Zwei Methoden zur Festlegung von primären humanen Endometrium Stromazellen aus Hysterektomie Proben

* These authors contributed equally
Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aufbau primären Endometrium-Stroma-Zellkultursysteme von Hysterektomie Proben ist eine wertvolle biologische Technik und ein entscheidender Schritt vor der Verfolgung einer Vielzahl von Forschungszielen. Hier beschreiben wir zwei Verfahren verwendet, um stromale Kulturen von chirurgisch entfernten endometrialen Geweben menschlichen Patienten zu etablieren.

Cite this Article

Copy Citation | Download Citations

Jividen, K., Movassagh, M. J., Jazaeri, A., Li, H. Two Methods for Establishing Primary Human Endometrial Stromal Cells from Hysterectomy Specimens. J. Vis. Exp. (87), e51513, doi:10.3791/51513 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Es wurden viele Anstrengungen gewidmet, in vitro Zellkultursystemen zu schaffen. Diese Systeme sind für eine große Anzahl von in-vivo-Prozesse zu modellieren. Zellkultursystemen aus humanen endometrialen Proben sind keine Ausnahme. Die Anwendungen reichen von normalen zyklischen physiologischen Prozesse Endometrium-Krankheiten wie gynäkologischen Krebserkrankungen, Infektionskrankheiten, und der Fortpflanzung. Hier bieten wir zwei Methoden zur Festlegung primären Endometrium Stromazellen aus chirurgisch entfernten Endometrium Hysterektomie Proben. Das erste Verfahren wird als "Schaben-Verfahren" bezeichnet und beinhaltet mechanisches Abkratzen mit chirurgischen oder Rasierklingen, während das zweite Verfahren wird als "die Trypsin-Verfahren". Dieses letztere Verfahren verwendet, das die enzymatische Aktivität von Trypsin, um die Trennung von Zellen und primäre Förderung Zellauswuchs. Wir veranschaulichen die Schritt-für-Schritt-Methode durch digitale Bilder und Mikroskopie. Wir auch provide Beispiele für die Validierung von Endometrium-Stroma-Zelllinien über quantitative Echtzeit-Polymerase-Kettenreaktion (qPCR) und Immunfluoreszenz (IF).

Introduction

Die menschlichen Uterus Korpus besteht aus drei Schichten, die Perimetrium (bzw. Serosa), Myometrium und Endometrium besteht. Unterscheiden jeder dieser Schichten ist ein wichtiger Schritt, um endometriale Zelllinien zu etablieren. Die Perimetrium ist die äußerste Schicht des Uterus und von dünnen, serösen Zellen. Myometrium ist die dicke, mittlere Schicht des Uterus und der glatten Muskelzellen besteht. Das Endometrium wird als die innere Schicht des Uterus identifiziert und enthält Epithel-und Stroma-Zellpopulationen.

Das Endometrium wird weiter in die basalis Schicht, deren Stammzellpopulation wird die Hypothese aufgestellt, um die Schicht functionalis besiedeln etwa alle 28 Tage 1 unterteilt. Die functionalis Schicht der menschlichen Endometrium erfährt wesentliche biochemische und morphologische Veränderungen als Reaktion auf zirkulierende Hormone. Diese Hormone werden aus der Hypophyse und Eierstöcke abgeleitet.

Diekoordiniert die Produktion und Freisetzung von Hormonen zu einer Fortpflanzungszyklus. Der Fortpflanzungszyklus ist entworfen, um das Endometrium für mögliche Einnistung des Embryos Ereignisse vorzubereiten. Beim Menschen wird der Fortpflanzungszyklus als "Menstruationszyklus" bekannt und in drei Phasen unterteilt - proliferative, sekretorischen und Menstruations. Die proliferative Phase beinhaltet die Proliferation des Endometrium functionalis Schicht, während der sekretorischen Phase wird durch functionalis Reifung markiert. Insbesondere extrazelluläre Veränderungen, Sekrete und die zelluläre Differenzierung Signal ein Potential Implantation. Wenn Implantation nicht vor dem Ende des sekretorischen Phase auftreten, wird der functionalis Endometrium-Schicht während des Menstruationsphase zu vergießen. Die Bedeutung der Menstruation und die Ereignisse, die das Ablösen des functionalis Schicht auslösen, werden noch diskutiert. Beim Menschen wurde gestellt, dass die Menstruation ist das Ergebnis einer bestimmten mittleren sekretorischen Phase Differenzierung Ereignis bekanntals "spontane Dezidualisierung" 2. In diesem Manuskript, bieten wir detaillierte Methodik für beide Endometrium-Stroma-Zellisolationsverfahren, und verwenden eine Kombination von Immunfluoreszenz und digitale Bilder, um die Wirksamkeit dieser Ansätze zu demonstrieren. Darüber hinaus wenden wir eine häufig in vitro-Modell der spontanen Dezidualisierung zur Endometrium-Stroma-Zellisolierung bestätigen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hysterektomie Proben in diesem Manuskript verwendet wurden, in Übereinstimmung mit einer von der Universität IRB-zugelassene Ethik-Protokoll nummeriert IRB-HSR # 14424 gesammelt.

1. Probennahme von Clinical Quelle

  1. Erhalten Regierung und Institutionen auf der Grundlage ethischer Richtlinien und Genehmigungsunterlagen vor Beginn.
  2. Führen Sie alle Schritte unter sterilen Bedingungen.
  3. Bewahren Patienten stamm Gewebe in Medien (RPMI oder DMEM / hohe Glucose) in einem 50 ml-Röhrchen bei 4 ° C, wenn die Probe nicht in Kultur sofort verarbeitet werden. Proben können in diesem Zustand für maximal 24 Stunden gelagert werden.
  4. Dreimal waschen Gewebeprobe mit 1X steriler Phosphat-gepufferter Salzlösung (PBS) gewaschen und die Lösung verwerfen zwischen den Waschgängen.

2. Herstellung von primären Zelllinien mit Hilfe der Methode Scraping

  1. Hinzufügen 4-10 ml Wachstumsmedium (RPMI-oder DMEM / Hoch Glucose mit 10% fötalem Rinderserum und 1% Penicillin-Streptomyces ergänztCIN), um Gewebe und fügen Fungizone (0,25 &mgr; g / ml Endkonzentration) für 30 min.
  2. Entsorgen Sie die Wachstumsmedien.
  3. Zweimal waschen Gewebe mit 1X PBS.
  4. Legen Sie das Gewebe auf einer 6 cm Zellkulturplatte zwischen Myometrium und Endometrium Schichten (siehe Fig. 2A-2C für die weitere Beschreibung) unterscheiden. Trennen Sie die Gebärmutterschleimhaut.
  5. Mit einem Skalpell oder einer Rasierklinge, durchschneiden das Gewebe in kleine Stücke, während Kratzen auf den 6 cm Zellkulturschale. Diese Kratzer erleichtern die Befestigung der neuen primären Endometrium-Zellen. Verglichen mit dem Trypsin-Verfahren wird mehr Gewebe benötigt (siehe Abbildung 2D für eine Näherung).
  6. Sanft, 2 ml Wachstumsmedium zerkratzt Schale (Gewebefragmente sichtbar und im Idealfall aus dem Kratzen Bewegung immobilisiert sein).
  7. Übertragen Sie die Platte (n) zu einem bestimmten Zellkulturbrutschrank (37 ° C und 5% CO 2). Bestimmen Sie einen Ort für primäre Zelllinien, weg von othäh Zellkulturschalen. Primärkulturen sind empfindlicher gegenüber Infektion und Kontamination.
  8. Untersuchen Sie die Zellen unter einem Lichtmikroskop täglich. Kleine Populationen von Zellen sollten durch zwei oder drei Tage um von den geschnittenen Gewebe entstehen (siehe Fig. 3B).
  9. Um Kulturen zu erhalten, vorsichtig waschen mit 1X PBS und fügen Sie frisches Wachstumsmedium (2 ml) alle drei Tage. Wenn Proliferationsrate zunimmt, können zusätzliche Wachstumsmedien (3-4 ml) zu der 6 cm-Kulturplatte (n) hinzugefügt werden.
    Hinweis: Während des Wasch-und Medienwechsel, werden Gewebestücke wahrscheinlich abgesaugt werden. Dies beeinflusst nicht das Wachstum von adhärenten Zellen. Gewebestücke sollten durch den nachfolgenden Schritt (2.10) angesaugt werden als neue Kolonien sind unwahrscheinlich, nach einer Woche entstehen.
  10. Wenn die 6 cm Platte etwa 75-80% konfluent (siehe Abbildung 3B), Durchgang mit 0,05% Trypsin. Primäre Zellen nicht unbegrenzt agiert werden - einfrieren unten eine Platte von Zellen, sobald zwei oder drei Platten sind maintained. Wenn mehrere Durchgänge erforderlich sind, folgen einer Immortalisierung Protokoll (in Ref. 3 reviewed).

3. Herstellung von primären Zelllinien mit dem Trypsin-Methode

  1. Eine kleine Stück Endometrium (siehe Fig. 2D eine Annäherung) in 2 ml 0,25% Trypsin mit Kanamycin (0,03 mg / ml Endkonzentration) ergänzt.
  2. Inkubieren Gewebe bei 37 ° C auf rotierenden Plattform für 30 min.
  3. Kurz vortexen das Gewebe.
  4. Zentrifugieren Sie die Probe bei 200-400 g für 2 min und den Überstand verwerfen.
  5. Fügen Sie frisches Trypsin und Kanamycin.
  6. Inkubieren des Gewebes bei 37 ° C unter Rotation für eine Stunde.
  7. Mischen Sie das Gewebe für 5-10 sek.
  8. Hinzufügen von 2 ml Wachstumsmedium (mit 10% fötalem Rinderserum und 1% Penicillin-Streptomycin), um das Trypsin zu deaktivieren.
  9. Centrifuge Zellen bei 200-400 g für 2-3 min.
  10. Überstand verwerfen und 2 ml wachsenth Medien zu den pelletierten Zellen.
  11. Platte auf eine 6 cm Zellkulturschale. Kratzen Sie die Platte wie in Schritt 2.5 von Herstellung von primären Zelllinien mit Hilfe des Scraping-Methode ist nicht notwendig, aber erhöht die Bindung und Auswuchs der Primärkulturen.
  12. Überwachung der Zellen unter einem Lichtmikroskop täglich. Die Zellen sind in der Regel sichtbar unter einem Lichtmikroskop nach 24-48 h (siehe Abbildung 3C).
  13. Um die Kulturen zu erhalten, die Zellen zu überwachen und ändern Medien alle 2-3 Tage, wie in Schritt 2.9.
  14. Um Durchgang die Zellen, verwenden Sie 0,05% oder 0,25% Trypsin, wenn die Zellen 75-80% Konfluenz erreichen (siehe Abbildung 3C).

4. Speichern Extra-Tissue für Analyse (Snap-Freezing und Formalin-Fixierung)

  1. Zweimal waschen Probe mit 1X PBS.
  2. Saugen Sie so viel Flüssigkeit wie möglich.
  3. Für Snap-Freezing, legen Endometrium-Gewebe-Probe in einem 1,7-Zentrifugenröhrchen (siehe Abbildungen 2F und 2G). Platzieren Sie die 1,7Zentrifugenröhrchen in flüssigen Stickstoff für 10 Sek. oder bis es ersichtlich, dass das Gewebe nach unten eingefroren.
    Hinweis: Achten Sie darauf, nicht direkt berühren flüssigem Stickstoff bei der Herstellung von Proben. Die Proben können bei -80 ° C bis zur weiteren Verarbeitung oder Analyse gespeichert werden.
  4. Für Formalin-Fixierung, schneiden Sie ein kleines Stück von Endometrium-Gewebe (siehe Abbildung 2H), und tauchen in 10% gepuffertem Formalin Zink. Nach 24 Stunden verwerfen Formalin und fügen Sie 70% Ethanol, um Gewebeproben bis zur Weiterverarbeitung.

5. Immunfluoreszenz (IF)

  1. Zellfixierung
    1. Vorbereitung der Zellen auf einem Objektträger oder Kulturplatte.
    2. Sanft waschen Sie die Zellen mit 1X PBS.
    3. Hinzufügen vorgekühlte (4 ° C), Methanol und Aceton (Verhältnis 1:1 gemischt) für 5 min.
    4. Air die Folie trocknen, bevor Sie fortfahren. Folie kann bei 4 ° C für 1-2 Wochen bei Bedarf gespeichert werden.
  2. Verarbeitung IF
    1. Rehydrate Zellen mit 1X PBS für 10 min. Für die following Schritte 1-6, führen alle Waschungen und Inkubation auf einer rotierenden Plattform.
    2. Block mit 1X PBS, ergänzt mit 1% Rinderserumalbumin (BSA) und 1% Serum artspezifisch (Quelle 2. Antikörper) für 30 min bei Raumtemperatur (RT).
    3. Inkubation in primären Antikörper (siehe Empfehlungen der Hersteller für die Antikörper-Verdünnungen). Beziehen sich auf Materialien für die spezifischen Antikörper. Verdünnen Sie die primären Antikörper in Blockierungspuffer frisch wie in Schritt 5.2.2. Diese Inkubation für mindestens 2 Stunden bei Raumtemperatur oder über Nacht bei 4 ° C durchgeführt werden
    4. 3 x waschen mit 1X PBS für jeweils 5 min.
    5. Inkubation in Sekundärantikörper (siehe Empfehlungen der Hersteller für die Antikörper-Verdünnungen). Verdünnen Sie die sekundären Antikörper in Blockierungspuffer frisch wie in Schritt 5.2.2. Auf Foto-Bleich verhindern, ist es wichtig, diese und die nachfolgenden Schritte in der Abwesenheit von Licht durchzuführen.
    6. 3 x waschen mit 1X PBS für jeweils 5 min.
    7. Thoroughly trocknen die Dias.
    8. In Medien-und Montage DAPI Gegenfärbung Lösung.
    9. Bewerben Deckglas und die Ränder mit Dichtstoff (e). Folien können bei 4 ° C im Dunkeln für bis zu 2 Wochen gelagert werden.

6. RNA-Extraktion

  1. Tablette 1 x 10 7 Zellen durch Zentrifugation. Alle Materialien und Reagenzien in diesem Protokoll sollten frei RNase werden.
  2. Lysieren Zellen in 1 ml Trizol-Reagenz, und Inkubieren der homogenisierten Proben für 10 min bei Raumtemperatur, um die Dissoziation Nukleoproteinkomplexen abzuschließen.
  3. In 200 ul Chloroform pro 1 ml TRIZOL. Kräftiges Schütteln per Hand für 15 Sekunden und Inkubation für 2-3 min bei RT.
  4. Zentrifuge bei maximaler Geschwindigkeit (15.000 × g) für 15 min bei 4 ° C. Drei Schichten führen wird.
  5. Übertragen Sie die obere wässrige Phase in ein neues Mikrozentrifugenröhrchen. 1 ul Glykogen, um die RNA-Ausbeute zu erhöhen; allerdings ist dieser Schritt nur erforderlich, wenn eine kleineRNA-Menge, zu rechnen.
  6. 0,5 ml Isopropyl-Alkohol zu der wässrigen Schicht und invertieren die Proben 3-5 mal. Proben Inkubation bei RT für 10 min. Um die Ausbeute zu erhöhen, können die Proben in -20 ° C oder -80 ° C für 30 min gebracht werden.
  7. Zentrifuge bei maximaler Geschwindigkeit für 10 min bei 4 ° C.
  8. An diesem Punkt sollte eine kleine RNA-Pellet sichtbar. Überstand verwerfen.
  9. Mit 1 ml 75% Ethanol waschen der RNA.
  10. Zentrifugieren bei maximaler Geschwindigkeit für 5 min und den Überstand verwerfen. Proben noch einmal anorganischen Verunreinigungen zu befreien gewaschen werden, aber dieser Schritt ist nicht notwendig.
  11. Kurz gesagt, trocknen die RNA-Pellet bis zur RNA-Pellet trocken ist (dauert in der Regel 7-10 min).
    Hinweis: Ein zusätzlicher Schritt kann verwendet werden, um anorganische Stoffe zu verringern und verringern die Trocknungszeit werden. Nach Verwerfen des Überstands aus der Ethanolwaschschleuder Proben bei maximaler Geschwindigkeit für eine zusätzliche Minute und Restflüssigkeit absaugen. Achten Sie darauf, Pellet abzusaugen.
  12. Auflösen RNA in RNase-freiem Wasser, je nach der Größe der RNA-Pellet. Volumes liegen typischerweise im Bereich von 10 bis 50 ul.
  13. Proben inkubieren bei 55 ° C für 10 min und Messen der Konzentration von RNA.
  14. Proben bei -20 ° C bis zur Weiterverarbeitung.

7. Reverse Transkription

  1. Bringen Sie die Proben-RNA (1-3 &mgr; g) auf ein Volumen von 9 &mgr; l mit H 2 O.
  2. Wärme RNA auf 70 ° C für 10 min.
  3. Um eine AMV Mastermix erzeugen, kombiniert die folgenden Reagenzien: 5 &mgr; l dNTP (Arbeitskonzentration von 50 &mgr; M), 5 &mgr; l N6-DNA-Oligos (Arbeitskonzentration von 80 uM), 5 ul 5X AMV-Puffer und 1 &mgr; l AMV . Dieser Master-Mix-Lösung wird eine Probe pro ausgelegt.
  4. In 16 ul des Master-Mix zum beheizten RNA. Das endgültige Reaktionsvolumen 25 ul Reaktion sein.
  5. Mit den folgenden PCR-Bedingungen für die reverse Transkription: (Stufe 1) 42 ° C für 90 min, (StaGe 2) 95 ° C für 5 min, und (3. Stufe) 4 ° C bis zur Weiterverarbeitung.

8. Real Time PCR

  1. PCR-Reaktionen durchzuführen unter Verwendung der Primer, Glühtemperaturen Zykluszahlen und Reagenzien in Tabelle 1 angegeben.
    Hinweis: Es ist ideal, um die Anweisungen des Herstellers folgen, wenn mit Hilfe der PCR-Reagenzien (siehe Firmen und Katalognummern in Materials).

9. In vitro Dezidualisierung Protocol (aus Ref. 4 und 5 Abgeleitet)

  1. Platte Endometrium-Zellen.
  2. Wachsen bis zu einer Konfluenz von 75-85%.
  3. Nachdem die Zellen konfluent werden, einmal zu waschen mit 1X PBS.
  4. Schnell, fügen hormonfreien Medien (Phenol RPMI, ergänzt mit 5% Kohlestreifen FBS und 1% Penicillin-Streptomycin).
  5. Nach 24 Stunden, fügen Sie mit Medroxyprogesteronacetat (MPA), ergänzt mit einer endgültigen Konzentration von 1 uM und 8-bromoadenosine 3 hormonfreien Medien ', 5'-Monophosphat (cAMP) in einer Endkonzentration von 0,5 mM.
  6. Nach mindestens 48 Stunden, stoppen Sie die Reaktion und speichern Sie die Platte (n) zur weiteren Verarbeitung.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Wie im Abschnitt Protokoll betont, sicher sein, alle Methoden von der Regierung, institutionellen und ethischen Richtlinien bei der Handhabung und Herstellung von humanem Gewebe durchzuführen.

In diesem Manuskript enthalten ist eine Darstellung der allgemeinen Arbeitsabläufe der "Schaben-Methode" (Fig. 1A) und "der Trypsin-Methode" (1B) verwendet werden, um primäre Kulturen Endometrium herzustellen. (- 3. Siehe Teile 1.) Diese Methoden sind ausführlich in dem Protokoll Abschnitt beschrieben. Beide Methoden belegen das Wachstum von primären Kulturen endometrial erfolgreich. Der Vorteil zum "Schaben-Methode" ist die verkürzte Vorbereitungszeit; jedoch ist die Zeit, die für lebensfähige Zellen zu beobachten in der Regel 2 - 4x länger im Vergleich zu "Trypsin-Verfahren".

Vorausgesetzt sind digitale Bilder der von der Gewebebeschaffung erhielt ersten menschlichen Gewebe. Die Gebärmutter-Schichten können durch die unterschieden werdenGrobheit der Schicht, dh die Myometrium ist dick und muskulös und das Endometrium ist dünn und nachgiebiger. Wir haben die dicken, glatten Muskulatur (Myometrium) weiß hervorgehoben und erläutert die Endometrium-Schicht von Interesse in schwarz aus zwei verschiedenen Proben Hysterektomie (2A und 2B). In 2C werden die Gewebe mit dem Myometrium nach oben, während das Endometrium nach unten positioniert orientiert. Die dünne Schicht perimetrial wurde operativ reseziert und nicht in diesen Bildern hervorgehoben. Es ist auch wichtig zu beachten, dass die Größe der endometrialen Schicht in dieser digitalen 2-dimensionalen Bildern im Vergleich zu dem Myometrium der tatsächliche 3-dimensionalen Schicht sehr dünn ist falsch.

Schneiden Sie die entsprechende Gewebegröße ist sowohl für die "Scraping Verfahren" und "Trypsin-Methode." In 2D, werden geeignete Größen für jede Methode über dem jeweiligen Probe bezeichnet. Mit einem 0.5x00,5 x0.5 cm Stück für "Trypsin-Methode" [links] ist ausreichend für eine Kultur. Der Vertreter Ausgangsgewebe für "das Kratzen Methode" [rechts] umfasst alle Uterusschichten. Das Endprodukt für den "Schaben-Verfahren" ist in Fig. 2E dargestellt, und es wird empfohlen, daß wenigstens 1x1x1 cm des endometrialen Gewebes verwendet werden, um lebensfähige Kulturen herzustellen. Voraussetzung hierfür viel Gewebeprobe ist ein Nachteil der "Methode der Schaben."

Verbleibende Gewebe wird häufig auf zahlreiche Arten, einschließlich Protein und RNA-Analysen verwendet. Zur Erhaltung der Gewebequalität zu gewährleisten, ist es wichtig, einen "Schnapp Einfrieren" Verfahren, wie im Protokoll Abschnitt verwenden (siehe 4.).. Dieses Verfahren ist ebenfalls in Fig. 2F und 2G veranschaulicht. Speichern von zusätzlichen Gewebe durch Formalin-Fixierung ist auch eine gemeinsame Praxis der Pathologen und Forscher. Vorbereiten Gewebe für Formalin-Fixierung wird im Protokoll beschriebenen 2H dargestellt.

Die Lichtmikroskopie ist wichtig für die Überwachung von primären Endometrium-Kulturen. Individuelle Endometrium Stromazellen sollte Fibroblasten-Morphologie (3A) aufweisen. "Die Schaben-Methode" erzeugt in der Regel Cluster von frühen Schwellen Zellen, vor allem entlang Skalpell-induzierte Kratzer (3B, Tag 2). "Das Trypsin-Methode" erzeugt sowohl Cluster-und verteilte Zellwachstumsmuster (3C, Tag 4). Wir haben mehrere repräsentative Bilder von der anfänglichen Plattierung (Tag 0) mit dem ersten Durchgang jedes Verfahren (3B und 3C) enthalten.

Viele Gewebe werden durch ihre Expression von gewebespezifischen Markern, wie Aktin glatter Muskeln (SMA) für glatte Muskulatur, CD34 für Immun Stammzellen usw. definiert, während Gen-und Proteinexpressionsversuchen wurden für die Endometrium 6-11, Bad durchgeführtdometrial Stromazellen spezifischer Marker noch nicht entdeckt zu werden. Stattdessen Forscher allgemein beurteilen Endometrium-Stroma Reinheit durch Messung von potenziellen Markern Zellverunreinigungen. So werden beispielsweise verwendet werden, um Marker Cytokeratin epithelialen Bevölkerung zu zeigen. Jedoch weniger ein Problem ist, weil die Einrichtung und Aufrechterhaltung Endometrium Epithelien sind schwierig und in der Regel gegen (Ref 12 und 4A) ausgewählt. Falls die Proben während der Schwangerschaft, positive Expression von HLA-A erhalten waren,-B,-C zeigt, Keim, Trophoblastenzellen 13. Auf der anderen Seite, wie andere mesenchymalen Fibroblasten-, Endometrium-Stroma-Zellen exprimieren Vimentin (CDH1). Wir zeigen, mit Immunfluoreszenz, die Expression von Vimentin und das Fehlen von Cytokeratin-und E-Cadherin (CDH1) in unseren etablierten endometrialen Stromazellen (4B).

Schließlich bieten wir funktionelle Nachweis der primären Endometrium-Kultur über ein in vitro spontan Dezidualisierung-Assay. Diese Methode wurde von Ref. 4 und 5 angepaßt und umfaßt die Behandlung von Kulturen, die mit einer Kombination von Medroxyprogesteronacetat (MPA) und 8 - bromoadenosine 3 ', 5'-cyclischem Monophosphat (cAMP) (in 9 beschriebenen In-vitro-Protokoll decidualization und modelliert. in Fig. 5A). In Anwesenheit von MPA und cAMP-, Endometrium-Stroma-Zellen zeigen signifikant verändert Genexpressionsprofile (in Ref. 14 überprüft). Die häufig veröffentlicht spontane Dezidualisierung Marker sind Prolaktin (PRL) und Insulin-like Growth Factor Binding Protein 1 (IGFBP1) (in Ref. 14 prüft). Die Antwort dieser beiden Gene zu MPA und cAMP sind starke Indikatoren sowohl spontane Dezidualisierung und erfolgreiche Einrichtung eines Endometrium-Stroma-Kultur. Wir demonstrieren dies in 5B.


Abbildung 1. Schematische Darstellung der zwei Haupt Endometrium-Isolationsmethoden. (A) Die Schritte 2,1-2,10 der Schaben-Methode in einem Organigramm dargestellt. (B) Schritte 3,1-3,14 der Trypsin-Verfahren in einem Organigramm dargestellt. Klicken Sie hier für eine größere Ansicht.

Figur 2
Abbildung 2. Verarbeitung Gebärmuttergewebe. (AC) Klinische Gebärmutter Proben von zwei weiblichen Patienten. A & C werden von Patient 1 abgeleitet und B wird von Patient 2 abgeleitet. Chirurgisch entfernten Uterusgewebe (links) und highlighted Gebärmutter Schichten (rechts). (A & B) Das Myometrium ist in weiß und dem Endometrium in schwarz eingekreist. (C) Das Myometrium ist vor der Kamera. (D) Erste repräsentative Endometrium Stichprobengrößen für beide Isolationsmethoden angegeben sind. Die Trypsin-Verfahren erfordert reine Endometrium vor der Zugabe der Trypsin während die Schaben Verfahren kann die gesamte Gebärmutterproben verwendet. (E) Beispiel des verarbeiteten Endometrium Probe des Abschabverfahren. (F & G) Bild verbleibenden Uterusgewebe ist für Snap hergestellt Einfrieren. Gezeigt wird ein Labor hergestellten Metallbehälter für diese Methode eingesetzt. (H) Formalin-Fixierung von Endometrium-Probe. Klicken Sie hier für eine größere Ansicht.

Fig. 3 Abbildung 3. Lichtmikroskopische Bilder von primären Endometrium-Kulturen. . (A) Repräsentative Bilder von Endometrium-Stroma-Zellkulturen an verschiedenen Kräfte und Konfluenz genommen (B) Repräsentative Bilder der Schaben-Methode (Tage 0-16) aus dem gleichen Kulturschale, angetrieben mit 10-facher genommen. Hinweis: Visuelle Linien zeigen Kratzer von chirurgischen Klinge (C) Repräsentative Bilder der Trypsin-Methode.. (Tage 0-16) des gleichen Kulturschale, angetrieben mit 10-facher genommen Klicken Sie hier für eine größere Ansicht.

Fig. 4
4. Immun Bilder von endometrialen Stroma-Zellen. (A) Immunfluoreszenzvon Primärkulturen isoliert Endometrium über die Schaben-Methode. Bilder zeigen Verlust Cytokeratin zwischen Passage 2 (P2) und der Durchgang 5 (P5). Promyelozytenleukämie Protein (PML) Kernprotein und DAPI-Färbung wurden als Kontrollen verwendet. (B) Die Bilder zeigen eine positive Färbung für den mesenchymalen Marker Vimentin. Bilder zeigen auch, negative Färbung für E Cadherin (CDH1) und Cytokeratin. Die Färbung für DAPI und Promyelozytenleukämie Protein (PML) wurden als Kontrollen vorgesehen. Klicken Sie hier für eine größere Ansicht.

Figur 5
Abbildung 5. Spontane Dezidualisierung von zwei primären Endometrium Stromazellen. (A) Überblick über experimentelle Verfahren. (B) Hochregulation von Prolaktin (PRL) undInsulin-like Growth Factor Binding Protein 1 (IGFBP1) Genexpression in Reaktion auf MPA und cAMP. Die Ergebnisse wurden mittels RT-qPCR gemessen und Expression wurde auf GAPDH normalisiert. Signifikanz wurde mittels t-Test (p <0,001 und *** P <0,0001 ****) berechnet. Beide Zelllinien wurden mit dem Kratzen Verfahren isoliert. Klicken Sie hier für eine größere Ansicht.

Grundierung Folge Annealing-Temperatur (° C) Cycles Probe
Prolaktin (PRL) Zukunfts CATATTGCGATCCTGGAATGAGC 60 40 SybrGreen
Prolaktin (PRL) Rück TCCTCAATCTCTACAGCTTTGGA 60 40 SybrGreen
Insulin-like growth factor binding protein 1 (IGFBP1)Vorwärts TCCTTTGGGACGCCATCAGTAC 60 40 SybrGreen
Insulin-like growth factor binding protein 1 (IGFBP1) Rück GATGTCTCCTGTGCCTTGGCTA 60 40 SybrGreen
GAPDH Keine Angabe (siehe Reagenzienliste) 60 40 Taqman

Tabelle 1. PCR-Bedingungen für Dezidualisierung Marker.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Andere Gruppen sind für die Herstellung von Endometrium-Stromazellen Kulturen, von denen die meisten zu nutzen Kollagenase 4,12,13,15-18 beschriebenen Methodik und angepasst. In diesem Manuskript haben wir Methoden und Beweise für zwei vereinfachte primären Endometrium-Stroma-Kulturmethoden, die beide von unserem Labor aus wirtschaftlichen Gründen und der günstigen Verfügbarkeit von Trypsin und / oder einer Rasierklinge verwendet werden, vorausgesetzt.

Beim Vergleich unserer zwei Methoden, die beide erfolgreich lebensfähigen Primärkulturen zu erzeugen. Unser bevorzugtes Verfahren ist die Trypsin Verfahren gibt es typischerweise eine höhere Ausbeute mit einer kleineren Probenvolumens. Wenn die Vorbereitungszeit ist begrenzt, erfordert jedoch das Kratzen Verfahren 30 Minuten wohinBeschichtung Zellen unter Verwendung des Trypsin-Verfahren dauert mehr als eine Stunde und eine Hälfte.

Bemerkenswert ist auch, dass wir zeigen, diese Methoden mit Hysterektomie Proben im Gegensatz zu Endometrium-Biopsien. Endometriumkarzinom biopsies werden ohne signifikante Einbruch aufgenommen und sind in der Regel kleinere Exemplare zu produzieren. Dennoch sollten die in dieser Handschrift (vor allem die Trypsin-Methode) beschriebenen Methoden Kulturen aus Endometriumbiopsien ergeben.

Es gibt zahlreiche Anwendungen für die Primär endometrialen Stroma-Zellen. Vergleicht Endometrium-Stroma-Kulturen aus menschlichen Vergleich zu anderen Säugetieren kann Hinweise liefern auf die Fragen, die seit Jahrhunderten darüber, warum Menschen menstruieren diskutiert wurden. Es gibt andere Studien, die unerforschten Physiologie in-vitro-Kultur erfordern. Von besonderem Interesse sind die Entdeckungen, die Einblicke in die Fortpflanzungszyklus Ereignisse wie die Erkenntnisse, die epigenetische molekularen Ereignisse verknüpft haben, um die funktionellen Ereignisse des Reproduktionszyklus 19,20, 21 und 11 in Ref überprüft werden.

Ärzte würden stark von Endometrium-Stroma-Studium Kultur-und Biomarker-Identifizierung profitierens in den Instanzen von Fortpflanzungsstörungen und Krebs Tumoren. Zwischen 2006 und 2010 wurde berichtet, dass 7,4 Millionen Frauen und ihre Partner verwendet Unfruchtbarkeit Dienstleistungen in den Vereinigten Staaten 22. Eine signifikante Prozent der Unfruchtbarkeit ist wegen des Ausfalls der Dezidualisierung 23. Darüber hinaus wird die Beziehung zwischen endometrialen Hyperplasie Erkrankungen wie Endometriose und zu Unfruchtbarkeit kurzem geprüft. Die Fähigkeit, uterine gynäkologischen Krebserkrankungen durch in vitro-Modellierung zu studieren, ist auch von unschätzbarem Wert, denn obwohl fortgeschrittenen Endometrium-Sarkom ist selten, kann es tödlich sein. Mit der Gründung in vitro Primärkulturen untersuchen wir den Einfluss der molekularen Ereignisse, die mit den Krankheiten verbunden und kann vermeintlichen klinische Anwendungen zu generieren.

Abschließend Erzeugen repräsentativer und wirksamer in vivo-Modelle für viele dieser Anwendungen ist schwierig. Dies macht die Entwicklung invitro Primär Endometrium Kulturen zu studieren, mehrere Funktionen in vivo kritisch. Diese beiden Endometrium-Isolationsverfahren ", das Kratzen Verfahren" und "die Trypsin-Methode" wird dazu beitragen, das Standbein für unser Verständnis von Endometrium-Physiologie und Pathologie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu Veröffentlichung.

Acknowledgements

Wir danken den gemeinsamen Bemühungen von Dr. Thao Dang und Mitglieder ihr Labor für die Nutzung ihrer Bild und Mikroskoptechnik. Wir danken auch der Biobanken und Tissue Research Facility (BTRF) Kern, Jeff Harper, und die Bewohner an der Universität von Virginia für uns mit Gebärmuttergewebe. Wir danken Karol Szlachta für die Hilfe bei Schematische Übersicht.

Materials

Name Company Catalog Number Comments
0.25 Trypsin or 0.05% Trypsin  Hyclone SH3023602 or SH30004202
1.7 micro Centrifuge Tube   Genesee Scientific 22-272A
1 µl, 20 µl, 200 ml and 1,000 µl Pipette   Genesee Scientific 24-401,24-402, 24-412, 24-430
15 ml Conical Tube  Hyclone 339650
50 ml Conical Tube  Hyclone 339652
6 cm Cell Culture Dish  Thermo scientific 12-556-002
8 well Chambers  Thermo Scientific AB-4162
Acetate  Fisher scientific C4-100
AMV RT Enzyme/Buffer  Bio Labs M077L
Bovine Serum Albumin (BSA)  Fisher Scientific BP-1605-100
Buffered Zinc Formalin  Thermo 59201ZF
Charcoal strip FBS  Fisher NC9019735
Chloroform  Fisher Scientific BP1145-1
Cover slip  Fisher Brand 12-544D
Cyclic AMP (cAMP)  Sigma B7880
DMEM/High Glucose  Hyclone SH30243FS
dNTP  Bioline BIO-39025
Donkey Anti Goat -TRITC  Santa Cruz SC-3855
Donkey Serum  Jackson’s lab 017-000-002
E Cadherin Antibody   Epitomics 1702-1
Ethanol  Fisher Scientific BP2818-1
Fetal Bovine Serum (FBS)  Fisher Scientific 03-600-511
Fungizone Amphotericin B  Gibco 15290-018
GAPDH Probe  Life Technologies HS99999905
Glycogen  5Prime 2301440
Goat Anti Mouse - FITC  Jackson’s Lab 115-096-003
Isopropanol  Fisher Scientific BP2618-1
Kanamycin   Fisher Scientific BP906-5
Medroxyprogesterone acetate (MPA)  Sigma M1629
MeOH (Methanol)  Fisher Scientific A4-08-1
Mounting Media (w/DAPI)  Vector Labratories H-1500
N6 DNA Oligos  Invitrogen
Number 15 Scraper   BD 371615
Pan Cytokeratin  Mouse mAB  Cell Signaling 4545
PBS (phosphate buffered saline)  Fisher Scientific BP-399-4
Penicillin-Streptomycin Glutamine Solution 100X   Hyclone SV30082.01
PML Anti Goat Anti body  Santa Cruz SC-9862
Primer(s)  Eurofins
RPMI  Hyclone SH30027FS
RPMI (Phenol free)  Gibco 11835
Sybr Green   Thermo Scientific AB-4162
Taqman  Thermo AB-4138
Trizol  Life Technologies 15596018
Vimentin Antibody  Epitomics 4211-1

DOWNLOAD MATERIALS LIST

References

  1. Heller, D. in The endometrium: a clinicopathologic approach. Heller, D. 56-75 (1994).
  2. Emera, D., Romero, R., Wagner, G. The evolution of menstruation: a new model for genetic assimilation: explaining molecular origins of maternal responses to fetal invasiveness. Bioessays. 34, 26-35 (2011).
  3. Gudjonsson, T., Villadsen, R., Ronnov-Jessen, L., Petersen, O. W. Immortalization protocols used in cell culture models of human breast morphogenesis. Cell Mol Life Sci. 61, 2523-2534 (2004).
  4. Brosens, J. J., Hayashi, N., White, J. O. Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology. 140, 4809-4820 (1999).
  5. Jones, M. C., et al. Regulation of the SUMO pathway sensitizes differentiating human endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A. 103, 16272-16277 (2006).
  6. Salamonsen, L. A., et al. Proteomics of the human endometrium and uterine fluid: a pathway to biomarker discovery. Fertil Steril. 99, 1086-1092 (2013).
  7. Haouzi, D., Dechaud, H., Assou, S., De Vos, J., Hamamah, S. Insights into human endometrial receptivity from transcriptomic and proteomic data. Reprod Biomed Online. 24, 23-34 (2012).
  8. Chen, J. I., et al. Proteomic characterization of midproliferative and midsecretory human endometrium. J Proteome Res. 8, 2032-2044 (2009).
  9. Talbi, S., et al. Molecular phenotyping of human endometrium distinguishes menstrual cycle phases and underlying biological processes in normo-ovulatory women. Endocrinology. 147, 1097-1121 (2006).
  10. Punyadeera, C., et al. Oestrogen-modulated gene expression in the human endometrium. Cell Mol Life Sci. 62, 239-250 (2005).
  11. Ponnampalam, A. P., Weston, G. C., Susil, B., Rogers, P. A. Molecular profiling of human endometrium during the menstrual cycle. Aust N Z J Obstet Gynaecol. 46, 154-158 (2006).
  12. Zhang, L., Rees, M. C., Bicknell, R. The isolation and long-term culture of normal human endometrial epithelium and stroma. Expression of mRNAs for angiogenic polypeptides basally and on oestrogen and progesterone challenges. J Cell Sci. 108, (1), 323-331 (1995).
  13. Richards, R. G., Brar, A. K., Frank, G. R., Hartman, S. M., Jikihara, H. Fibroblast cells from term human decidua closely resemble endometrial stromal cells: induction of prolactin and insulin-like growth factor binding protein-1 expression). Biol Reprod. 52, 609-615 (1995).
  14. Gellersen, B., Brosens, J. Cyclic AMP and progesterone receptor cross-talk in human endometrium: a decidualizing affair. J Endocrinol. 178, 357-372 (2003).
  15. Marsh, M. M., Hampton, A. L., Riley, S. C., Findlay, J. K., Salamonsen, L. A. Production and characterization of endothelin released by human endometrial epithelial cells in culture. J Clin Endocrinol Metab. 79, 1625-1631 (1994).
  16. Siegfried, J. M., Nelson, K. G., Martin, J. L., Kaufman, D. G. Histochemical identification of cultured cells from human endometrium. In Vitro. 20, 25-32 (1984).
  17. Rawdanowicz, T. J., Hampton, A. L., Nagase, H., Woolley, D. E., Salamonsen, L. A. Matrix metalloproteinase production by cultured human endometrial stromal cells: identification of interstitial collagenase, gelatinase-A, gelatinase-B, and stromelysin-1 and their differential regulation by interleukin-1 alpha and tumor necrosis factor-alpha. J Clin Endocrinol Metab. 79, 530-536 (1994).
  18. Dimitriadis, E., Robb, L., Salamonsen, L. A. Interleukin 11 advances progesterone-induced decidualization of human endometrial stromal cells. Mol Hum Reprod. 8, 636-643 (2002).
  19. Sakai, N., et al. Involvement of histone acetylation in ovarian steroid-induced decidualization of human endometrial stromal cells. J Biol Chem. 278, 16675-16682 (2003).
  20. Logan, P. C., Ponnampalam, A. P., Steiner, M., Mitchell, M. D. Effect of cyclic AMP and estrogen/progesterone on the transcription of DNA methyltransferases during the decidualization of human endometrial stromal cells. Mol Hum Reprod. 19, 302-312 (2013).
  21. Tamura, I., et al. Induction of IGFBP-1 expression by cAMP is associated with histone acetylation status of the promoter region in human endometrial stromal cells. Endocrinology. 153, 5612-5621 (2012).
  22. American Society for Reproductive Medicine: Quick facts about infertility. Available from: http://www.asrm.org/detail.aspx?id=2322 (2013).
  23. Salker, M., et al. Natural selection of human embryos: impaired decidualization of endometrium disables embryo-maternal interactions and causes recurrent pregnancy loss. PLoS One. 5, (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics