To metoder til fastsættelse primære humane Endometriecancer stromacellers fra Hysterektomi Prøver

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Etablering primære endometriale stromacellelinier kultur systemer fra hysterektomi prøver er en værdifuld biologisk teknik og et afgørende skridt forud for at forfølge en bred vifte af forskning sigter. Her beskriver vi to metoder, der anvendes til at etablere stromale kulturer fra kirurgisk resektion endometrie væv af menneskelige patienter.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mange bestræbelser har været afsat til at etablere in vitro-cellekultur-systemer. Disse systemer er designet til at modellere et utal af in vivo processer. Cellekultursystemer opstår fra humane endometriske prøver er ingen undtagelse. Applikationer spænder fra normale cykliske fysiologiske processer til endometrie patologier såsom gynækologisk cancer, infektionssygdomme og nedsat fertilitet. Her giver vi to metoder til oprettelse primære endometrie stromaceller fra kirurgisk resektion endometrie hysterektomi prøver. Den første metode er benævnt "skrabe"-metoden og omfatter mekanisk skrabning ved hjælp af kirurgisk eller barberblade, mens den anden metode betegnes "trypsin-metoden". Sidstnævnte metode anvender den enzymatiske aktivitet af trypsin til at fremme adskillelse af celler og primære celleudgroning. Vi illustrerer trin-for-trin metode gennem digitale billeder og mikroskopi. Vi har også provide eksempler på validering endometriale stromacellelinier via kvantitative realtids polymerasekædereaktioner (qPCR) og immunfluorescens (IF).

Introduction

Den humane uterus korpus består af tre lag, det perimetrium (eller serosa), myometrium og endometriet. At skelne hver af disse lag er et vigtigt skridt til at etablere endometriale cellelinjer. Den perimetrium er den yderste lag af livmoderen og består af tynde, serøse celler. Myometrium er tyk, midterste lag af livmoderen og består af glatte muskelceller. Endometriet er identificeret som det indre lag af livmoderen og omfatter epitel og stroma cellepopulationer.

Endometrium er yderligere opdeles i basalis lag, hvis stamceller befolkning er en hypotese at genbesætte functionalis lag ca hver 28 dage 1. Det functionalis lag af den menneskelige endometrium undergår betydelige biokemiske og morfologiske ændringer som reaktion på cirkulerende hormoner. Disse hormoner er afledt fra hypofysen og æggestokkene.

Denkoordineret produktion og frigivelse af hormoner resulterer i et reproduktive cyklus. Den reproduktive cyklus er designet til at forberede endometriet for potentielle embryo implantation begivenheder. Hos mennesker er den reproduktive cyklus kendt som "Menstruation", og opdelt i tre faser - proliferativ, sekretoriske og menstruation. Den proliferative fase omfatter udbredelsen af ​​functionalis endometrie lag hvorimod den sekretoriske fase er præget af functionalis modning. Specifikt ekstracellulære forandringer, sekreter og cellulær differentiering signalere en potentiel implantation. Hvis implantation ikke sker inden udløbet af den sekretoriske fase bliver functionalis endometriske lag kaste under menstruation fase. Betydningen af ​​menstruation og de begivenheder, der udløser udgydelse af functionalis lag bliver stadig debatteret. Hos mennesker er det blevet foreslået, at menstruation er resultatet af en specifik mid-sekretorisk fase differentiering begivenhed er kendtsom "spontan decidualization" 2. I dette manuskript, giver vi detaljeret metode til både endometrie stromacelle isolation metoder, og bruge en kombination af immunfluorescens og digitale billeder for at vise effekten af ​​disse tilgange. Derudover anvender vi et almindeligt anvendt in vitro-model af spontan decidualization at bekræfte endometrial stromacelle isolation.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hysterektomi prøver, der anvendes i dette manuskript blev indsamlet i konkordans med en University IRB-godkendt etik protokol nummereret IRB-HSR # 14424.

1.. Sample Erhvervelse fra Klinisk Source

  1. Anskaf regeringen og institutions-baserede etiske retningslinjer og godkendelse dokumentation før starten.
  2. Gennemføre alle trin i sterile forhold.
  3. Bevare patient-afledt væv i medier (RPMI eller DMEM / høj glucose) i et 50 ml rør ved 4 ° C, hvis prøven ikke kan behandles i kultur straks. Prøver kan opbevares i denne tilstand for højst 24 timer.
  4. Vask vævsprøve tre gange med 1X sterilt phosphatbufret saltvand (PBS), og opløsningen mellem hver vask kasseres.

2. Fremstilling af primære cellelinier ved hjælp af Skrabning Metode

  1. Tilføj 4-10 ml vækstmedium (RPMI eller DMEM / høj glucose suppleret med 10% føtalt bovint serum og 1% penicillin-streptomycin) til væv og tilføje Fungizone (0,25 ug / ml slutkoncentration) i 30 minutter.
  2. Kassér vækstmediet.
  3. Vask væv to gange med 1X PBS.
  4. Placer væv på en 6 cm celledyrkningsplade at skelne mellem myometrium og endometrium lag (se figur 2A-2C for yderligere beskrivelse). Adskil endometriet.
  5. Ved hjælp af en skalpel eller barberblad, transektere vævet i små stykker, mens skrabe på 6 cm celledyrkningsskål. Disse ridser lette fastgørelsen af ​​de nye primære endometrie celler. Sammenlignet med trypsin-metoden, er der behov for mere væv (se figur 2D for en tilnærmelse).
  6. Forsigtigt, tilsættes 2 ml vækstmedier til ridset parabol (vævsfragmenter vil være synlig og ideelt immobiliseret fra skrabe bevægelse).
  7. Overfør plade (r) til et udpeget cellekultur inkubator (37 ° C og 5% CO 2). Udpege et sted for primære cellelinier, væk fra othare celledyrkningsskåle. Primære kulturer er mere følsomme over for infektion og forurening.
  8. Undersøg cellerne under et lysmikroskop dagligt. Små populationer af celler skulle opstå ved dag to eller tre fra omkring de skivede væv (se figur 3B).
  9. For at opretholde kulturer vaskes forsigtigt med 1X PBS, og der tilsættes friske vækstmedier (2 ml) hver tredje dag. Når spredningen stiger, kan yderligere vækst medier (3-4 ml) lægges til den 6 cm kultur plade (r).
    Bemærk: Under vask og medieændringer vil stykker af væv sandsynligvis aspireres. Dette vil ikke påvirke væksten af ​​klæbende celler. Vævsstykker bør aspireret ved det efterfølgende trin (2,10), som er usandsynligt, at dukke op efter en uge nye kolonier.
  10. Når 6 cm plade er omkring 75 - 80% sammenflydende (se figur 3B), passage anvendelse af 0,05% trypsin. Primære celler ikke kan passeres i det uendelige - fryse ned én plade af celler, så snart to eller tre plader er maintained. Hvis flere passager er påkrævet, skal du følge en immortalization protokol (revideret i ref 3).

3.. Fremstilling af primære cellelinier ved hjælp af trypsin Metode

  1. Placer en lille stykke af endometrisk væv (se figur 2D en tilnærmelse) i 2 ml 0,25% trypsin suppleret med kanamycin (0,03 mg / ml slutkoncentration).
  2. Inkuber væv ved 37 ° C på roterende platform i 30 minutter.
  3. Kortvarigt vortex vævet.
  4. Centrifuger prøven ved 200-400 xg i 2 min og supernatanten.
  5. Tilføj frisk trypsin og kanamycin.
  6. Inkuberes vævet ved 37 ° C under rotation for en time.
  7. Vortex væv i 5-10 sek.
  8. Tilføj 2 ml vækstmedium (suppleret med 10% føtalt bovint serum og 1% penicillin-streptomycin) for at deaktivere trypsin.
  9. Centrifugér cellerne ved 200-400 xg i 2-3 min.
  10. Supernatanten fjernes, og tilsæt 2 ml growth medier til de pelleterede celler.
  11. Plate på en 6 cm celledyrkningsskål. Skrabning pladen som i trin 2.5 af Forberedelse Primære cellelinier ved hjælp af Skrabning metode er ikke nødvendig, men forbedrer den vedhæftede fil og udvækst af primære kulturer.
  12. Monitor celler under et lysmikroskop dagligt. Cellerne er normalt synlige under et lysmikroskop efter 24-48 timer (se figur 3C).
  13. For at opretholde kulturer, overvåger cellerne og ændre medier hver 2-3 dage som i trin 2.9.
  14. Til passage cellerne bruge 0,05% eller 0,25% trypsin når cellerne når 75-80% konfluens (se figur 3C).

4.. Lagring ekstra væv til analyse (Snap Frysning og formalinfiksering)

  1. Vask prøven to gange med 1X PBS.
  2. Aspirer så meget væske som muligt.
  3. For Snap Frysning placere endometriosevævet prøve i en 1,7 centrifugerør (se figur 2F og 2G). Anbring 1.7centrifugerør i flydende nitrogen i 10 sekunder, eller indtil det kan ses, at vævet er frosset ned.
    Bemærk: Pas på ikke at røre direkte flydende nitrogen ved klargøring af prøver. Prøver kan opbevares ved -80 ° C indtil yderligere behandling eller analyse.
  4. For formalinfiksering, skæres et lille stykke af endometrievæv (se figur 2H) og dykke i 10% bufferet zink formalin. Efter 24 timer, kasseres formalin og tilføje 70% ethanol til vævsprøver indtil videre forarbejdning.

5.. Immunofluorescens (IF)

  1. Cellefiksering
    1. Forbered celler på en kultur dias eller plade.
    2. Forsigtigt vaskes cellerne med 1X PBS.
    3. Tilføj forafkølet (4 ° C) Methanol og Acetone (blandet i forholdet 1:1) i 5 minutter.
    4. Lufttørre slide, før du fortsætter. Slide kan opbevares ved 4 ° C i 1-2 uger, hvis nødvendigt.
  2. Behandling IF
    1. Rehydrér cellerne med 1X PBS i 10 min. For following trin 1-6, udføre alle vasker og inkubationer på en roterende platform.
    2. Block hjælp 1X PBS suppleret med 1% bovint serumalbumin (BSA) og 1% artsspecifik serum (kilde 2. antistof) i 30 minutter ved stuetemperatur (RT).
    3. Inkuber i primært antistof (se producentens anbefalinger for antistoffortyndinger). Se Materialer til specifikke antistoffer. Fortynd det primære antistof i frisk blokeringspuffer som i trin 5.2.2. Kan udføres denne inkubering i mindst 2 timer ved stuetemperatur eller natten over ved 4 ° C.
    4. Vask 3 gange med 1X PBS i 5 minutter hver.
    5. Inkuber i sekundært antistof (se producentens anbefalinger for antistoffortyndinger). Fortynd det sekundære antistof i frisk blokeringspuffer som i trin 5.2.2. For at forhindre foto-blegning, er det vigtigt at gennemføre dette og efterfølgende trin i fravær af lys.
    6. Vask 3 gange med 1X PBS i 5 minutter hver.
    7. Thoroughly tørre dias.
    8. Tilføj montering medier og DAPI-modfarvning løsning.
    9. Påfør dækglas og forsegle kanterne ved hjælp af tætningsmiddel (r). Slides kan opbevares ved 4 ° C i mørke i op til 2 uger.

6.. RNA-ekstraktion

  1. Pelletere 1 x 10 7 celler ved centrifugering. Alle materialer og reagenser i denne protokol skal RNase gratis.
  2. Lyserer cellerne i 1 ml TRIZOL reagens og inkuberes de homogeniserede prøver i 10 min ved stuetemperatur for at fuldføre dissociering af nukleoprotein-komplekser.
  3. Tilsæt 200 pi af chloroform per 1 ml TRIZOL. Rystes kraftigt med hånden i 15 sekunder og inkuberes i 2-3 min ved stuetemperatur.
  4. Centrifugeres ved maksimal hastighed (15.000 xg) i 15 min ved 4 ° C. Tre lag vil medføre.
  5. Den øverste vandige fase overføres til et rent mikrocentrifugerør. Tilsæt 1 pi glykogen til at øge RNA-udbytte; imidlertid kun nødvendigt dette trin, når en lillemængde RNA forventes.
  6. Tilsæt 0,5 ml isopropylalkohol til det vandige lag, og invertsukker prøverne 3-5 gange. Inkuber prøver ved stuetemperatur i 10 min. At øge udbyttet, kan prøverne anbringes i -20 ° C eller -80 ° C i 30 minutter.
  7. Centrifugeres ved maksimal hastighed i 10 min ved 4 ° C.
  8. På dette tidspunkt skal en lille pellet af RNA være synlige. Supernatanten.
  9. Vask RNA med 1 ml 75% ethanol.
  10. Centrifugeres ved maksimal hastighed i 5 minutter og supernatanten. Prøver kan vaskes en gang mere for at fjerne uorganiske kontaminanter, men dette trin er ikke nødvendigt.
  11. Kort fortalt tørre RNA pellet indtil RNA pellet tør (sædvanligvis 7-10 min.)
    Bemærk: Et yderligere trin kan bruges til at mindske uorganisk stof og reducere tørretid. Efter bortkastning af supernatanten fra ethanol vask, centrifugering prøver ved maksimal hastighed for et ekstra minut og aspirat resterende væske. Pas på ikke at aspirere pellet.
  12. Opløs RNA i RNase-frit vand, afhængigt af størrelsen af ​​RNA-pellet. Mængder ligger typisk 10-50 gl.
  13. Inkuber prøverne ved 55 ° C i 10 min, og måle koncentrationen af ​​RNA.
  14. Opbevar prøver ved -20 ° C indtil yderligere forarbejdning.

7.. Revers transkription

  1. Prøven bringes RNA (1-3 ug) til et volumen på 9 pi med H 2 O.
  2. Heat-RNA til 70 ° C i 10 min.
  3. For at generere en AMV mester mix, kombinere følgende reagenser: 5 pi dNTP (arbejds koncentration på 50 uM), 5 pi N6 DNA oligo'er (arbejder koncentration på 80 uM), 5 pi 5X AMV buffer, og 1 ml af AMV . Denne master mix løsning er designet per én prøve.
  4. Tilføj 16 ul af master mix til den opvarmede RNA. Det endelige reaktionsvolumen vil være 25 ul reaktion.
  5. Brug følgende PCR-betingelser for revers transkription: (trin 1) 42 ° C i 90 min, (Stage 2) 95 ° C i 5 min, og (trin 3) 4 ° C indtil yderligere forarbejdning.

8.. Real Time PCR

  1. Gennemføre PCR-reaktioner under anvendelse af primere, udglødningstemperaturer, cyklus tal, og reagenser i tabel 1.
    Bemærk: Det er ideelt at følge fabrikantens anvisninger, når du bruger PCR-reagenser (se virksomheds-og katalognumre i materialer).

9.. In vitro Decidualization Protocol (Afledt af Ref 4 og 5)

  1. Plate endometrie celler.
  2. Vokse til en konfluens på 75-85%.
  3. Efter cellerne bliver konfluente, vaskes en gang med 1X PBS.
  4. Hurtigt tilsættes hormon-frie medier (Phenol fri RPMI suppleret med 5% trækul strimmel FBS og 1% penicillin-streptomycin).
  5. Efter 24 timer tilsættes hormon frie medier suppleret med medroxyprogesteronacetat (MPA) i en endelig koncentration på 1 uM og 8-bromoadenosine 3 ', 5'--Cyklisk monophosphat (cAMP) i en endelig koncentration på 0,5 mM.
  6. Efter mindst 48 timer, stoppe reaktionen og gemme skilt (e) til videre forarbejdning.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Som understreget i protokol sektionen, skal du sørge for at udføre alle metoder under regeringens, institutionelle og etiske retningslinjer ved håndtering og klargøring humant væv.

Inkluderet i dette manuskript er en illustration af den generelle workflow "skrabe"-metoden (figur 1A) og "trypsin-metoden" (figur 1B), der anvendes til at indføre primære endometriske kulturer. Disse fremgangsmåder er beskrevet i detaljer i protokol sektionen (se del 1 -. 3..). Begge metoder lykkes i væksten af ​​primære endometrie kulturer. Fordelen til "skrabe"-metoden er den forkortede forberedelse; men den tid det tager at observere levedygtige celler er sædvanligvis 2 - 4 gange længere i forhold til "trypsin-metoden."

Forudsat er digitale billeder af den indledende humant væv modtaget fra væv indkøb. Livmoderen lag kan skelnes ved dengrovhed af laget, dvs myometrium er tyk og muskulær og endometriet er tynd og mere eftergivende. Vi har fremhævet den tykke, glatte muskulatur lag (myometrium) i hvidt og skitserede endometrie lag af interesse i sort fra to forskellige hysterektomi prøver (figur 2A og 2B). I figur 2C er væv orienteret med myometrium opad, mens endometrium er placeret ned. Den tynde, perimetrial lag blev kirurgisk resektion og ikke fremhævet i disse billeder. Det er også vigtigt at bemærke, at størrelsen af ​​den endometriske lag i disse digitale 2-dimensionelle billeder er fordrejet som den faktiske 3-dimensionelle lag er meget tyndt sammenlignet med myometrium.

Skæring passende væv størrelse er vigtig for både "skrabe"-metoden og "trypsin-metoden." I figur 2D, er passende størrelser, der er udpeget for hver metode over den pågældende prøve. Ved at bruge en 0.5x0.5 X0.5 cm stykke til "trypsin-metoden" [left] er tilstrækkelige til at fastslå en kultur. Den repræsentative udgangspunkt væv for "skrabe-metoden" [højre] omfatter alle uterine lag. Slutproduktet for "skrabe"-metoden er vist i figur 2E, og det anbefales, at mindst 1x1x1 cm af endometrisk væv anvendes til at etablere levedygtige kulturer. Kravet til dette meget vævsprøve er en ulempe ved "skrabning metode."

Resterende væv anvendes ofte på mange måder, herunder protein og RNA-analyser. For at sikre bevarelsen af væv kvalitet, er det vigtigt at bruge en "snap fryse"-metoden, som i protokol sektionen (se 4.).. Denne metode er også illustreret i figur 2F og figur 2G. Lagring ekstra væv af formalin fiksering er også en fælles praksis for patologer og forskere. Forberedelse væv til formalinfiksering er beskrevet i protokollen figur 2. halvår.

Lysmikroskopi er afgørende for overvågning af primære endometriale kulturer. Individuelle endometriske stromale celler, bør udvise fibroblast morfologi (figur 3A). "The skrabe metode" typisk genererer klynger af tidlige nye celler, primært langs skalpel-induceret ridser (figur 3B, dag 2). "The trypsin-metoden" genererer både klynge og spredte cellevækst mønstre (figur 3C, dag 4). Vi har inkluderet flere repræsentative billeder fra den indledende udpladning (dag 0) til den første passage af hver metode (figur 3B og 3C).

Mange væv er defineret ved deres ekspression af vævsspecifikke markører, såsom glat muskel-actin (SMA) til glat muskulatur, CD34 Immunreaktioners stamceller osv. Mens gen og protein udtryk forsøg er blevet foretaget for endometrium 6-11, en ​​endometrial stromacelle specifik markør endnu at blive opdaget. I stedet forskere almindeligvis vurdere endometrial stroma renhed ved måling af markører fra potentielle celle forureninger. For eksempel er cytokeratin markører anvendes til at vise epitel populationer. Men det er et mindre problem, fordi etablering og vedligeholdelse af endometrie epitel er vanskelige og udvælges sædvanligvis imod (Ref 12 og figur 4A). Hvis prøverne skulle opnås under graviditet, positiv ekspression af HLA-A,-B,-C, viser kimceller, trophoblastceller 13. På den anden side, ligesom andre mesenchymale fibroblaster, endometriske stromale celler udtrykker vimentin (CDH1). Vi viser med immunofluorescens ekspressionen af vimentin og fraværet af cytokeratin og E cadherin (CDH1) på etablerede endometriske stromale celler (figur 4B).

Endelig giver vi funktionelle tegn på primær endometrie kultur via en In vitro spontan decidualization assay. Denne fremgangsmåde blev tilpasset fra Ref. 4 og 5 og involverer behandling af kulturer med en kombination af medroxyprogesteronacetat (MPA) og 8 - bromoadenosine 3 ', 5'-cyklisk monophosphat (cAMP) (beskrevet i 9 In vitro Decidualization protokollen og modelleret. i figur 5A). I nærværelse af MPA og cAMP, endometrielæsioner stromaceller udviser væsentligt ændret genekspression profiler (anmeldt i Ref. 14). De hyppigst offentliggjorte spontane decidualization markører er Prolaktin (PRL) og insulin-lignende vækst faktor bindende protein 1 (IGFBP1) (revideret i Ref. 14). Svaret af disse to gener for MPA og lejren er stærke indikatorer for både spontan decidualization og vellykket etablering af et endometrie stroma kultur. Vi demonstrere dette i figur 5B.


Fig. 1. Skematisk af de to primære endometriske isoleringsmetoder. (A) Trin 2,1-2,10 af skrabning metode, der vises i en organisationsplan. (B) Trin 3.1-3.14 af trypsin metode, der vises i en organisationsplan. Klik her for at se større billede.

Figur 2
Figur 2. Behandles uterusvæv. (AC) Kliniske uterine prøver fra to kvindelige patienter. A & C er afledt fra patient 1 og B stammer fra patient 2. Kirurgisk resektion livmodervæv (venstre) og highlighted uterine lag (højre). (A & B) myometrium er omgivet i hvidt og endometrium i sort. (C) myometrium vender kameraet. (D) Indledende repræsentative endometriale stikprøvestørrelser for begge isolation metoder er indikeret. Trypsin metode kræver ren endometrium før tilsætning af trypsin mens skrabning metode anvender hele uterine prøver. (E) Eksempel på forarbejdede endometrisk prøve af skrabning metode. (F & G) Billede af resterende uterusvæv forberedes til Snap frysning. Vist er en lab-made metal beholder anvendes til denne metode. (H) formalinfiksering for endometrie prøve. Klik her for at se større billede.

Figur 3 Figur 3.. Lysmikroskopi billeder af primære endometriale kulturer. . (A) Repræsentative billeder af endometrie stroma cellekulturer taget på forskellige beføjelser og sammenflydning (B) Repræsentative billeder af skrabning metoden (dage 0-16) taget af den samme kultur fad, powered 10x Note:. Visuelle linjer angiver ridser fra kirurgisk kniv (C) Repræsentative billeder af trypsin-metoden.. (Days 0-16) taget af den samme kultur fad, powered 10x Klik her for at se større billede.

Figur 4
Figur 4.. Immunofluorescens billeder af endometriske stromale celler. (A) Immunofluorescensaf primære endometriske kulturer isoleret via skrabning metode. Billeder demonstrere tab af cytokeratin mellem passage 2 (P2) og passage 5 (P5). Promyelocytic leukæmi protein (PML) nuklear protein og DAPI farvning blev brugt som kontrol. (B) billeder demonstrere positiv farvning for mesenkymal markør Vimentin. Billederne viser også negativ farvning for E cadherin (CDH1) og Cytokeratin. Farvning for DAPI og promyelocyt leukæmi protein (PML) blev leveret som kontroller. Klik her for at se større billede.

Figur 5
Figur 5. Spontan decidualization af to primære endometriske stromale celler. (A) Oversigt over eksperimentelle procedure. (B) Opregulering af Prolaktin (PRL) ogInsulin-lignende vækst faktor bindende protein 1 (IGFBP1) genekspression som svar på MPA og cAMP. Resultaterne blev målt via RT-qPCR og udtryk blev normaliseret til GAPDH. Signifikans blev beregnet ved hjælp af studerende t-test (P <0.001 *** og P <0,0001 ****). Begge cellelinjer blev isoleret ved hjælp af skrabning metoden. Klik her for at se større billede.

Primer Sequence Annealingtemperatur (° C) Cycles Assay
Prolaktin (PRL) Fremad CATATTGCGATCCTGGAATGAGC 60 40 Sybrgreen
Prolaktin (PRL) Omvendt TCCTCAATCTCTACAGCTTTGGA 60 40 Sybrgreen
Insulin-lignende vækstfaktor-bindende protein 1 (IGFBP1)Fremad TCCTTTGGGACGCCATCAGTAC 60 40 Sybrgreen
Insulin-lignende vækstfaktor-bindende protein 1 (IGFBP1) bagside GATGTCTCCTGTGCCTTGGCTA 60 40 Sybrgreen
GAPDH Uspecificeret (se reagenslisten) 60 40 TaqMan

Tabel 1. PCR-betingelser for decidualization markører.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Andre grupper har beskrevet og tilpasset metode for udarbejdelse af endometrie stroma kulturer, hvoraf de fleste anvender collagenase 4,12,13,15-18. I dette manuskript, har vi givet metode og evidens for to forenklede primære endometrie stroma dyrkningsmetoder, som begge er brugt af vores laboratorium af økonomiske årsager og praktisk tilgængelighed af trypsin og / eller et barberblad.

Når man sammenligner vores to metoder, begge med succes genererer levedygtige primære kulturer. Vores foretrukne metode er trypsin fremgangsmåde som der typisk et højere udbytte med en mindre krav prøvestørrelse. Hvis forberedelse tid er begrænset, skrabning metode kræver dog, 30 minutter mens plating celler ved hjælp af trypsin metode tager mere end en time og en halv.

Også bemærkelsesværdigt er, at vi demonstrere disse metoder med hysterektomi prøver i modsætning til endometriebiopsierne. Endometrie biopsies er taget uden væsentlig indtrængen og har tendens til at producere mindre prøver. Alligevel bør de metoder, der er beskrevet i dette manuskript (især trypsin-metoden) yde kulturer fra endometriebiopsierne.

Der er mange ansøgninger til primære endometriale stromaceller. Sammenligning endometrie stroma kulturer fra menneske versus andre pattedyr kan give et fingerpeg om de spørgsmål, der er blevet debatteret i århundreder om, hvorfor mennesker menstruerer. Der er andre uudforskede fysiologi studier, der kræver in vitro kultur. Af særlig interesse er de opdagelser, der giver indsigt i reproduktive cyklus begivenheder såsom resultaterne der har tilknytning epigenetiske molekylære begivenheder til de funktionelle begivenheder reproduktionscyklussen 19,20, 21 og revideret i ref 11..

Klinikere vil have stor gavn af at studere endometrie stroma kultur og identificere biomarkørs i tilfælde af reproduktive lidelser og kræft maligniteter. Mellem 2006 og 2010 blev det rapporteret, at 7,4 millioner kvinder og deres partnere anvendte infertilitet tjenester i USA 22.. En betydelig procent af infertilitet skyldes svigt af decidualization 23. Derudover er forholdet mellem endometriske sygdomme, såsom hyperplasi og endometriose til infertilitet er først for nylig at blive vurderet. Evnen til at studere uterine gynækologisk cancer gennem in vitro-modellering er også uvurderlig fordi selvom avanceret endometrie sarkom er sjælden, kan det være dødelige. Ved at etablere in vitro primære kulturer, vi undersøge virkningen af de molekylære begivenheder, der er forbundet med de sygdomme og kan generere formodede kliniske anvendelser.

Afslutningsvis er det svært at generere repræsentative og effektivt in vivo modeller for mange af disse applikationer. Dette gør udviklingen af ivitro primære endometriske kulturer at undersøge adskillige in vivo-funktioner kritisk. Disse to endometrie isolation metoder, "skrabe-metoden" og "trypsin-metoden", vil bidrage til at give fodfæste for vores forståelse af endometrie fysiologi og patologi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at udlevering.

Acknowledgements

Vi takker fælles indsats Dr. Thao Dang og medlemmer af hendes laboratorium for brug af deres billeder og mikroskop-udstyr. Vi takker også Biorepository og Tissue Research Facility (BTRF) kerne, Jeff Harper, og beboerne på University of Virginia til at forsyne os med uterin væv. Vi takker Karol Szlachta for hjælpen med skematisk oversigt.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics