छोटे आरएनए प्रजाति के उत्तरी ब्लाट पता लगाने में बढ़ी

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस प्रकाशन का उद्देश्य कल्पना और ड्रोसोफिला से निकाले शाही सेना पर एक बढ़ाया उत्तरी ब्लाट प्रोटोकॉल का ऑपरेटिव कदम पर चर्चा भ्रूण कोशिकाओं और ऊतकों मेलानोगास्टर है. इस प्रोटोकॉल छोटे आरएनए प्रजातियों के कुशल पता लगाने के लिए विशेष रूप से उपयोगी है.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

पिछले दशकों आरएनए स्तर पर जीन अभिव्यक्ति नियंत्रण तंत्र के आसपास वैज्ञानिक ब्याज के विस्फोट देखा है. आणविक जीव विज्ञान की इस शाखा को काफी बाद के ट्रांसक्रिप्शनल नियमन में प्रमुख खिलाड़ी के रूप में RNAs noncoding की खोज के द्वारा ईंधन की गई है. इस तरह के एक क्रांतिकारी नजरिए उच्च throughput स्तर (जीनोम चौड़ा पहचान) पर या एकल उम्मीदवार विश्लेषण (विशिष्ट प्रजातियों के स्थिर राज्य संचय) के रूप में दोनों के साथ और कम RNAs अभिव्यक्ति की रूपरेखा के लिए शक्तिशाली प्रौद्योगिकियों के विकास के द्वारा शुरू किया गया है. कई राज्य के कला रणनीतियों dosing या इस तरह भागने अणुओं दृश्यमान करने के लिए वर्तमान में उपलब्ध हैं, उत्तरी ब्लाट परख शाही सेना अभिव्यक्ति की तत्काल और सही मूल्यांकन के लिए आणविक जीव विज्ञान में पात्र दृष्टिकोण रहता है. यह कई मामलों में और अधिक परिष्कृत, महंगा प्रौद्योगिकियों और, के आवेदन की ओर एक पहला कदम है, आसानी से समझ प्राप्त करने का एक तरजीही विधि रहता प्रतिनिधित्व करता हैशाही सेना जीव विज्ञान में. यहाँ हम स्वयं लार्वा / वयस्क ऊतकों विच्छेदित या इन विट्रो संवर्धित कोशिकाओं में, पूरे भ्रूण मेलानोगास्टर ड्रोसोफिला से कमजोर व्यक्त microRNAs (या अन्य छोटे विनियामक आरएनए प्रजाति) का पता लगाने के लिए (उत्तरी ब्लाट बढ़ाया) एक कुशल प्रोटोकॉल अवलोकन. शाही सेना का एक बहुत ही सीमित मात्रा में आवश्यक और cytometry पृथक कोशिकाओं किया जा सकता है प्रवाह से सामग्री का उपयोग भी परिकल्पना की गई है.

Introduction

शाही सेना बायोकैमिस्ट्री पिछले साल 1 में शानदार प्रगति का अनुभव किया है. जीन अभिव्यक्ति के नियंत्रण में शाही सेना के संभावित की हमारी समझ उपन्यास आरएनए आधारित विनियामक तंत्र 3,4 की खोज से और पहले से ही जाना जाता है के बाद ट्रांसक्रिप्शनल घटनाओं का गहरा लक्षण वर्णन द्वारा, शक्तिशाली noncoding RIBO-नियामकों 2 की पहचान से फट गया है 5. सभी एक साथ इन अध्ययनों की अनुमति दी है आरएनए जीव विज्ञान में नाटकीय रूप से वर्तमान वैज्ञानिक परिदृश्य में एक प्रमुख अनुसंधान विषय बनता जा रहा है, दृश्य बनाने के लिए. विशेष रूप से, हाल के वर्षों में हम आणविक तंत्रिका जीव विज्ञान 6, आधुनिक जीवन विज्ञान के क्षेत्र में सबसे गतिशील अनुसंधान डोमेन में से एक पर 'शाही सेना दुनिया "के व्यापक प्रभाव की भावना हो रही है. पिछली सदी के अंतिम दशक में, समग्र वैज्ञानिक परिदृश्य आरएनए हस्तक्षेप 7,8 की खोज से और छोटे विनियामक RNAs 9,10 के क्र ांतिकारी परिवर्तन किया गया हैmicroRNAs 11 को विशेष संबंध, endogenously जीन अभिव्यक्ति की pleiotropic और मिश्रित नियामकों के रूप में लगभग सभी सेलुलर कार्यों के नियंत्रण में फंसा छोटे noncoding RNAs व्यक्त किया.

MiRNAs की उच्च संख्या ड्रोसोफिला में और साथ ही साथ 12-15 मानव कोशिकाओं में पहचान की गई है, जब लगभग 10 साल AMBROS और Ruvkun प्रयोगशालाओं द्वारा Caenorhabditis एलिगेंस में miRNA प्रारंभिक खोज के बाद, नए सिरे से ध्यान क्षेत्र में बदल गया था. तब से, बहुमुखी ट्रांसजेनिक दृष्टिकोण के लिए धन्यवाद, ड्रोसोफिला मेलानोगास्टर miRNA जैवसंश्लेषण और गतिविधि में delving के लिए एक मूल्यवान जैविक संदर्भ के रूप में बाहर खड़ा हो गया है. ड्रोसोफिला miRNAs रास्ते, चयापचय को उम्र बढ़ने के संकेत से फैले, कीट विशिष्ट या evolutionarily संरक्षित प्रक्रियाओं में विशिष्ट कार्यों से पता चला है , व्यवहार और, ज़ाहिर है, न्यूरोजेनेसिस. इस दिशा के साथ, हम हाल ही पेचीदा सह में एक उपन्यास कड़ी 16 अनावरणमास्टर जीन GCM / सरकना और आरएनए मार्ग के बीच होने वाली rrelation. मक्खी प्रतिलेखन कारक GCM / ग्लाइड 17-19 multipotent में glial बनाम न्यूरोनल भाग्य पसंद तंत्रिका व्यापारियों 20 मक्खी पैदा करती है जो सेल भाग्य निर्धारक, का एक अनूठा उदाहरण का गठन किया. बीस साल इस विषय पर लंबे समय से शोध GCM / पर converging जीन अभिव्यक्ति विनियमन के कई और अतिव्यापी आदानों की घटना तंत्रिका विकास के दौरान neuronal और glial समकक्षों के बीच नाजुक अनुपात में संतुलन के लिए आवश्यक दहलीज स्तर स्थापित करने के लिए 21-28 सरकना रेखांकित स्पष्ट रूप से किया गया है.

हम Dmel-miR279 लक्ष्यीकरण के माध्यम से उस विनियमन GCM के बाद ट्रांसक्रिप्शनल ठीक ट्यूनिंग / अभिव्यक्ति 16 सरकना करने के लिए योगदान एक और नियंत्रण के स्तर का प्रतिनिधित्व करता है की खोज की. विश्व स्तर पर, इन अनुसंधान लाइनों की आवश्यकता है विशिष्ट पद्धति सुधार: वर्षों के साथ, कई प्रौद्योगिकियों मूल पारं का विश्लेषण करने के लिए विकसितitional RNAs तरह, छोटे गैर कोडन RNAs बढ़ाता के लिए बदल दिया गया है RNase संरक्षण assays, सीडीएनए सरणियों 29-31, वास्तविक समय पीसीआर तरीकों 32-35 और 36,37 अनुक्रमण के रूप में. दूसरी ओर, तकनीकी दृष्टिकोण के recalibration क्षेत्र में निरंतर प्रगति को बढ़ावा दिया है.

उत्तरी ब्लाट परख (नो, या आरएनए जेल धब्बा परख) एक प्रतिनिधि उदाहरण का गठन: यह आकार दृढ़ संकल्प के साथ ही दोनों अभिव्यक्ति स्तर quantitation सुनिश्चित करता है के बाद से यह काफी हद तक, आरएनए संचय प्रोफ़ाइल में कार्यरत है. हालांकि, विधि के आंतरिक गरीब संवेदनशीलता यह कम RNAs तरह, कम प्रचुर मात्रा में जीन अभिव्यक्ति ठीक ट्यूनर के लिए लागू किया जा रहा है जब सीमित है. एक हानिकारक परिणाम विशिष्ट जैविक नमूने के लिए मुश्किल अपने आवेदन में आता है, जो कुल शाही सेना, की बड़ी मात्रा की आवश्यकता है. इस तरह के कारणों, छोटे RNAs का पता लगाने के लिए विशिष्ट नायब वेरिएंट के लिए 38-40 विकसित किया गया है: हम एक बेहतर नायब proc का फायदा उठायाedure 41 (ENB, बढ़ी उत्तरी ब्लाट), Dmel-miR279 और GCM / ग्लाइड बीच उपरोक्त परस्पर क्रिया elucidating है.

यह विधि एक Carbodiimide व्युत्पन्न की गतिविधि के आधार पर एक रासायनिक crosslinking कदम पर निर्भर करता है [1-एथिल-3 (3 dimethylaminopropyl) carbodiimide, ईडीसी] ठोस समर्थन पर न्यूक्लिक एसिड को ठीक करने के लिए. Carbodiimide सक्रिय carboxyl या फॉस्फेट समूहों और amine समूहों के बीच 42 एमाइड बांड के गठन को उत्प्रेरित करने के लिए जाना जाता है एक बहुमुखी पार linker है. यह गुण नायलॉन झिल्ली की सतह पर समूहों एमिनो उनके मोनो phosphorylated 5'-हाइड्रॉक्सिल समूह के माध्यम से covalently जोड़ी छोटे RNAs के लिए इस्तेमाल किया जा सकता. परिणामस्वरूप लगाव विन्यास, बारी में, उल्लेखनीय पता लगाने वृद्धि 43 में जो परिणाम जांच लक्ष्य संकरण की दक्षता स्थिर न्यूक्लिक एसिड की पहुंच बढ़ जाती है और.

तकनीक विशेष relevanc मानता हैड्रोसोफिला आणविक पढ़ाई में ई, जिसके द्वारा छोटे noncoding RNAs के उपन्यास और विशिष्ट वर्गों की घटना के 44 में उभर रहा है. इन के अलावा, 45,46 अनुक्रम विशिष्ट जीन मुंह बंद में शामिल piwi बातचीत RNAs (piRNAs 47), की एक विशिष्ट उप प्रकार का गठन rasiRNAs. इस विधि का ऑपरेटिव विवरण पूरी तरह से वर्णित और एक rasiRNA, rasi4 की, पहली बार, microRNAs Dmel-miR279 और Dmel-miR286 के विश्लेषण के सापेक्ष और, बाद में कल्पना कर रहे हैं. हम आरएनए (कम से कम 1 ग्राम) की न्यूनतम मात्रा से खराब व्यक्त लक्ष्य खुलासा हमें अनुमति दी है जो इस पद्धति, चरम पर धकेल दिया.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 नमूना संग्रह

  1. Pipetting द्वारा अर्द्ध पक्षपाती श्नाइडर के 2 कोशिकाओं, (औसतन 1-5 एक्स 10 6 कोशिकाओं), अलग करें और centrifugation (1 मिनट के लिए 100 XG) द्वारा उन्हें फसल. इन विट्रो सुसंस्कृत पक्षपाती कोशिकाओं के मामले में, मानक स्थितियों में उन्हें trypsinize या सीधे एक सेल खुरचनी की मदद से, शाही सेना निष्कर्षण अभिकर्मक का एक सुविधाजनक राशि में प्लेटों से उन्हें इकट्ठा.
  2. भ्रूण संग्रह के लिए, मक्खी पिंजरों में ड्रोसोफिला उपभेदों बढ़ने और दो ​​भ्रूण अंडे बिछाने प्लेटों पर संचित. आसुत जल में एक तूलिका (DH 2 हे) द्वारा भ्रूण से साफ कर लें, चलनी छानने से मलबे त्यागें कुल्ला और एक शीशी 48 में भ्रूण की वसूली.
  3. एक वैकल्पिक तकनीक के रूप में, मैन्युअल ऊतकों / अंगों को काटना. तुलना के रूप में विच्छेदन सुई या संदंश का उपयोग करके, एक stereomicroscope (20x बढ़ाई) के तहत फॉस्फेट बफर खारा (पीबीएस) में ड्रोसोफिला पेट से वृषण (Pirna विश्लेषण के लिए एक तरजीही सिस्टम) को अलगसुलिवान एट अल 49 में ualized.
  4. मूसल शाही सेना निष्कर्षण अभिकर्मक के 0.5 संस्करणों की लत पर नमूने homogenize.

2 शाही सेना निष्कर्षण / विश्लेषण

  1. निम्नलिखित निर्माताओं के निर्देश वाणिज्यिक अभिकर्मकों के माध्यम से शाही सेना अलगाव प्रदर्शन करते हैं. चेतावनी! शाही सेना निकासी एजेंट आमतौर पर विषाक्त और कास्टिक हैं. निम्नानुसार वैकल्पिक रूप से, शाही सेना अलगाव 50 के लिए एक proteinase कश्मीर आधारित प्रोटोकॉल लागू होते हैं:
    1. बंद करो मिक्स के 400 μl में नमूने पतला और 15 मिनट के लिए आरटी पर सेते हैं.
    2. क्लोरोफॉर्म: isoamyl शराब और क्लोरोफॉर्म एक्सट्रेक्शन और इथेनॉल (EtOH) वर्षा / वाशिंग द्वारा मानक फिनोल द्वारा hydrosoluble घटकों की वसूली. एयर नमूने सूखी और diethylpyrocarbonate (DEPC) में resuspend डबल (डीडी) एच 2 ओ आसुत -treated
  2. यूवी spectrophotometric माप से शाही सेना एकाग्रता का आकलन करें. इसके अलावा, आरएनए शुद्धता 2.0 के करीब, अधिक है बस सुनिश्चितएक 260 पर एड / 280 पठन.
  3. निम्नानुसार agarose जेल denaturing पर आरएनए तैयारी की जाँच करें:
    1. एक साफ बीकर में, निरंतर क्रियाशीलता के तहत, DEPC-DDH 2 हे के 82 मिलीलीटर में agarose के 1.2 ग्राम भंग. पूरी तरह भंग जब तक उबाल लें.
    2. जेल समाधान शांत करने की अनुमति दें; तापमान 60 डिग्री 10X 4-morpholinepropanesulfonic एसिड के 10 मिलीलीटर जोड़ने सी पहुंचता है जब (MOPS) 1x अंतिम एकाग्रता (एफसी) के लिए बफर, और 8 मिलीग्राम से 3 formaldehyde% की 37% एफसी. चेतावनी! Formaldehyde एक कैसरजन है.
    3. एक क्षैतिज वैद्युतकणसंचलन सेल में जेल डालो. जेल में कम से कम 1 घंटे के लिए एक डाकू के तहत जमना करने की अनुमति दें. दृढ़ीभवन बाद, mops 1X में जेल डूब.
    4. विभाज्य शाही सेना के नमूने की 2 ग्राम और सीढ़ी के 1 ग्राम (सही मूल्यांकन वांछित है जब एक शाही सेना मार्कर का उपयोग करें). शाही सेना को agarose लोडिंग डाई (ALD) के 3 खंडों जोड़ें और सीढ़ी को. गर्मी 70 डिग्री सेल्सियस 5 मिनट के लिए और बर्फ पर तुरंत शांत पर. सीएUtion! ALD की सामग्री (ethidium ब्रोमाइड और formamide, सामग्री देखें) क्रमश: उत्परिवर्तजन और संक्षारक हैं.
    5. नमूने लोड और सामयिक बफर रीसाइक्लिंग के साथ के बारे में 1 घंटे के लिए 50 वी में जेल चला रहे हैं. यूवी दृश्य या जेल इमेजिंग द्वारा आरएनए विभाजन पैटर्न की जाँच करें. 28S और 18S rRNAs करने और tRNAs को इसी असतत बैंड पहचानो (चित्रा 1 देखें).
  4. -80 डिग्री सेल्सियस पर उत्तरी परख या दुकान शाही सेना के लिए आगे बढ़ें.

3 अप्राकृतिकरण acrylamide जेल तैयारी

  1. इस विभाजन कदम के लिए एक छोटी सी खड़ी electrophoretic तंत्र (प्लेट आकार के बारे में 8 सेमी एक्स 9 सेमी, कंघी मोटाई 0.75 मिमी) का प्रयोग करें.
  2. एक कास्टिंग फ्रेम में साथ स्वच्छ चश्मा इकट्ठे.
  3. (1 19) MOPS 1X में समाधान, 7 एम यूरिया 10% acrylamide / बीआईएस acrylamide का 10 मिलीलीटर की तैयारी. तुरंत गिरने से पहले, 10% अमोनियम persulfate के 100 μl और TEMED की 10 μl जोड़ने और तेजी से समाधान मिश्रण. चेतावनी! Acrylamide neurotoxic और कैसरजन है.
  4. कांच की प्लेटों के बीच जेल डालो और बुलबुले से बचने के लिए सावधानी से अच्छी तरह कंघी डालें. जेल का प्रयोग करने से पहले कम से कम 45 मिनट के लिए आरटी पर भाजन करते हैं. वैकल्पिक रूप से, जेल ओ / एन, पानी से लथपथ फिल्टर अखबारों में लपेटा और सरन लपेट में सील की दुकान.

4 नमूना तैयार

  1. विभाज्य 0.5-20 प्रत्येक नमूने के लिए कुल शाही सेना के माइक्रोग्राम. मात्रा 3-4 μl से अधिक है, वैक्यूम नमूना सूखी.
  2. आकार निर्धारण के लिए एक मार्कर के रूप में (तैयार करने के लिए खंड 4.3 और 4.4 देखें), नमूने के समानांतर में radiolabeled कम दूरी की सीढ़ी के एक विभाज्य (20-30 सीपीएस) चलाते हैं. कदम 4.5 में वर्णित के रूप में, नमूने के समानांतर में यह समझो.
  3. सीढ़ी: एक 10 बीपी कदम सीढ़ी की 0.1 ग्राम का उपयोग कर एक फॉस्फेट आगे प्रतिक्रिया की स्थापना की. 30 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं और 20 मिमी एफसी को ethylenediaminetetraacetic एसिड (EDTA) जोड़कर प्रतिक्रिया बंद करो.
  4. EtOH तेज़ी / धोने, शुष्क हवा और शुद्धDDH 2 ओ (लगभग 100 μl). में resuspend चेतावनी! 32 पी एक रेडियोधर्मी स्रोत है.
  5. प्रत्येक नमूने के acrylamide नीले डाई (अब्द) की एक समान मात्रा में जोड़ें. 5 मिनट के लिए 80 डिग्री सेल्सियस पर गर्म करने से denature और लदान. चेतावनी तक बर्फ पर शांत! Formamide (अब्द में सामग्री) संक्षारक है.

5 Electrophoretic Fractionation

  1. कास्टिंग समर्थन से गिलास प्लेट निकालें और ठीक से वैद्युतकणसंचलन सेल में उन्हें इकट्ठा. पर्याप्त चल रहा है बफर (आरबी) के साथ दोनों आंतरिक और बाह्य कक्ष भरें.
  2. धीरे कंघी को हटाने और 10 मिनट के लिए 200 वी पर जेल पूर्व चलाते हैं. लोड हो रहा नमूने से पहले, एक सिरिंज के माध्यम से कुछ आरबी squirting द्वारा कुओं से यूरिया जमा दूर धोने.
  3. फ्लैट युक्तियों का उपयोग अच्छी तरह से प्रत्येक के निचले भाग में 4.5 कदम से ध्यान से विभक्त हो जाना नमूने लिए. उल्टे चलने से बचने के लिए एनोड और कैथोड कनेक्शन की जाँच करें. नमूने 5 मिनट के लिए 100 वी पर जेल में प्रवेश करने के बाद, मैं200 वी वोल्टेज ncrease
  4. के बारे में 7 सेमी की विभाजन की लंबाई के लिए, एक 45 मिनट लंबी रन के लिए पर्याप्त है. जेल अतिप्रवाह Bromophenol नीले (अब्द में एक ट्रैकिंग वर्णक) से बचें.
  5. एक वैकल्पिक कदम के रूप में ethidium ब्रोमाइड (EtBr) धुंधला, द्वारा fractionated लंबे RNAs जेल पर कल्पना:
    1. जेल के ऊपर से दूर 2 सेमी कट और संक्षिप्त DDH 2 ओ में टुकड़ा कुल्ला
    2. आरबी, EtBr 0.5 माइक्रोग्राम / एमएल एफसी में कोमल shacking के साथ 15 मिनट के लिए आरटी पर जेल टुकड़ा सेते हैं.
    3. आरबी में 15 मिनट के लिए जेल Destain, यूवी विकिरण या जेल इमेजिंग द्वारा लंबे rRNAs कल्पना. शाही सेना लोड हो रहा है और गुणवत्ता (1 चित्र देखें, पैनल 7). सावधानी के लिए जाँच करें! Ethidium ब्रोमाइड एक उत्परिवर्तजन है.
  6. इस बीच छोटे आरएनए प्रजातियों युक्त जेल के निचले हिस्से सोख्ता आगे बढ़ना.

6 जेल सोख्ता

  1. 6 सोख्ता क्षेत्र फिट करने के लिए कागज सोख्ता के टुकड़े और uncharge के एक बराबर टुकड़ा काटडी नायलॉन झिल्ली. पेपर शीट, झिल्ली और आरबी में 2 सोख्ता पैड गीला हो जाना. पूरी तरह से बार बार आरबी में उन्हें फैलाएंगे द्वारा पैड सोख करने के लिए सुनिश्चित करें.
  2. तंत्र से जेल निकालें और एक रंग का मतलब द्वारा चश्मा खुला. कुओं को दूर करने के लिए एक साफ कटर का उपयोग करें. जेल पर गीला वाटमान कागज के एक पत्रक प्लेस और धीरे इसे उठा.
  3. जेल से मुक्त चेहरे पर नायलॉन झिल्ली रखें. नमूना लोड के अनुसार फिल्टर उन्मुख करने के लिए एक कोने निशान. "सैंडविच" (3 कागज के टुकड़े प्रत्येक पक्ष) को पूरा करें. किसी भी संभावित हवाई बुलबुले को दूर करने के लिए, दाग सतह पर एक प्लास्टिक की रॉड रोल.
  4. सोख्ता कैसेट में दो सोख्ता पैड और फिर बीच धब्बा रखें. , सोख्ता मॉड्यूल में कैसेट इकट्ठा आरबी के साथ चैम्बर भरें और (जेल और सकारात्मक टर्मिनस के बीच रहना चाहिए नायलॉन झिल्ली) सही उन्मुखीकरण के लिए जाँच करें.
  5. 20 मिनट के लिए 20 वी में स्थानांतरण. नोट: 10 मिनट सोख्ता मॉड्यूल और अनुसंधान को खोलने के बाद, सजातीय स्थितियां सुनिश्चित करने के लिएहस्तांतरण पूरा करने से पहले 180 डिग्री से सैंडविच otate.

7 झिल्ली Crosslinking

  1. ताजा Crosslinking सॉल्यूशन (XLS) के 6 मिलीलीटर तैयार करें. तर एक 10 सेमी (नायलॉन झिल्ली से बड़ा) 10 सेमी XLS. सावधानी के साथ कागज सोख्ता का टुकड़ा x! एचसीएल (XLS का एक घटक) अत्यधिक संक्षारक है.
  2. दाग विघटित और गीला 3mm फिल्टर पेपर पर झिल्ली जगह है. नोट: शाही सेना संतृप्त कागज के साथ सीधे संपर्क में नहीं होना चाहिए. दो गिलास प्लेट के बीच फिल्टर और कागज प्लेस और सरन लपेटो में लपेट.
  3. एक DDH 2 हे धोने के द्वारा पीछा 2 घंटे के लिए 60 डिग्री सेल्सियस पर झिल्ली, गर्मी. -20 डिग्री सेल्सियस पर दुकान या संकरण करने के लिए आगे बढ़ें.

8 झिल्ली Prehybridization

  1. शाही सेना लोडिंग (वैकल्पिक कदम 5.5) की जाँच की गई है, तो सीधे संकरण करने के लिए आगे बढ़ें. वरना, नायलॉन फिल्टर के शीर्ष करने से दूर 1 सेमी कटौती जांच पार hybridizatio से बचने के लिएfractionated लंबे RNAs के लिए एन एस.
  2. 37 डिग्री सेल्सियस पर संकरण समाधान (एचएस) के 10 मिलीलीटर पहले से गरम. , 5 मिनट के लिए 95 डिग्री सेल्सियस पर सामन शुक्राणु के 1 मिलीग्राम denature बर्फ पर शांत और एच एस में जोड़ें.
  3. एक संकरण ओवन में रोटेशन के तहत कम से कम 1 घंटे के लिए 37C पर एच एस में फिल्टर सेते हैं. फिल्टर की शाही सेना की ओर एचएस चेहरे की जाँच करें.

9 जांच संश्लेषण

  1. 4.3 में वर्णित के रूप में, विशिष्ट antisense oligonucleotide की 10 pmol पर एक फॉस्फेट आगे प्रतिक्रिया सेट करें.
  2. (EtOH तेज़ी से भी या) Tris-EDTA-NaCl (दस) के 5 संस्करणों प्रतिक्रिया के लिए बफर और जी 25 Sephadex कॉलम पर जेल अपवर्जन क्रोमैटोग्राफी द्वारा अनिगमित nucleotides से लेबल प्राइमर शुद्ध जोड़ें. जांच गतिविधि तरल जगमगाहट काउंटर द्वारा मूल्यांकन किया जा सकता है.

10 झिल्ली संकरण

  1. एक ताजा 10 मिलीलीटर विभाज्य (ऊपर वर्णित के रूप में तैयार और पूरित) के साथ समाप्त एचएस बदलें. पर जांच गर्मीबर्फ पर शांत और उपन्यास एच एस को जोड़ने के 10 मिनट के लिए 95 डिग्री सेल्सियस,. 37 डिग्री सेल्सियस पर फिल्टर सेते हैं.

11 झिल्ली धुलाई

  1. संकरण समाधान की वसूली और एक रेडियोधर्मिता परिरक्षण बॉक्स में -20 डिग्री सेल्सियस पर दुकान.
  2. धोने बफर (पश्चिम बंगाल) में फिल्टर कुल्ला और आरटी पर 10 मिनट के लिए इसे अच्छी तरह से धो लें.
  3. फिल्टर कोनों में अवशिष्ट रेडियोधर्मिता की जाँच के लिए एक Geiger म्यूएलर डिटेक्टर का उपयोग. पृष्ठभूमि उत्सर्जन लगभग 5 सीपीएस है, जब प्रदर्शनी झिल्ली को आगे बढ़ना.

12 संकेत का पता लगाने

  1. Autoradiography फिल्मों पर या एक आणविक इमेजर स्क्रीन पर पर फिल्टर बेनकाब. फ़ोटो प्रसंस्करण या डिजिटल रूपांतरण से संकेत प्रकट.
  2. समर्पित मात्रा का ठहराव सॉफ्टवेयर (ImageJ या Optiquant) द्वारा बैंड तीव्रता का विश्लेषण करें.

13 झिल्ली स्ट्रिपिंग

  1. स्ट्रिपिंग समाधान उबलते की 500 मिलीलीटर में डूब, झिल्ली प्राथमिक संकेतों को निकालने के लिए, तो 1 मिनट के लिए आरटी पर सेते हैं. उपन्यास (पूर्व) संकरण करने के लिए आगे बढ़ें या -20 डिग्री सेल्सियस पर फिल्टर की दुकान.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

चित्रा 1 में पाठ में वर्णित और रेखाचित्र प्रतिनिधित्व समग्र प्रक्रिया का अनुसरण करके हम अलग अलग मूल की जटिल शाही सेना के नमूने से छोटे RNAs अभिव्यक्ति का आकलन किया. (: Agarose जेल विभाजन denaturing वैकल्पिक कदम) और डबल में लोड चित्रा 1 में प्रस्तुत प्रयोग में, आरएनए अखंडता के लिए जाँच proteinase कश्मीर निष्कर्षण द्वारा ड्रोसोफिला श्नाइडर के 2 कोशिकाओं से अलग किया गया था. जेल के एक आधा एक तटस्थ झिल्ली पर मिट गया था और रासायनिक पार से जुड़े ईडीसी द्वारा; दूसरी छमाही तो यूवी पार से जुड़े, एक सकारात्मक आरोप लगाया नायलॉन फिल्टर पर (1.2 x 10 5 μJ / 2 सेमी) स्थानांतरित किया गया था. Dmel-miR279 परिवार से संबंधित दो microRNAs की अंतर्जात अभिव्यक्ति (Dmel-miR279 ही है और Dmel-miR286 15) दोनों स्थितियों में सत्यापित किया गया था. सुधार प्रक्रिया (ENB) मानक एक (SNB) के लिए उच्च संवेदनशीलता सम्मान सुनिश्चित करता है.

आंकड़े 2 और 3 में प्रकाश डाला है. प्रयोगात्मक औचित्य ऊपर के रूप में एक ही है: यहाँ हम वृषण उड़ वयस्क से निकाले कुल शाही सेना के एक अनुमापन साथ Pirna rasi4 के उत्तरी ब्लाट autoradiographic पता लगाने के प्रतिनिधि परिणाम की रिपोर्ट. शाही सेना के 0.5 माइक्रोग्राम भरी हुई है जब ENB पहले से ही एक विशिष्ट बैंड का पता लगाने की अनुमति देता है. मात्रा का ठहराव एक तरफ संकेत आनुपातिक खुराक / प्रतिक्रिया अनुपात का पता लगाने के रैखिक सीमा में निहित है कि यह दर्शाता है, fractionated शाही सेना की राशि के साथ बढ़ जाती है कैसे पता चलता है. पैनल नीचे SNB की तुलना में इस विधि के बेहतर संवेदनशीलता ratifies. इस मामले में, एक detectable संकेत कम से कम SNB के लिए शाही सेना के 10 माइक्रोग्राम के electrophoretic विभाजन पर प्राप्त की है.

चित्रा 3 <रूप में रिपोर्ट में इसी तरह के परिणाम, जैसे एक अलग noncoding शाही सेना प्रजातियों के साथ 5 एस rRNA प्राप्त कर रहे हैं/> मजबूत.

चित्रा 1
समग्र उत्तरी ब्लाट प्रक्रिया के 1 योजनाबद्ध प्रतिनिधित्व चित्रा. मुख्य प्रक्रियात्मक चरणों सूचीबद्ध और उत्तरोत्तर गिने जा रहे हैं. परिणाम वही शर्तों में प्रदर्शन बढ़ी उत्तरी ब्लाट (ENB) और मानक उत्तरी ब्लाट (SNB), के बीच तुलना कर रहे हैं: ड्रोसोफिला श्नाइडर के 2 कोशिकाओं (पैनल 1), वैद्युतकणसंचलन (पैनल 2), हस्तांतरण (पैनल 3) और संकरण (से शाही सेना अलगाव पैनल 5). ENB लक्ष्य शाही सेना 5'-अंत और झिल्ली के बीच बंधन एक सहसंयोजक (स्थापित करता है जो एक तटस्थ फिल्टर (पैनल 3 झिल्ली की, बाईं आधा) और EDC आधारित crosslinking (पैनल 4) की आवश्यकता है जो इस रिपोर्ट में वर्णित सुधार प्रक्रिया को संदर्भित करता है कक्ष 4 में गुलाबी डॉट्स). SNB में शाही सेना crosslinking सकारात्मक nylo आरोप पर यूवी उपचार (पैनल 4) से प्राप्त किया जाता हैn झिल्ली (पैनल 3, झिल्ली के ठीक आधे). यह भी SNB और ENB प्रक्रिया के बीच मतभेद का जवाब क्योंकि 5S आरएनए विशिष्ट संकेत, तुलनात्मक स्थितियों में एक अंशशोधक नहीं है. इस प्रकार, एक 5'लेबल की (10 सीपीएस के लिए इसी) एक राशि (संदर्भ में एक "कील" के रूप में कार्य करने के लिए, 50 NT लंबे तले oligonucleotide वैद्युतकणसंचलन से पहले प्रत्येक नमूने के लिए जोड़ा गया है, (अंक 4.3 और प्रोटोकॉल के 4.4 देखें) पैनल 7). लोड हो भी लंबे rRNAs (प्रोटोकॉल के बिंदु 5.5 देखें) पर जेल EtBr धुंधला द्वारा मूल्यांकन किया जा सकता. एल = सीढ़ी. FV = ललाट देखें, एल.वी. = पार्श्व दृश्य, एचवी = क्षैतिज देखें. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 2
चित्रा 2 COMPARrasi4 अभिव्यक्ति की ative उत्तरी धब्बा विश्लेषण. वृषण विशेष Pirna rasi4 की अंतर्जात स्तर बढ़ाया (ENB) या मानक (SNB) उत्तरी ब्लाट से पता चला रहे हैं, वयस्क ड्रोसोफिला वृषण से निकाला (प्रत्येक लेन उपर्युक्त) कुल शाही सेना की बढ़ती मात्रा पर प्रदर्शन , या पूरे पेट से (अब्द). प्रत्येक पद्धति के लिए, एक तरफ histograms लोडिंग नियंत्रण "में कील" एक का एक ही राशि के लिए rasi4 सम्मान के रिश्तेदार मात्रा की रिपोर्ट. दो तरीकों से quantifications जैल नीचे रखा निर्णायक ग्राफ में संयुक्त रहे हैं. यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चित्रा 3
5 एस आर के चित्रा 3 तुलनात्मक उत्तरी धब्बा विश्लेषणशाही सेना अभिव्यक्ति. एक सकारात्मक नियंत्रण और प्रयोगात्मक अंशांकन के रूप में, पिछले विश्लेषण 5S rRNA के लिए बढ़ा दिया गया था. विवरण चित्रा 2 के रूप में. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

शाही सेना न्यूरोजेनेसिस को नियंत्रित करता है, जिसके माध्यम से intertwining मिलावट की हमारी प्रशंसा लगातार बढ़ती जा रही है हालांकि, तंत्रिका स्टेम कोशिका जीव विज्ञान, neuronal भेदभाव / कार्यात्मक एकीकरण, तंत्रिका विकृतियों और कैंसर के विकास को प्रभावित आरएनए आधारित circuitries की यंत्रवत निहितार्थ बेरोज़गार रहते हैं. ड्रोसोफिला कम noncoding RNAs और प्रतिलेखन कारक प्रमुख आणविक खिलाड़ियों के रूप में माना जाता है जिसमें बेरोज़गार सेलुलर रास्ते, जानने के लिए महत्वपूर्ण भूमिका निभाई मेलानोगास्टर के रूप में राज्यों के माध्यम से इस तरह के नेटवर्क के रखरखाव आनुवंशिक प्रणाली की क्षमता बनाता है. इस दृश्य में, उम्मीदवार छोटे आरएनए अभिव्यक्ति के स्तर की रूपरेखा सटीक कार्यात्मक विश्लेषण करने के लिए प्राथमिक है: एक उदाहरण के उत्तरी सोख्ता परख के एक उन्नत संस्करण के रूप में के माध्यम से पूरा Dmel-miR279 विवो में GCM / ग्लाइड भाग्य निर्धारक modulates कि हमारे हाल के प्रदर्शन से आता है अभिव्यक्ति के विश्लेषण के लिए एक उपकरण.

51 में अपनी प्रारंभिक विकास के बाद से वर्ग = "jove_content">, नायब शाही सेना के विश्लेषण के लिए एक संदर्भ विधि के रूप में माना गया है. संकेत मात्रा का ठहराव के साथ प्रारूप या संभव त्रुटियों मल्टीप्लेक्स मुश्किल रूपांतरण के रूप में इस परख के कुछ आंतरिक सीमाओं के बावजूद, आरएनए आणविक जीव विज्ञान में हाल ही में सफलताओं छोटे Ribonucleic की अंतर्जात अभिव्यक्ति परख करने की क्रिया के लिए एक "त्वरित और स्वच्छ" प्रणाली के रूप में इस पारंपरिक तकनीक को फिर से खोज की है एसिड या gain- या नुकसान के समारोह दृष्टिकोण के प्रभाव को मान्य करने के लिए. दृष्टिकोण विनियामक RNAs 52 की कभी नए गुणों के लक्षण वर्णन में अपनी प्रासंगिकता के लिए कतार में सबसे आगे रहता है जबकि उदाहरणस्वरूप उदाहरण के रूप में, उत्तरी विश्लेषण, microRNAs की मूल खोज के आधार पर देता है.

यहाँ वर्णित संस्करण के कारण शाही सेना की रासायनिक crosslinking के लिए वृद्धि की संवेदनशीलता पर आधारित है. हम believethe विधि अभी भी खराब ड्रोसोफिला में कार्यरत है, खयह आरएनए लक्ष्य का पता लगाने 41,43 के एक औसत 10-30 गुना सुधार के साथ छोटे नमूने (कम से कम 1 ग्राम), से संभव रूपरेखा शाही सेना अभिव्यक्ति बनाता है के बाद से हम अपने स्थितियों में प्राप्त के रूप में केन्द्र शासित प्रदेशों का शोषण करते हैं, महत्वपूर्ण खोजों से 52 के नेतृत्व में (आंकड़े 2 और 3).

शाही सेना अखंडता सुसंगत और प्रतिलिपि प्रस्तुत करने योग्य परिणाम प्राप्त करने के क्रम में एक महत्वपूर्ण मुद्दा गठन किया. शाही सेना जोड़तोड़ निष्कर्षण और लदान के बीच होने वाली संभव नमूना गिरावट को सीमित करने सटीकता और तेज़ी की आवश्यकता होती है. इस उद्देश्य पर, सभी समाधान RNase गतिविधि को नाकाम करने के लिए (DEPC) (autoclaved तो 37 डिग्री सेल्सियस में 0.1% DEPC की उपस्थिति में 2 घंटा ऊष्मायन और) उपयोग करने से पहले इलाज diethylpyrocarbonate- होने की जरूरत है. समाधान उपचार एक विलायक के रूप में DEPC पानी का उपयोग करने के लिए बेहतर परिणाम सम्मान की गारंटी देता है. सभी उपकरण समान रूप से एक RNase विशिष्ट सतह decontaminant द्वारा सफाई के बाद, DEPC ddH20 में rinsed किया जाएगा.

(उदाहरण के लिए, rasi4, Figure2) या आरएनए शुद्धि (ताजा नमूनों पर नहीं किया जाता है जब उदाहरण के लिए, ऊतक भंडारण में संरक्षित अभिकर्मकों). अनुभव से, स्थिर नमूनों से शाही सेना अलगाव काफी कठोर हुई और अधिक कठोर निकासी की स्थिति की आवश्यकता है. मानक स्थितियों में वर्णित proteinase कश्मीर आधारित पद्धति के रूप में अच्छी तरह से, (एक महत्वपूर्ण उदाहरण Figure1 में प्रतिनिधित्व किया है) अच्छी गुणवत्ता तैयारी की गारंटी देता है, लेकिन यह भंडारण अभिकर्मकों में संरक्षित नमूनों के लिए इष्टतम पसंद नहीं है.

इस प्रक्रिया के छोटे आरएनए विशिष्ट पहचान करना है, क्योंकि अंत में, समर्पित स्तंभ शुद्धि आधारित किट भी वें हालांकि, प्रत्यक्ष छोटे आरएनए अलगाव के लिए नियोजित किया जा सकताहै आरएनए अखंडता को सत्यापित करने के लिए कठिन बना देता है. ऊपर वर्णित आरएनए अखंडता नियंत्रण के लिए शास्त्रीय जेल आधारित प्रक्रिया के लिए वैकल्पिक रूप से, आरएनए गुणवत्ता न्यूक्लिक एसिड पैटर्न पर चिप छोटी विश्लेषण के लिए उपकरणों द्वारा मूल्यांकन किया जा सकता है.

बफर च्वाइस: MOPS-NaOH बफर (पीएच 7) बढ़ी उत्तरी जेल वैद्युतकणसंचलन और सोख्ता दोनों के लिए एक तरजीही बफर के रूप में प्रस्तावित किया गया था. हम भी संतोषजनक ढंग से हमारे प्रयोगों में Tris-borate EDTA (TBE) बफर इस्तेमाल किया. Tris (hydroxymethyl) aminomethane की nucleophile amine समूहों की उपस्थिति में ही hydrolyze और इलाज के दौरान DEPC निष्क्रिय होगा, क्योंकि इस मामले में, यह DEPC इलाज पानी के बजाय इलाज TBE बफर पहले से ही तैयार में Tris भंग की सिफारिश की है.

Electrophoretic भागो और सोख्ता: जेल से पूर्व चल अतिरिक्त Persulfate हटाने और hyperfocusing को नष्ट करने के लिए आवश्यक है. पूर्व रन पैरामीटर भी तेजी electropho परहेज, विभाजन के दौरान भी बनाए रखा जाना चाहिएretic रन. लोड करने से पहले, अंदर बफर squirting द्वारा, कुओं से संभव यूरिया अवसादों को दूर करने के लिए सुनिश्चित करें. इस संकेत का पता लगाने के दौरान हल autoradiographic बैंड का निर्माण, नमूना फैल अधिक और गारंटी सटीक आरएनए स्तरीकरण सीमित कर देगा. किसी भी तटस्थ नायलॉन झिल्ली न्यूक्लिक एसिड हस्तांतरण के लिए एक सहायता के रूप में इस्तेमाल किया जा सकता है. निर्दिष्ट शर्तों पर अधिक से अधिक 20-30 मिनट के लिए शाही सेना दाग मत करो.

Crosslinking: ईडीसी आधारित रासायनिक crosslinking इस बढ़ाया उत्तरी धब्बा संस्करण के महत्वपूर्ण पद्धति अग्रिम का प्रतिनिधित्व करता है. संभावना आरएनए 5'mono फॉस्फेट समूह और नायलॉन प्राथमिक एमाइंस के बीच सहसंयोजक सीमा से तटस्थ सतहों को कम आरएनए प्रजातियों crosslink करने के संकरण के लिए उपलब्ध अड्डों में से बहुमत छोड़ देता है. इस पारंपरिक crosslinking को 10-20xrespect द्वारा संवेदनशीलता को बढ़ाता है. यह उचित झिल्ली संतृप्ति के लिए पर्याप्त मात्रा में, प्रत्येक सोख्ता के लिए crosslinking समाधान की ताजा राशि को तैयार करने के लिए महत्वपूर्ण है.

संकरण और वॉशिंग: जांच हौसले लेबल किया जाना चाहिए. (संकरण के लिए उपलब्ध जांच की मात्रा पर भी विशिष्ट गतिविधि पर निर्भर है और निगमित radiolabeled न्यूक्लियोटाइड की राशि और) विशिष्ट गतिविधि की जांच के लक्ष्य का पता लगाने की संवेदनशीलता को निर्धारित करता है. 3,000 Ci / mmol के एक विशिष्ट गतिविधि के साथ एटीपी प्रयोग किया जाता है [32 पी γ-] जब, 5 'समाप्त होता है की 100% लेबलिंग के लिए 10 6 सीपीएम / pmol उम्मीद है.

संकरण समाधान बरामद किया जा सकता है और पर फिर से उपयोग किया, उस कारण को 32 पी क्षय, के बारे में 14 दिन में जांच गतिविधि आधा.

कारण झिल्ली तटस्थता के लिए, कम पृष्ठभूमि शोर संकरण पर उम्मीद है. अधिक कड़े धोने की स्थिति के लिए आवश्यक हैं, तो उत्तरोत्तर (0.2x SSPE तक) धोने बफर ईओण ताकत को कम या 37 डिग्री सेल्सियस को धोने तापमान बढ़ा ईओण डिटर्जेंट या (0.5% एसडीएस के लिए) बढ़ती मात्रा जोड़ने.

शाही सेना का आकार माप की आवश्यकता है जब उत्तरी धब्बा विश्लेषण आवश्यक है. इस परख प्रतिदीप्ति आधारित qPCR छोटे RNAs के आकलन के लिए दृष्टिकोण की सटीकता की कमी हो सकती है, भले ही एक फायदा / denaturing विभाजन का उपयोग सोख्ता और लक्ष्य RNAs का पता लगाने से पहले अनूठा कदम के रूप में जांच पर निर्भर संकरण से निकला है. नतीजतन, नमूना से विशिष्ट संकेतों के रहस्योद्घाटन प्रत्यक्ष और समर्पित वाणिज्यिक किट का उपयोग मतलब होगा जो enzymatic उपचार / रूपांतरण / प्रवर्धन के किसी भी अतिरिक्त कदम की आवश्यकता नहीं है. शाही सेना के स्तर मात्रा निर्धारित और एक झिल्ली पर कई नमूने के बीच तुलना की जा सकती. इस प्रकार Northeआर.एन. धब्बा सामान्यतः qPCR डेटा के लिए एक कड़े सत्यापन के रूप में कार्यरत है. विशिष्ट प्रयोगात्मक आवश्यकताओं के कहने पर विधि RNAs के सीमित मात्रा में (आंकड़े 2 देखें और 3) इतना है कि यहां तक कि दोनों संवेदनशीलता और संकल्प के स्तर पर, पिछले वर्षों के दौरान सुधार किया गया है सफल विश्लेषण के लिए आवश्यक हैं.

हम प्रस्तुत प्रोटोकॉल सामग्री सीमित मात्रा में उपलब्ध है, विशेष रूप से जहां आवेदनों की एक विस्तृत श्रृंखला के लिए अनुकूलित किया जा सकता है. शाही सेना के नमूने के जैविक स्रोत विषम हो सकता है: ड्रोसोफिला संबंध है, जहाँ तक भ्रूण या अन्य विकास के चरणों व्यक्ति की कोशिकाओं छँटाई पृथक cytotypes या सेल संस्कृतियों, उपयुक्त हैं, लेकिन यह भी मैन्युअल ऊतकों या अंगों विच्छेदित.

इसके अलावा, microRNAs सेल और शाही सेना की मध्यस्थता जीन अभिव्यक्ति नियंत्रण के क्षेत्र में जांच के प्रमुख विषय में कम विनियामक RNAs के सबसे प्रचुर मात्रा में वर्ग हैं, भले ही वे नहीं विपक्ष करनासेलुलर noncoding RNAs के ही परिवार titute. छोटे RNAs के कई समूहों को आम तौर पर व्यापारियों के अणुओं की एंडो-ribonucleolytic प्रसंस्करण से पाने, राज्यों (जैसे, अंतर्जात siRNAs, piRNAs, snoRNAs, संयंत्र tasiRNAs) और उनमें से ज्यादातर (असंशोधित) एक नि: शुल्क 5 'टर्मिनस से विशेषता हैं भर में कार्य करते हैं. यह सुविधा अब RNAs विश्लेषण कर रहे हैं जब शाही सेना आकार, के रूप में अच्छी तरह से विचार किया जाना है, भले ही सख्ती से रासायनिक crosslinking के आधार पर विशिष्ट पद्धति में सुधार लागू करने के लिए आवश्यक अद्वितीय संरचनात्मक शर्त का गठन किया. चित्रा 2 में हम बढ़ाया संवेदनशीलता एक उत्तरी धब्बा विश्लेषण तुलनात्मक rasi4 54 गरीब और विशिष्ट अभिव्यक्ति के स्तर की स्थिति में रोगाणु लाइन विशिष्ट छोटे RNAs के एक वर्ग (आरएनए या piRNAs Piwi बातचीत.) के एक सदस्य के स्तर का पता लगाने रिपोर्ट इस पद्धति का विशेष रूप से सूचना दी प्रोटोकॉल आगे कंघी द्वारा सुधार किया जा सकता है, विचार है कि सफल परिणाम मंजूर कर सकते हैंपहले से ही साहित्य 55,56 में वर्णित अन्य व्यावहारिक कार्यान्वयन के साथ यह ining.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

इस काम के संस्थान नेशनल डे ला Sante एट डी ला Recherche MEDICALE द्वारा समर्थित किया गया था, केंद्र में राष्ट्रीय डी ला Recherche Scientifique, Université डी स्ट्रासबर्ग, Hôpital डे स्ट्रासबर्ग, एसोसिएशन डालना ला Recherche सुर ले कैंसर, संस्थान नेशनल डु कैंसर, एजेंस नेशनल डी ला Recherche और क्षेत्र Alsace.

पिएत्रो LaNeve ला Recherche MEDICALE Fondation द्वारा डालना समर्थन किया गया है. वर्तमान में, वह एक Istituto Italiano Tecnologia (आईआईटी) फैलोशिप के प्राप्तकर्ता है. प्रकाशन लागत Neurex नेटवर्क के द्वारा समर्थित हैं (TriNeuron - कार्यक्रम Interreg चतुर्थ अपर राइन)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics