pour la following étapes 1-6, procéder à tous les lavages et les incubations sur une plate-forme tournante.
    2. Bloc à l'aide de PBS 1X supplémenté avec 1% de sérum-albumine bovine (BSA) et 1% d'espèces sérum spécifique (2 ème source d'anticorps) pendant 30 min à température ambiante (RT).
    3. Incuber dans l'anticorps primaire (voir les recommandations du fabricant pour la dilution de l'anticorps). Reportez-vous aux documents d'anticorps spécifiques. Diluer l'anticorps primaire dans un tampon de blocage frais comme à l'étape 5.2.2. Cette incubation peut être réalisée pendant au moins 2 heures à température ambiante ou une nuit à 4 ° C.
    4. Laver 3 fois avec du PBS 1X pendant 5 min chacun.
    5. Incuber dans l'anticorps secondaire (voir les recommandations du fabricant pour la dilution de l'anticorps). Diluer l'anticorps secondaire dans du tampon de blocage frais comme à l'étape 5.2.2. Pour empêcher la photo-blanchiment, il est important de procéder à des étapes ultérieures, et ce en l'absence de lumière.
    6. Laver 3 fois avec du PBS 1X pendant 5 min chacun.
    7. Thoroughly sécher les diapositives.
    8. Ajouter milieux de montage et solution de contre-coloration DAPI.
    9. Appliquer la lamelle et sceller les bords à l'aide d'étanchéité (s). Lames peuvent être stockées à 4 ° C dans l'obscurité pendant jusqu'à 2 semaines.

6. Extraction de l'ARN

  1. Pellet 1 x 10 7 cellules par centrifugation. Tous les matériaux et les réactifs de ce protocole doivent être RNase.
  2. Lyser les cellules dans 1 ml de réactif TRIZOL, et incuber les échantillons homogénéisés pendant 10 min à température ambiante pour compléter la dissociation des complexes de nucléoprotéines.
  3. Ajouter 200 ul de chloroforme pour 1 ml de TRIZOL. Secouer vigoureusement à la main pendant 15 secondes et incuber pendant 2-3 min à température ambiante.
  4. Centrifuger à la vitesse maximale (15 000 xg) pendant 15 min à 4 ° C. Trois couches en résulteront.
  5. Transférer la phase aqueuse supérieure dans un tube à centrifuger frais. Ajouter 1 pi de glycogène pour augmenter le rendement de l'ARN; Toutefois, cette étape n'est nécessaire que lorsque une petitequantité d'ARN est prévu.
  6. Ajouter 0,5 ml d'alcool isopropylique à la couche aqueuse, et inverser les échantillons 3 à 5 fois. Incuber les échantillons à température ambiante pendant 10 min. Pour augmenter le rendement, les échantillons peuvent être placés dans -20 ° C ou -80 ° C pendant 30 min.
  7. Centrifuger à vitesse maximale pendant 10 minutes à 4 ° C.
  8. À ce stade, une petite pastille d'ARN doit être visible. Jeter le surnageant.
  9. Laver l'ARN avec 1 ml d'éthanol à 75%.
  10. Centrifuger à vitesse maximale pendant 5 min et jeter le surnageant. Les échantillons peuvent être lavées une fois de plus à éliminer les contaminants inorganiques, mais cette étape n'est pas nécessaire.
  11. En bref, sécher le culot d'ARN jusqu'à culot d'ARN est sec (prend habituellement 7-10 min).
    Remarque: Une étape supplémentaire peut être utilisé pour diminuer la matière inorganique et de diminuer le temps de séchage. Après avoir jeté le surnageant du lavage à l'éthanol, les échantillons de rotation à la vitesse maximale pendant une minute supplémentaire et aspirer le liquide résiduel. Prenez soin de ne pas aspirer à granulés.
  12. Dissoudre l'ARN dans l'eau exempte de RNase, en fonction de la taille de la pastille d'ARN. Les volumes varient généralement 10-50 pi.
  13. Incuber les échantillons à 55 ° C pendant 10 min, et de mesurer la concentration de l'ARN.
  14. Conserver les échantillons à -20 ° C jusqu'à leur traitement ultérieur.

7. Transcription inverse

  1. Amener l'ARN de l'échantillon (1-3 pg) jusqu'à un volume de 9 pi avec H 2 O.
  2. l'ARN de la chaleur à 70 ° C pendant 10 min.
  3. Pour générer un mélange maître AMV, combiner les réactifs suivants: 5 ul de dNTP (concentration de travail de 50 uM), 5 ul de oligos N6 ADN (concentration de travail de 80 uM), 5 ul de tampon 5X AMV, et 1 ul de AMV . Cette solution maître de mélange est conçu par un échantillon.
  4. Ajouter 16 pi de mélange maître de l'ARN chauffée. Le volume réactionnel final est de 25 ul de réaction.
  5. Utiliser les conditions suivantes PCR pour la transcription inverse: (étape 1) de 42 ° C pendant 90 min, (Stage 2) 95 ° C pendant 5 min, et (étape 3) 4 ° C jusqu'à traitement ultérieur.

8. PCR en temps réel

  1. Mener des réactions de PCR en utilisant les amorces, les températures de recuit, les nombres de cycles, et de réactifs figurant au tableau 1.
    Remarque: Il est idéal pour suivre les instructions du fabricant pour l'utilisation de réactifs de PCR (voir à la société et numéros de catalogue de matériaux).

9. In vitro Protocole décidualisation (Dérivé de Ref 4 et 5)

  1. Plate cellules de l'endomètre.
  2. Atteindre une confluence de 75-85%.
  3. Après que les cellules deviennent confluentes, laver une fois avec du PBS 1X.
  4. Rapidement, ajouter des médias sans hormones (phénol libre RPMI supplémenté avec 5% de charbon bande de FBS et 1% de pénicilline-streptomycine).
  5. Après 24 heures, ajouter des médias d'hormone libre supplémenté avec de l'acétate de médroxyprogestérone (MPA) à une concentration finale de 1 uM et 8 bromoadenosine-3 ', 5'-Monophosphate cyclique (AMPc) à une concentration finale de 0,5 mM.
  6. Après au moins 48 heures, arrêter la réaction et sauver la plaque (s) pour un traitement ultérieur.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Comme l'a souligné dans la section Protocole, assurez-vous de procéder à toutes les méthodes sous gouvernement, institutionnels, et des principes éthiques lors de la manipulation et la préparation de tissus humains.

Sont inclus dans ce manuscrit est une illustration du processus général de "la méthode de raclage" (figure 1A) et "le procédé de la trypsine" (Figure 1B) utilisé pour établir des cultures primaires de l'endomètre. Ces procédés sont décrits en détail dans la section de protocole (voir les parties 1 -. 3.). Les deux méthodes sont couronnés de succès dans la croissance de cultures primaires de l'endomètre. L'avantage de "la méthode de grattage" est le temps de préparation raccourcie; Cependant, le temps nécessaire pour observer les cellules viables est habituellement de 2 à 4 fois plus longue par rapport à la «méthode de la trypsine."

L'invention concerne des images numériques du tissu humain initiale reçue à partir de l'obtention de tissus. Les couches de l'utérus peuvent être distingués par lala grossièreté de la couche, c'est à dire le myomètre est épaisse et musculaire et l'endomètre est mince et plus rendement. Nous avons mis en évidence la couche épaisse, le muscle lisse (myomètre) en blanc et décrit la couche de l'endomètre d'intérêt dans le noir à partir de deux échantillons d'hystérectomie différents (Figures 2A et 2B). Sur la figure 2C, sont orientés avec les tissus du myomètre faisant face vers le haut tandis que l'endomètre est positionné vers le bas. La mince couche perimetrial a subi une résection chirurgicale et non mis en évidence dans ces images. Il est également important de noter que la taille de la couche de l'endomètre chez ces images numériques à 2 dimensions est déformé comme la couche 3 dimensions réelle est très mince par rapport à l'myomètre.

Les dimensions de découpe de tissu approprié est important à la fois pour "le procédé de raclage" et "le procédé de la trypsine." Dans la figure 2D, tailles appropriées sont désignés pour chaque méthode ci-dessus de l'échantillon respectif. En utilisant une 0.5x00,5 x0.5 cm pièce de "la méthode de la trypsine" [gauche] est suffisante pour établir une culture. Le tissu de départ représentant de "la méthode de grattage" [à droite] comprend toutes les couches de l'utérus. Le produit final de "la méthode de raclage" est représentée sur la figure 2E, et il est recommandé que au moins 1x1x1 cm de tissu endométrial être utilisé pour établir des cultures viables. L'obligation pour cet échantillon de tissu coûte un inconvénient de "la méthode de grattage."

Tissu restant est souvent utilisé dans de nombreuses façons, y compris des protéines et des analyses ARN. Pour assurer la préservation de la qualité des tissus, il est important d'utiliser une méthode «instantané gel" comme dans la section Protocole (voir 4.). Cette méthode est également illustrée sur la figure 2F et la figure 2G. Enregistrement tissu supplémentaire par fixation au formol est aussi une pratique courante des médecins et des chercheurs. Préparation des tissus pour la fixation au formol est décrit dans le Protocole la figure 2H.

La microscopie optique est indispensable pour surveiller les cultures de l'endomètre primaires. Cellules stromales de l'endomètre individuels doivent présenter la morphologie des fibroblastes (figure 3A). "La méthode de grattage" génère généralement des amas de cellules émergents premières, principalement le long des rayures induite scalpel (figure 3B, Jour 2). "La méthode de la trypsine" génère à la fois cluster et les modèles de croissance des cellules dispersées (figure 3C, Jour 4). Nous avons inclus plusieurs images représentatives de la plaque initiale (jour 0) sur le premier passage de chaque méthode (figure 3B et 3C).

Beaucoup de tissus sont définis par leur expression de marqueurs spécifiques de tissus tels que l'actine musculaire lisse (SMA) pour le muscle lisse, CD34 pour les cellules souches immunitaires, etc Bien que les expériences gène et expression de la protéine ont été menées pour l'endomètre 6-11, une salle demarqueur spécifique de cellules stromales dometrial n'a pas encore été découvert. Au lieu de cela, les chercheurs évaluent généralement la pureté de stroma de l'endomètre par la mesure des marqueurs de contaminants cellulaires potentiels. Par exemple, les marqueurs cytokératine sont utilisés pour montrer populations épithéliales. Cependant, il est moins préoccupante, parce que l'établissement et le maintien de l'épithélium de l'endomètre sont difficiles et souvent choisi contre (Ref 12 et la figure 4A). Si les échantillons devaient être obtenues au cours de la grossesse, l'expression positive de l'antigène HLA-A,-B,-C démontre germinales, cellules trophoblastiques 13. D'autre part, comme les autres fibroblastes mésenchymateuses, des cellules stromales endométriales expriment la vimentine (CDH1). Nous démontrons avec immunofluorescence, l'expression de la vimentine et de l'absence de la cytokératine et de cadhérine E (CDH1) dans les cellules du stroma de l'endomètre établies (Figure 4B).

Enfin, nous apportons la preuve fonctionnelle de la culture de l'endomètre primaire via un in test in vitro de décidualisation spontanée. Cette méthode a été adaptée à partir Ref 4 et 5, et comprend le traitement de cultures avec une combinaison d'acétate de médroxyprogestérone (MPA) et de 8 - bromoadenosine 3 ', 5'-monophosphate cyclique (AMPc) (décrit dans 9 In vitro Protocole decidualization et modélisé. la figure 5A). En présence de l'AMP et de l'AMPc, les cellules stromales de l'endomètre présentent des profils d'expression génique des changements importants (examinés dans la référence 14). Les marqueurs de décidualisation spontanées fréquemment publiés sont prolactine (PRL) et le facteur de croissance analogue à l'insuline Binding Protein 1 (IGFBP1) (commentaire dans Ref 14). La réponse de ces deux gènes de l'AMP et de l'AMPc sont de bons indicateurs des deux décidualisation spontanée et mise en place réussie d'une culture de cellules stromales de l'endomètre. Nous démontrons dans la figure 5B.


Figure 1. Schématique des deux méthodes d'isolement de l'endomètre primaires. (A) Les étapes 2.1 à 2.10 de la méthode de grattage affiché dans un organigramme. (B) Les étapes 3.1 à 3.14 de la méthode de la trypsine affiché dans un organigramme. Cliquez ici pour agrandir l'image.

Figure 2
Figure 2. Traitement de tissu utérin. (AC) des échantillons cliniques provenant de l'utérus deux patients de sexe féminin. A & C sont dérivés de patients 1 et B est dérivé du patient 2. tissu réséqué chirurgicalement de l'utérus (à gauche) et highlightecouches d utérins (à droite). (A et B) Le myomètre est entouré en blanc et l'endomètre en noir. (C) Le myomètre est face à la caméra. (D) la taille des échantillons initiaux représentatifs de l'endomètre pour les deux méthodes d'isolement sont indiquées. Le procédé de la trypsine nécessite endomètre pur avant ajout de la trypsine tandis que le procédé de raclage peut utilise les échantillons de l'utérus entières. (E) Exemple de l'échantillon de l'endomètre traitée du procédé de raclage. (F et G) de l'image de restante tissu utérin étant préparé pour Snap congélation. Montré est un récipient métallique fabriquée au laboratoire utilisé pour cette méthode. (H) La fixation au formol de l'échantillon de l'endomètre. Cliquez ici pour agrandir l'image.

Figure 3 Figure 3. Des images de microscopie optique de la culture de l'endomètre primaires. . (A) des images représentatives des cultures de cellules stromales de l'endomètre prises à différents pouvoirs et la confluence (B) images représentatifs de la méthode de raclage (jours 0 - 16) pris de la même boîte de culture, alimenté à 10x Remarque:. Lignes visuelles indiquent les rayures de lame chirurgicale (C) des images représentatives de la méthode de la trypsine.. (jours 0 - 16) pris de la même boîte de culture, alimenté à 10x Cliquez ici pour agrandir l'image.

Figure 4
Figure 4. Des images d'immunofluorescence de cellules stromales endométriales. (A) Immunofluorescencedes cultures primaires de l'endomètre isolé par le procédé de raclage. Les images montrent la perte de cytokératine entre passage 2 (P2) et un passage 5 (P5). Protéine de la leucémie promyélocytaire (PML) protéine nucléaire et la coloration DAPI ont été utilisés comme témoins. (B) Images montrent une coloration positive pour le marqueur mésenchymateuses vimentine. Images montrent également coloration négative E cadhérine (CDH1) et cytokératine. Coloration pour DAPI et promyélocytaire protéine de la leucémie (LEMP) ont été fournis en tant que témoins. Cliquez ici pour agrandir l'image.

Figure 5
Figure 5. D'decidualization spontanée de deux cellules stromales endométriales primaires. (A) Schéma de la procédure expérimentale. (B) Régulation à la hausse de la prolactine (PRL) etLe facteur de croissance analogue à l'insuline 1 Binding Protein (IGFBP1) de l'expression génique en réponse à l'AMP et de l'AMPc. Les résultats ont été mesurés par RT-qPCR, et d'expression a été normalisée à GAPDH. La signification a été calculée à l'aide des étudiants t-test (P <0,001 *** et P <0,0001 ****). Les deux lignées cellulaires ont été isolés en utilisant la méthode de grattage. Cliquez ici pour agrandir l'image.

Apprêt Séquence Recuit Température (° C) Cycles Essai
Prolactine (PRL) avant CATATTGCGATCCTGGAATGAGC 60 40 SybrGreen
Prolactine (PRL) n º TCCTCAATCTCTACAGCTTTGGA 60 40 SybrGreen
protéine de liaison du facteur de croissance analogue à l'insuline 1 (IGFBP1)Avant TCCTTTGGGACGCCATCAGTAC 60 40 SybrGreen
protéine de liaison du facteur de croissance analogue à l'insuline 1 (IGFBP1) n º GATGTCTCCTGTGCCTTGGCTA 60 40 SybrGreen
GAPDH Non spécifié (voir la liste de réactif) 60 40 Taqman

Tableau 1. Conditions PCR pour les marqueurs de décidualisation.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

D'autres groupes ont décrit et adapté méthodologie pour la préparation de cultures stromales endométriales, dont la plupart utilisent la collagénase 4,12,13,15-18. Dans ce manuscrit, nous avons fourni la méthodologie et les données pour deux endomètre méthodes de culture de cellules stromales primaires simplifiées, qui sont tous deux utilisés par notre laboratoire pour des raisons économiques et de la disponibilité pratique de la trypsine et / ou une lame de rasoir.

Lorsque l'on compare nos deux méthodes, à la fois de générer avec succès des cultures primaires viables. Notre procédé préféré est le procédé à la trypsine, car il s'agit généralement d'un rendement plus élevé avec une exigence inférieure de la taille de l'échantillon. Cependant, si le temps de préparation est limité, le procédé de raclage nécessite 30 minutes tandis que le placage des cellules selon la méthode de la trypsine faut plus d'une heure et demie.

Il faut également noter que nous démontrons ces méthodes avec des échantillons d'hystérectomie par opposition à des biopsies de l'endomètre. Bio de l'endomètrepsies sont prises sans ingérence importante et ont tendance à produire des spécimens plus petits. Pourtant, les méthodes décrites dans ce manuscrit (en particulier la méthode de la trypsine) devraient produire des cultures de biopsies de l'endomètre.

Il existe de nombreuses applications pour les cellules stromales de l'endomètre primaires. Comparaison cultures stromales de l'endomètre de l'homme par rapport à d'autres mammifères peuvent fournir des indices sur les questions qui ont été débattues pendant des siècles sur pourquoi les êtres humains ont des règles. Il ya d'autres études de physiologie inexplorées qui nécessitent la culture in vitro. D'intérêt particulier sont les découvertes qui permettent de mieux comprendre les événements du cycle de reproduction, tels que les résultats qui ont lié les événements moléculaires épigénétiques aux événements fonctionnels du cycle de reproduction 19,20, 21, et examinés dans 11 Réf.

Les cliniciens bénéficieraient grandement de l'étude de la culture du stroma de l'endomètre et l'identification de biomarqueurss dans les cas de troubles de la reproduction et des tumeurs malignes du cancer. Entre 2006 et 2010, il a été signalé que 7,4 millions de femmes et leurs partenaires ont utilisé les services de l'infertilité aux États-Unis 22. Un pour cent importante de l'infertilité est due à l'échec de la décidualisation 23. De plus, la relation entre les maladies de l'endomètre et l'hyperplasie, tels que l'endométriose à l'infertilité est que récemment évaluée. La capacité d'étudier les cancers gynécologiques utérins par la modélisation in vitro est également précieuse parce que même si sarcome avancé de l'endomètre est rare, il peut être mortel. En établissant dans des cultures primaires in vitro, nous étudions l'impact des événements moléculaires associés aux maladies et peut générer des applications cliniques putatifs.

En conclusion, la génération représentatif et efficace dans des modèles in vivo pour bon nombre de ces applications est difficile. Cela rend la mise au point d'encultures in vitro de l'endomètre primaires pour étudier plusieurs fonctions in vivo critique. Ces deux méthodes d'isolement de l'endomètre, "la méthode de grattage» et «la méthode de la trypsine," permettront d'établir le point d'appui pour notre compréhension de la physiologie et de la pathologie de l'endomètre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à divulgation.

Acknowledgements

Nous remercions la collaboration de Dr Thao Dang et les membres de son laboratoire pour l'utilisation de leur équipement d'imagerie et d'un microscope. Nous remercions également la banque de tissus biologiques et de tissus installation de recherche (BTRF) noyau, Jeff Harper, et les résidents de l'Université de Virginie de nous fournir le tissu utérin. Nous remercions Karol Szlachta pour l'aide avec vue d'ensemble schématique.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics