Twee methoden voor het vaststellen van primaire humane Endometriale Stromal Cellen uit hysterectomie Exemplaren

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Oprichting primaire endometrium stromale celkweek systemen van hysterectomie exemplaren is een waardevolle biologische techniek en een cruciale stap voorafgaand aan het nastreven van een breed scala van onderzoek wil. We beschrijven hier twee methoden om stroma culturen chirurgisch weggesneden endometriale weefsel van menselijke patiënten vastgesteld.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vele inspanningen gedaan om te bepalen in vitro celkweek systemen. Deze systemen zijn ontworpen om een model van een groot aantal in vivo processen. Celkweek systemen die voortkomen uit menselijke endometrium monsters zijn geen uitzondering. Toepassingen variëren van normale cyclische fysiologische processen endometrium pathologieën zoals gynaecologische kankers, infectieziekten en voortplantingsfunctie. Hier bieden we twee methoden voor het vaststellen van primaire endometrium stromale cellen van chirurgisch weggesneden endometrium hysterectomie exemplaren. De eerste methode wordt aangeduid als "het schrapen methode" en omvat mechanische schrapen met chirurgische of scheermesjes, terwijl de tweede methode wordt aangeduid als "de trypsine-methode. 'Deze laatste methode wordt de enzymatische activiteit van trypsine om de scheiding van de elementen en bevorderen cel uitgroei. We illustreren stap-voor-stap methode door middel van digitale beelden en microscopie. We hebben ook provide voorbeelden voor het valideren van endometrium stromale cellijnen via kwantitatieve real time polymerase kettingreactie (qPCR) en immunofluorescentie (IF).

Introduction

De menselijke baarmoeder corpus bestaat uit drie lagen, de perimetrium (of serosa), het myometrium en het endometrium. Onderscheidende elk van deze lagen een belangrijke stap endometrium cellijnen vast. De perimetrium is de buitenste laag van de baarmoeder en samengesteld uit dunne, sereuze cellen. De myometrium is de dikke, middelste laag van de baarmoeder en bestaat uit gladde spiercellen. Het endometrium is geïdentificeerd als de binnenste laag van de baarmoeder en omvat epitheliale en stromale cel populaties.

Het endometrium is verder onderverdeeld in de basalis laag waarvan stamcelpopulatie wordt verondersteld dat de functionalis laag herbevolking ongeveer elke 28 dagen 1. De functionalis laag van het menselijke endometrium ondergaat significante biochemische en morfologische veranderingen in respons op circulerende hormonen. Deze hormonen zijn afgeleid van de hypofyse en de eierstokken.

Degecoördineerde productie en afgifte van hormonen resulteert in een voortplantingscyclus. De voortplantingscyclus is ontworpen om het endometrium te bereiden op mogelijke embryo implantatie gebeurtenissen. Bij mensen wordt de voortplantingscyclus bekend als "de menstruele cyclus" en onderverdeeld in drie fasen - proliferatieve, secretoire en menstruatie. De proliferatieve fase betreft de verspreiding van de functionalis endometrium laag terwijl de secretoire fase wordt gekenmerkt door functionalis rijping. Specifiek extracellulaire veranderingen, afscheidingen en celdifferentiatie signaal een mogelijke inplanting. Als implantatie niet geschieden vóór het einde van de secretoire fase wordt de functionalis baarmoederslijmvlies laag vergoten tijdens de menstruele fase. Het belang van de menstruatie en de gebeurtenissen die het vergieten van de functionalis laag triggeren zijn nog gedebatteerd. In mensen, is gesteld dat de menstruatie is het gevolg van een specifieke mid-secretoire fase differentiatie gebeurtenis bekendals "spontane decidualization" 2. In dit manuscript hebben we gedetailleerde methodologie voor zowel endometrium stromale celisolatie methoden, en gebruik een combinatie van immunofluorescentie en digitale beelden naar de werkzaamheid van deze benaderingen te tonen. Daarnaast we een algemeen in vitro model van spontane decidualization endometrium stromale cel isolatie bevestigen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hysterectomie exemplaren gebruikt in dit manuscript werden verzameld in overeenstemming met een universiteit IRB goedgekeurde ethiek protocol genummerde IRB-HSR # 14424.

1. Sample Overname van Clinical Bron

  1. Verkrijgen overheid en het institutioneel bepaalde ethische richtlijnen en documentatie goedkeuring voordat u begint.
  2. Voeren alle stappen in steriele omstandigheden.
  3. Domein-patiënt afgeleide weefsel in medium (RPMI of DMEM / High Glucose) in een 50 ml buis bij 4 ° C indien het monster niet kan worden verwerkt in kweek onmiddellijk. Monsters kunnen in deze toestand worden bewaard gedurende maximaal 24 uur.
  4. Was weefselmonster driemaal met 1X steriele fosfaat gebufferde zoutoplossing (PBS) en de oplossing tussen wasbeurten ontdoen.

2. Voorbereiding van de primaire cellijnen met behulp van de schrapen Methode

  1. Voeg 4-10 ml groeimedium (RPMI of DMEM / hoge glucose aangevuld met 10% foetaal runderserum en 1% penicilline-streptomycin) weefsel en voeg Fungizone (0,25 ug / ml eindconcentratie) gedurende 30 minuten.
  2. Gooi de groeimedia.
  3. Was weefsel tweemaal met 1X PBS.
  4. Plaats het weefsel op een 6 cm celkweekplaat om onderscheid te maken tussen myometrium en endometrium lagen (zie de figuren 2A-2C voor een nadere beschrijving). Scheid het endometrium.
  5. Met behulp van een scalpel of scheermesje, doorsnijden het weefsel in kleine stukjes, terwijl krabben op de 6 cm celkweekschaal. Deze krassen vergemakkelijken van de bevestiging van de nieuwe primaire endometriumcellen. Vergeleken met de trypsine werkwijze wordt meer weefsel nodig (zie figuur 2D een benadering).
  6. Zachtjes, voeg 2 ml groeimedium om krassen gerecht (weefselfragmenten zichtbaar en ideaal geïmmobiliseerd van het krassen beweging zijn).
  7. Breng de plaat (platen) over aan een celkweek incubator (37 ° C en 5% CO2). Wijs een plek voor primaire cellijnen, weg van OTHer celkweekschalen. Primaire kweken zijn gevoeliger voor infectie en verontreiniging.
  8. Onderzoek de cellen onder een lichtmicroscoop dagelijks. Kleine populaties van cellen zou ontstaan ​​bij dag twee of drie van over de plakjes weefsel (zie figuur 3B).
  9. Om culturen te behouden, was voorzichtig met 1X PBS en voeg verse groeimedia (2 ml) om de drie dagen. Wanneer proliferatie toeneemt, extra groeimedia (3-4 ml) kan worden toegevoegd aan de 6 cm kweek plaat (platen).
    Opmerking: Tijdens het wassen en media verandert, zal stukjes weefsel waarschijnlijk worden opgezogen. Dit heeft geen invloed op de groei van hechtende cellen. Het weefsel moet worden opgezogen door de volgende stap (2,10) nieuwe kolonies waarschijnlijk ontstaan ​​na een week.
  10. Wanneer de 6 cm plaat is ongeveer 75-80% samenvloeiing (zie figuur 3B), doorgang met behulp van 0,05% trypsine. Primaire cellen kan niet onbeperkt worden gepasseerd - bevriezen beneden een plaat van cellen zodra twee of drie borden zijn maintained. Als er meer passages nodig zijn, volgen een immortalization protocol (beoordeeld in Ref 3).

3. Voorbereiding van de primaire cellijnen met behulp van de trypsine-methode

  1. Leg een klein stukje endometriumweefsel (zie Figuur 2D voor een benadering) in 2 ml van 0,25% trypsine aangevuld met Kanamycine (0,03 mg / ml uiteindelijke concentratie).
  2. Incubeer weefsel bij 37 ° C op draaiplateau 30 minuten.
  3. Kort vortex het weefsel.
  4. Centrifugeer het monster bij 200-400 xg gedurende 2 minuten en gooi het supernatant.
  5. Voeg verse trypsine en Kanamycin.
  6. Incubeer het weefsel bij 37 ° C onder draaiing een uur.
  7. Vortex het weefsel voor 5-10 sec.
  8. 2 ml groeimedium (aangevuld met 10% foetaal runderserum en 1% penicilline-streptomycine) Aan trypsine gedeactiveerd.
  9. Centrifugeer cellen bij 200-400 g gedurende 2-3 minuten.
  10. Verwijder het supernatant en voeg 2 ml groeienth media om de gepelleteerde cellen.
  11. Plaat op een 6 cm celkweekschaal. Het schrapen van de plaat zoals in stap 2.5 van voorbereiden Primaire cellijnen met behulp van de schrapen methode is niet nodig, maar bevordert de hechting en uitgroei van primaire culturen.
  12. Monitor cellen onder een lichtmicroscoop dagelijks. Cellen zijn meestal zichtbaar onder een lichtmicroscoop na 24-48 uur (zie Figuur 3C).
  13. De culturen behouden bewaken de cellen en media veranderen elke 2-3 dagen als in stap 2.9.
  14. Om de passage van de cellen, gebruik 0,05% of 0,25% trypsine wanneer cellen te bereiken 75-80% confluentie (zie figuur 3C).

4. Opslaan extra weefsel voor analyse (Snap Invriezen en formalinefixatie)

  1. Tweemaal spoelen monster met 1X PBS.
  2. Zuig zoveel vloeistof als mogelijk.
  3. Voor Snap Bevriezing, plaatst endometriumweefsel monster in een 1,7 centrifugebuis (zie figuren 2F en 2G). Plaats de 1.7centrifugebuis in vloeibare stikstof gedurende 10 seconden of totdat blijkt dat het weefsel beneden bevroren.
    Opmerking: Zorg ervoor dat u rechtstreeks aan vloeibare stikstof bij de voorbereiding van de monsters. Monsters kunnen worden opgeslagen bij -80 ° C tot verdere verwerking of analyse.
  4. Voor formalinefixatie, snijd een klein stukje van het endometrium weefsel (zie figuur 2H), en onder te dompelen in 10% gebufferde formaline zink. Na 24 uur, gooi formaline en voeg 70% ethanol weefselmonsters tot verdere verwerking.

5. Immunofluorescentie (IF)

  1. Cel fixatie
    1. Bereid cellen op een cultuur dia of plaat.
    2. Voorzichtig, wassen cellen met 1X PBS.
    3. Add voorgekoeld (4 ° C) methanol en aceton (gemengd bij een 1:1 verhouding) gedurende 5 minuten.
    4. Lucht drogen de dia voordat u verder gaat. Dia kan worden opgeslagen bij 4 ° C gedurende 1-2 weken indien nodig.
  2. Verwerking IF
    1. Hydrateren cellen met 1X PBS gedurende 10 minuten. Voor de voorllowing stappen 1-6 over tot alle wast en incubatie op een draaiend platform.
    2. Vak met 1X PBS aangevuld met 1% runderserumalbumine (BSA) en 1% soortspecifieke serum (bron 2e antilichaam) gedurende 30 minuten bij kamertemperatuur (RT).
    3. Incubeer in primaire antilichaam (zie aanbevelingen van de fabrikant voor antilichaam verdunningen). Zie Materialen voor specifieke antilichamen. Verdun het primaire antilichaam in verse blokkerende buffer als in stap 5.2.2. Deze incubatie kan worden uitgevoerd ten minste 2 uur bij kamertemperatuur of overnacht bij 4 ° C.
    4. Was 3 maal met 1X PBS gedurende 5 minuten elk.
    5. Incubeer in het secundair antilichaam (zie aanbevelingen van de fabrikant voor antilichaam verdunningen). Verdun het secundaire antilichaam in verse blokkerende buffer als in stap 5.2.2. Om fotoblekingsreactie voorkomen, is het belangrijk om deze en de volgende stappen uitvoeren in de afwezigheid van licht.
    6. Was 3 maal met 1X PBS gedurende 5 minuten elk.
    7. Thoroughly dia drogen.
    8. Voeg montage media en DAPI tegenkleuring oplossing.
    9. Solliciteer dekglaasje en sluit de randen met behulp van kit (s). Dia's kunnen bij 4 ° C worden bewaard in het donker gedurende 2 weken.

6. RNA-extractie

  1. Pellet 1 x 10 7 cellen door centrifugeren. Alle materialen en reagentia in dit protocol moet gratis worden RNAse.
  2. Lyse cellen in 1 ml TRIZOL-reagens en incubeer de monsters gehomogeniseerd gedurende 10 minuten bij kamertemperatuur om dissociatie van nucleoproteïne complexen voltooien.
  3. Voeg 200 ul chloroform per 1 ml TRIZOL. Schud krachtig met de hand gedurende 15 seconden en incubeer gedurende 2-3 minuten bij kamertemperatuur.
  4. Centrifugeer bij maximale snelheid (15.000 x g) gedurende 15 min bij 4 ° C. Drie lagen resulteert.
  5. Breng de bovenste waterige fase over in een schoon microcentrifugebuisje. Voeg 1 ui glycogeen de RNA opbrengst te verhogen; echter, deze stap is alleen nodig wanneer een kleinehoeveelheid RNA verwacht.
  6. Voeg 0,5 ml isopropylalcohol aan de waterige laag en keren de monsters 3-5 keer. Incubeer monsters bij kamertemperatuur gedurende 10 minuten. Om opbrengst te verhogen, kunnen monsters -20 ° C of -80 ° C gedurende 30 minuten geplaatst.
  7. Centrifugeer bij maximale snelheid gedurende 10 min bij 4 ° C.
  8. Op dit punt zou een kleine pellet RNA zichtbaar. Verwijder het supernatant.
  9. Was de RNA met 1 ml 75% ethanol.
  10. Centrifugeer op maximale snelheid gedurende 5 minuten en gooi het supernatant. Monsters kunnen weer aan anorganische verontreinigingen af ​​te wassen, maar deze stap is niet noodzakelijk.
  11. In het kort, droog de RNA pellet tot RNA pellet droog is (duurt meestal 7-10 min).
    Opmerking: Een extra stap kan worden gebruikt om anorganische stof af en verminderen droogtijd. Na het teruggooien van het supernatant van de ethanol te wassen, spinnen monsters bij de maximale snelheid voor een extra minuut en zuig resterende vloeistof. Zorg dat er geen pellet zuigen.
  12. Los RNA in RNase-free water, afhankelijk van de grootte van de RNA-pellet. Volumes variëren meestal 10-50 ul.
  13. Incubeer monsters bij 55 ° C gedurende 10 min, en meet de concentratie van RNA.
  14. WINKEL monsters bij -20 ° C tot verdere verwerking.

7. Reverse Transcriptie

  1. Het monster RNA (1-3 ug) tot een volume van 9 pl met H2O
  2. Warmte RNA 70 ° C gedurende 10 minuten.
  3. Een AMV master mix genereren, combineren de volgende reagentia: 5 pl dNTP (werkende concentratie van 50 uM), 5 pl N6 DNA oligo (bewerken concentratie van 80 uM), 5 ui 5X AMV buffer en 1 pl AMV . Deze master mix oplossing is ontworpen per een monster.
  4. Voeg 16 ul van de master mix tot het verwarmde RNA. Het uiteindelijke reactie volume 25 pi reactie.
  5. Gebruik de volgende PCR-omstandigheden voor omgekeerde transcriptie: (fase 1) 42 ° C gedurende 90 min, (Stage 2) 95 ° C gedurende 5 min, en (stadium 3) 4 ° C tot verdere verwerking.

8. Real Time PCR

  1. Voer PCR-reacties met de primers, annealing temperatuur, cyclus nummers en reagentia in tabel 1.
    Opmerking: Het is ideaal om instructies van de fabrikant volgen bij het ​​gebruik van PCR-reagentia (zie bedrijfs-en catalogusnummers in Materials).

9. In vitro decidualization Protocol (Derived from Ref 4 en 5)

  1. Plate endometriumcellen.
  2. Groeien tot een confluentie van 75-85%.
  3. Na cellen confluent, eenmaal wassen met 1X PBS.
  4. Snel, add-hormoon vrije media (fenol vrij RPMI aangevuld met 5% houtskool strip FBS en 1% penicilline-streptomycine).
  5. Na 24 uur, voeg hormoon vrij medium aangevuld met medroxyprogesteronacetaat (MPA) bij een uiteindelijke concentratie van 1 uM en 8-bromoadenosine 3 ', 5'-Cyclisch monofosfaat (cAMP) in een uiteindelijke concentratie van 0,5 mM.
  6. Na ten minste 48 uur, stop de reactie en bewaar de plaat (s) voor verdere verwerking.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Zoals benadrukt in de sectie Protocol, moet u alle methoden onder overheid, institutionele en ethische richtlijnen uit te voeren bij het ​​hanteren en het voorbereiden van menselijk weefsel.

Inbegrepen in dit manuscript is een illustratie van de algemene werkschema van "het schrapen methode" (figuur 1A) en "de trypsine-methode" (figuur 1B) gebruikt om primaire kweken endometrial stellen. Deze werkwijzen worden in detail beschreven in het protocol (zie delen 1 -. 3.). Beide methoden succesvol blijken in de groei van primaire culturen endometrium. Het voordeel van de "schrapen methode" is de verkorte voorbereidingstijd; echter, de tijd die nodig is om levensvatbare cellen te observeren is meestal 2-4 keer langer is dan "de trypsine-methode."

Mits zijn digitale beelden van het eerste menselijk weefsel ontvangen van weefsels. De baarmoeder lagen kunnen worden onderscheiden door degrofheid van de laag, dat wil zeggen de myometrium is dik en gespierd en het endometrium is dun en meer opbrengst. We hebben de dikke, gladde spierlaag (myometrium) wit gemarkeerd en schetste het endometrium laag van belang in zwart uit twee verschillende hysterectomie monsters (Figuren 2A en 2B). In figuur 2C, worden weefsels georiënteerd met het myometrium naar boven terwijl het endometrium is gepositioneerd beneden. De dunne, perimetrial laag werd chirurgisch weggesneden en niet gemarkeerd in deze beelden. Het is ook belangrijk op te merken dat de grootte van het endometrium laag in deze digitale 2-dimensionale beelden wordt verkeerd als de werkelijke 3-dimensionale laag is zeer dun in vergelijking met het myometrium.

Het snijden van de juiste weefsel omvang belangrijk voor zowel "het schrapen methode" en "de trypsine-methode." In figuur 2D, zijn juiste afmetingen aangewezen voor elke methode boven de respectieve monster. Met behulp van een 0.5x00,5 x0.5 cm stuk voor "de trypsine-methode" [links] is voldoende voor de oprichting van een cultuur. De vertegenwoordiger uitgangspunt weefsel voor "het schrapen methode" [right] omvat alle baarmoeder lagen. Het eindproduct voor "het schrapen methode" wordt weergegeven in figuur 2E, en het wordt aanbevolen dat ten minste 1x1x1 cm endometriumweefsel worden om levensvatbare kweken stellen. De eis voor zoveel weefselmonster is een nadeel van "het schrapen methode."

Restmateriaal wordt vaak gebruikt in tal van manieren, waaronder eiwit en RNA analyses. Om behoud weefsel kwaliteit, is het belangrijk een "snap bevriezing" methode zoals in het protocol (zie 4.). Deze werkwijze wordt ook geïllustreerd in figuur 2F en figuur 2G. Het opslaan van extra weefsel door formalinefixatie is ook een gangbare praktijk van pathologen en onderzoekers. Voorbereiden van weefsel voor formalinefixatie wordt beschreven in het protocol figuur 2H.

Lichtmicroscopie is essentieel voor het bewaken endometrial primaire culturen. Individuele endometrium stromale cellen moeten fibroblast morfologie (figuur 3A) vertonen. "De schrapen methode", wordt meestal clusters van vroege opkomende cellen, voornamelijk langs-scalpel geïnduceerde krassen (Figuur 3B, Dag 2). "De trypsine-methode" genereert zowel cluster-en verspreide celgroei patronen (figuur 3C, Dag 4). Wij hebben verscheidene representatieve beelden van het oorspronkelijke beplating (dag 0) tot de eerste passage van elke methode (Figuur 3B en 3C) inbegrepen.

Veel weefsels worden gedefinieerd door hun expressie van weefselspecifieke merkers zoals gladde spier actine (SMA) voor gladde spieren, CD34 voor immune stamcellen, enz. Terwijl gen-en eiwitexpressie experimenten uitgevoerd voor het endometrium 6-11, een endometrial stromale cel specifieke marker moet nog worden ontdekt. In plaats daarvan, onderzoekers vaak endometriumstroma zuiverheid bepalen door het meten van markers van potentiële cel verontreinigingen. Zo worden cytokeratine markers gebruikt om epitheliale populaties tonen. Het is echter minder groot probleem, omdat opzetten en onderhouden endometrium epitheel moeilijk en meestal geselecteerd tegen (Ref 12 en figuur 4A). Als monsters zouden worden verkregen bij zwangerschap, positieve expressie van HLA-A,-B,-C toont kiem trofoblast cellen 13. Anderzijds, zoals andere mesenchymale fibroblasten, endometriale stromale cellen brengen vimentine (CDH1). We tonen met immunofluorescentie, de expressie van vimentine en de afwezigheid van cytokeratine en E cadherine (CDH1) in onze gevestigde endometriale stromale cellen (Figuur 4B).

Tot slot bieden wij functionele bewijs van primaire endometrium cultuur via een in vitro spontane decidualization assay. Deze werkwijze werd aangepast van Ref 4 en 5, en omvat de behandeling van culturen met een combinatie van medroxyprogesteronacetaat (MPA) en 8 - bromoadenosine 3 ', 5'-cyclisch monofosfaat (cAMP) (9 beschreven In vitro decidualization protocol en gemodelleerd. figuur 5A). In aanwezigheid van MPA en cAMP, endometriale stromale cellen vertonen significant veranderd genexpressieprofielen (besproken in ref 14). De vaak gepubliceerde spontane decidualization markers zijn prolactine (PRL) en Insulin-like Growth Factor Binding Protein 1 (IGFBP1) (besproken in ref 14). De reactie van deze twee genen om de MPA en cAMP zijn sterke indicatoren van zowel spontane decidualization en succesvolle oprichting van een endometrium stromale cultuur. Dat laten we zien in figuur 5B.


Figuur 1. Schema van de twee primaire endometrial isolatiewerkwijzen. (A) Stappen 2,1-2,10 van het schrapen methode weergegeven in een organigram. (B) Stappen 3,1-3,14 van de trypsine-methode weergegeven in een organigram. Klik hier voor grotere afbeelding.

Figuur 2
Figuur 2. Verwerkt baarmoederweefsel. (AC) Clinical baarmoeder monsters van twee vrouwelijke patiënten. A & B zijn afgeleid van patiënt 1 en B is afgeleid van patiënt 2. Chirurgisch weggesneden baarmoeder weefsel (links) en highlighted baarmoeder lagen (rechts). (A & B) Het myometrium is omcirkeld in wit en het endometrium in het zwart. (C) Het myometrium wordt geconfronteerd met de camera. (D) Eerste representatieve endometriumbiopt maten voor zowel isolatie methode wordt aangekruist. De trypsine methode vereist pure endometrium vóór toevoeging van de trypsine terwijl het schrapen methode de gehele baarmoeder exemplaren kunnen gebruikt. (E) Voorbeeld van de verwerkte endometriumbiopt van het schrapen methode. (F & G) Afbeelding van resterende baarmoeder weefsel wordt voorbereid voor Snap bevriezing. Getoond wordt een-lab gemaakte metalen container gebruikt voor deze methode. (H) Formaline fixatie van endometriumbiopt. Klik hier voor grotere afbeelding.

Figuur 3 Figuur 3. Licht microscopie beelden van primaire endometrium culturen. . (A) Vertegenwoordiger beelden van endometrium stromale celculturen, genomen op verschillende bevoegdheden en confluentie (B) Vertegenwoordiger beelden van het schrapen methode (dagen 0-16) gemaakt van dezelfde cultuur schotel, aangedreven op 10x. Opmerking: Visual lijnen geven krassen uit chirurgisch mes (C) Vertegenwoordiger beelden van de trypsine-methode.. (dagen 0-16) gemaakt van dezelfde cultuur schotel, aangedreven op 10x Klik hier voor grotere afbeelding.

Figuur 4
Figuur 4. Immuunfluorescentie beelden van endometrium stromale cellen. (A) Immunofluorescentievan primaire endometrium culturen geïsoleerd via het schrapen methode. Afbeeldingen tonen verlies van cytokeratin tussen passage 2 (P2) en de passage 5 (P5). Promyelocytische leukemie-eiwit (PML) kerneiwit en DAPI kleuring werden als controles. (B) afbeeldingen tonen positieve kleuring voor de mesenchymale merker Vimentin. Beelden tonen ook negatieve kleuring voor E cadherine (CDH1) en Cytokeratin. Kleuring voor DAPI en Promyelocytic leukemie eiwit (PML) werden verstrekt als controles. Klik hier voor grotere afbeelding.

Figuur 5
Figuur 5. Spontane decidualization twee primaire endometriale stromale cellen. (A) Overzicht van de experimentele procedure. (B) Upregulation van prolactine (PRL) enInsuline-like Growth Factor Bindend Eiwit 1 (IGFBP-1) gen expressie in reactie op MPA en cAMP. De resultaten werden gemeten via RT-qPCR, en expressie werd genormaliseerd tot GAPDH. Significantie werd berekend met studenten t-test (P <0,001 *** en P <0,0001 ****). Beide cellijnen werden geïsoleerd met behulp van het schrapen methode. Klik hier voor grotere afbeelding.

Grondverf Sequentie Gloeien Temperatuur (° C) Cycles Analyse
Prolactine (PRL) Forward CATATTGCGATCCTGGAATGAGC 60 40 SYBRGreen
Prolactine (PRL) Reverse TCCTCAATCTCTACAGCTTTGGA 60 40 SYBRGreen
Insuline-achtige groeifactor bindend eiwit 1 (IGFBP1)Vooruit TCCTTTGGGACGCCATCAGTAC 60 40 SYBRGreen
Insuline-achtige groeifactor bindend eiwit 1 (IGFBP1) Reverse GATGTCTCCTGTGCCTTGGCTA 60 40 SYBRGreen
GAPDH Niet gespecificeerd (zie reagenslijst) 60 40 Taqman

Tabel 1. PCR-omstandigheden voor decidualization markers.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Andere groepen hebben beschreven en aangepaste methodologie voor de bereiding van endometriale stromale culturen, waarvan de meeste gebruik collagenase 4,12,13,15-18. In dit manuscript hebben we methodologie en bewijsmateriaal voor twee vereenvoudigde primaire endometriale stromale kweekmethoden, die beide worden gebruikt door ons laboratorium om economische redenen en de gemakkelijke verkrijgbaarheid van trypsine en / of een scheermesje.

Wanneer onze twee methoden vergelijken, zowel met succes genereren levensvatbare primaire culturen. Onze voorkeur methode is de trypsine methode omdat er meestal een hoger rendement met een kleinere steekproefomvang eis. Echter, als voorbereidingstijd is beperkt, het schrapen methode vereist 30 minuten, terwijl plating cellen met behulp van de trypsine-methode duurt meer dan een uur en een half.

Ook opmerkelijk is dat we aantonen deze methoden met hysterectomie monsters in tegenstelling tot endometrium biopsieën. Endometrium biopsies genomen zonder significante binnendringing en vaak kleinere monsters te produceren. Toch moeten de in dit manuscript (vooral de trypsine-methode) beschreven werkwijzen culturen endometriale biopsie verkregen.

Er zijn tal van toepassingen voor primaire endometrium stromale cellen. Het vergelijken van het endometrium stroma culturen van menselijke versus andere zoogdieren kan aanwijzingen op de vragen die zijn eeuwen gedebatteerd over waarom mensen menstrueren bieden. Er zijn andere onontgonnen fysiologie studies die vereisen dat in vitro cultuur. Van bijzonder belang zijn de ontdekkingen die inzichten in de voortplantingscyclus evenementen zoals de bevindingen die zijn gekoppeld epigenetische moleculaire gebeurtenissen aan de functionele gebeurtenissen van de voortplantingscyclus 19,20, 21, en ​​beoordeeld in Ref 11 bieden.

Clinici zouden veel baat hebben bij het bestuderen van het endometrium stroma cultuur en het identificeren van biomarkers in de gevallen van reproductieve aandoeningen en kanker maligniteiten. Tussen 2006 en 2010, werd gemeld dat 7,4 miljoen vrouwen en hun partners die onvruchtbaarheid in de Verenigde Staten 22. Een aanzienlijk percentage van onvruchtbaarheid is te wijten aan het falen van decidualization 23. Bovendien is de relatie tussen endometriale hyperplasie ziekten zoals endometriose en onvruchtbaarheid onlangs beoordeeld. Het vermogen om baarmoeder gynaecologische kankers studeren via in vitro modellen is ook van onschatbare waarde, want hoewel geavanceerde endometrium sarcoom is zeldzaam, kan het dodelijk zijn. Door de oprichting van in vitro primaire culturen, bestuderen we de invloed van de moleculaire gebeurtenissen in verband met de ziekten en kan vermoedelijke klinische toepassingen te genereren.

Concluderend genereren representatieve en effectieve in vivo modellen voor veel van deze toepassingen is moeilijk. Dit maakt de ontwikkeling van invitro primaire endometrium culturen te bestuderen verschillende in vivo functies kritisch. Deze twee endometrium isolatie methoden, "het schrapen methode" en "de trypsine-methode," zal bijdragen aan het steunpunt voor ons begrip van het endometrium fysiologie en pathologie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te openbaring.

Acknowledgements

Wij danken de gezamenlijke inspanningen van dr. Thao Dang en de leden van haar lab voor het gebruik van hun beeldvorming en microscoop apparatuur. We danken ook de biorepository en Tissue Research Facility (BTRF) kern, Jeff Harper, en de bewoners aan de Universiteit van Virginia voor het verstrekken van ons met baarmoeder weefsel. Wij danken Karol Szlachta voor de hulp met schematisch overzicht.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics