Aprimorada do Norte Detecção Blot de pequeno RNA de espécies em
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

O objetivo desta publicação é visualizar e discutir os passos operatórios de um protocolo de Northern Blot em RNA extraído de Drosophila melanogaster avançado embriões, células e tecidos. Este protocolo é particularmente útil para a detecção eficiente de espécies de ARN pequenas.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

As últimas décadas têm testemunhado a explosão do interesse científico em torno de mecanismos de controle de expressão gênica em nível de RNA. Este ramo da biologia molecular tem sido grandemente impulsionado pela descoberta de RNAs não-codificantes como principais intervenientes na regulação pós-transcricional. Tal perspectiva revolucionária tem sido acompanhado e desencadeada pelo desenvolvimento de tecnologias poderosas para criação de perfil curto expressão RNAs, tanto no nível de alto rendimento (número de identificação do genoma) ou como análise-candidato único (acúmulo de estado estacionário de espécies específicas). Embora várias estratégias estado-da-arte estão atualmente disponíveis para a dosagem ou visualizar tais moléculas que fogem, ensaio Northern Blot continua a ser a abordagem elegíveis em biologia molecular para a avaliação precisa e imediata de expressão do RNA. Ela representa um primeiro passo para a aplicação de tecnologias caras mais sofisticados e, em muitos casos, continua a ser um método preferencial para ganhar facilmente descobertasem biologia ARN. Aqui nós overview um protocolo eficiente (Enhanced Northern Blot) para detectar microRNAs fracamente expressos (ou outras espécies de pequenos RNA reguladores) de Drosophila melanogaster embriões inteiros, dissecados manualmente tecidos / adultos ou larvas em células cultivadas in vitro. Uma quantidade muito limitada de RNA é necessária e do uso de material de fluxo de células isoladas de citometria pode ser também prevista.

Introduction

RNA bioquímica tem experimentado avanços espetaculares nos últimos anos 1. A nossa compreensão de ARN potencial no controlo da expressão de genes tem sido perfurados por a identificação de poderosos noncoding ribo-reguladores 2, com a descoberta de novos mecanismos de regulação baseados no RNA 3,4 e por uma caracterização mais profunda de eventos pós-transcrição já conhecidos 5. Todos biologia RNA juntos estes estudos têm permissão para fazer drasticamente a cena, tornando-se um importante tema de pesquisa na paisagem científica atual. Em particular, nos últimos anos estamos recebendo uma noção do impacto generalizado do "mundo de RNA" em neurobiologia molecular 6, um dos campos de pesquisa mais dinâmicos da ciência da vida moderna. Na última década do século passado, o cenário científico global foi revolucionado pela descoberta da interferência de RNA 7,8 e dos pequenos RNAs regulatórios 9,10nomeadamente em matéria de microRNAs 11, endogenamente expressa pequenos RNAs não-codificantes envolvidos no controle de quase todas as funções celulares como reguladores pleiotrópicos e combinatórias de expressão gênica.

Quase 10 anos depois de miRNA descoberta inicial em Caenorhabditis elegans por Ambros e laboratórios da Ruvkun, renovada atenção voltou-se para o campo quando um elevado número de miRNAs foram identificados em Drosophila e em células humanas, bem 12-15. Desde então, graças às abordagens transgênicas versáteis, Drosophila melanogaster tem se destacado como um contexto biológico valioso para aprofundar em miRNA biossíntese e atividade. Drosophila miRNAs têm revelado funções distintas em processos de insetos específicos ou conservados evolutivamente, que vão desde o envelhecimento ao metabolismo, vias de sinalização , comportamento e, é claro, neurogenesis. Ao longo desta direção, que recentemente lançou um novo link de 16 em co intriganterrelation ocorrendo entre o gene mestre GCM / glide ea via RNA. O fator de transcrição fly Gcm / Glide 17-19 constitui um exemplo único de determinante do destino da célula, o que determina a escolha destino neuronal glial vs. em multipotentes voar precursores neurais 20. Vinte anos longa investigação sobre este tema sublinhou claramente a ocorrência de múltiplas e sobrepostas entradas de regulação da expressão gênica convergindo sobre GCM / deslizar 21-28 para estabelecer os limiares necessários para equilibrar a relação delicada entre as partes neuronais e gliais durante o desenvolvimento neural.

Descobrimos que a regulação via DMEL-miR279 segmentação representa um novo nível de controle que contribui para a pós-transcricional ajuste fino da GCM / deslizar expressão 16. Melhorias metodológicas específicas Globalmente, estas linhas de pesquisa têm exigido: ao longo dos anos, várias tecnologias originalmente desenvolvidas para analisar tradRNAs itional foram convertidos para quantificar pequenos RNAs não codificantes, como como ensaios de proteção RNase cDNA matrizes 29-31, em tempo real, métodos de PCR e sequenciamento 32-35 36,37. Por outro lado, a recalibração de abordagens técnicas promoveu avanços contínuos no campo.

Northern blot (NB, ou ensaio de mancha de gel de ARN) constitui um exemplo representativo: é largamente utilizado para o perfil de acumulação de ARN, uma vez que garante a expressão de nível de quantificação, bem como determinação do tamanho. No entanto, a fraca sensibilidade intrínseca do método é limitante quando é para ser aplicada à expressão do gene finas sintonizadores baixa abundantes, como RNAs curtos. Uma consequência prejudicial é o requisito de grandes quantidades de RNA total, o que torna difícil a sua aplicação para amostras biológicas específicas. Por tais razões, variantes NB específicos para detecção de RNAs pequenos foram desenvolvidos 38-40: aproveitamos uma melhor proc NBedure 41 (ENB, Avançado Northern Blot), enquanto elucidar a interação entre DMEL-miR279 e GCM / glide acima referido.

Este método baseia-se num passo de reticulação química com base na actividade de um derivado de carbodiimida [1-etil-3 (3-dimetilaminopropil) carbodiimida, EDC] para fixar o ácido nucleico em suportes sólidos. Carbodiimida é um agente de reticulação versátil conhecida para catalisar a formação de ligações amida entre os grupos carboxilo activados ou fosfato e os grupos de amina 42. Esta propriedade pode ser explorada para acoplar covalentemente pequenos RNAs através do seu grupo 5 '-hidroxilo de mono-fosforilada em grupos amino na superfície de membranas de nylon. A configuração do acessório resultante aumenta a acessibilidade do ácido nucleico imobilizado e, por sua vez, a eficiência da hibridação sonda-alvo, o que resulta em aumento notável de detecção 43.

A técnica assume particular relevance em estudos moleculares de Drosophila, pelo que a ocorrência de aulas novas e distintivas de pequenos RNAs não-codificantes está emergindo 44. Entre estes, rasiRNAs 45,46 constituem um subtipo específico de RNAs-interagindo Piwi (piRNAs 47), envolvidos no silenciamento de genes de seqüência específica. Detalhes da operação deste método estão completamente descritos e visualizadas a seguir, em relação com a análise da microRNAs DMEL-miR279 e DMEL-miR286 e, pela primeira vez, de uma rasiRNA, rasi4. Nós levado ao extremo este método, o que nos permitiu revelar alvos mal expressas de quantidades mínimas de RNA (menos de 1 mg).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Coleção 1 Amostra

  1. Separe duas células semi-aderente de Schneider, (1-5 x 10 6 células, em média), por pipetagem e colhê-las por centrifugação (100 xg por 1 min). Em caso de in vitro células aderentes cultivadas, trypsinize-los em condições normais ou diretamente coletá-los de placas em uma quantidade conveniente de reagente de extração de RNA, com a ajuda de um raspador de células.
  2. Para a coleta de embriões, crescer estirpes de Drosophila em gaiolas mosca e deixar acumular embriões em placas de ovos de postura. Wipe embriões fora por um pincel em água destilada (dH2O), descartar detritos por crivo de filtragem, lavagem e recuperação de embriões num frasco 48.
  3. Como uma técnica alternativa, dissecar manualmente os tecidos / órgãos. Isolar testículos (um sistema preferencial para análise piRNA) de Drosophila abdômen em tampão fosfato (PBS) sob microscópio estereoscópico (aumento de 20X), usando agulhas de dissecação ou fórceps como visualized em Sullivan et al 49.
  4. Pilão homogeneizar amostras sobre vício de 0,5 volumes de reagente de extração de RNA.

2 Extração de RNA / Análise

  1. As instruções do fabricante efectuar o isolamento do RNA através de reagentes comerciais. CUIDADO! Agentes de extração de RNA são geralmente tóxico e corrosivo. Alternativamente, aplicam um protocolo baseado em Proteinase K para o isolamento de ARN de 50, como se segue:
    1. Diluir as amostras em 400 ul de paragem Misturar e incubar à temperatura ambiente durante 15 min.
    2. Recuperar os componentes hidrossolúveis de fenol padrão: clorofórmio: álcool isoamílico e extracções de clorofórmio e de etanol (EtOH) a precipitação / lavagem. Air secar as amostras e ressuspender em dietilpirocarbonato (DEPC) tenha sido tratada com dupla destilada (dd) H 2 O.
  2. Avaliar a concentração de ARN por espectrofotometria de UV. Também garantir a pureza RNA é alta, perto de 2.0, based em A 260 / A leitura 280.
  3. Verificar preparação de ARN em gel de agarose desnaturante, como se segue:
    1. Num copo limpo, dissolve-se 1,2 g de agarose em 82 ml de DEPC-ddH2O, sob agitação contínua. Ferva até dissolver completamente.
    2. Permitir que a solução gel para esfriar; quando a temperatura chega a 60 ° C adicionar 10 ml de ácido 4-10X morpholinepropanesulfonic (MOPS) buffer para 1X concentração final (FC), e 8 ml de formaldeído a 37% para 3% FC. CUIDADO! formaldeído é uma substância cancerígena.
    3. Verter o gel numa célula de electroforese horizontal. Permitir que o gel solidifique sob uma capa, durante pelo menos 1 hr. Após solidificação, submergir o gel em MOPS 1X.
    4. Alíquota de 2 mg de amostra de RNA e 1 mg de Escada (use um marcador de RNA quando avaliação precisa é desejada). Adicionar 3 volumes de corante de carga de agarose (ALD) de ARN e a escada. Aquece-se a 70 ° C durante 5 minutos e imediatamente em gelo fresco. CABuição! Índice de ALD (brometo de etídio e formamida, veja Materiais) são mutagênico e corrosivo, respectivamente.
    5. Coloque as amostras e correr o gel a 50 V durante cerca de 1 hora com tampão de reciclagem ocasional. Verifique o padrão de RNA fracionamento através da visualização de imagens UV ou gel. Reconhecer bandas discretas correspondentes a 28S e 18S ARNr e ARNt (ver Figura 1).
  4. Siga para norte Ensaio ou loja de RNA a -80 ° C.

3. desnaturação Acrylamide Gel Preparação

  1. Use um pequeno aparelho verticais eletroforética para esta etapa de fracionamento (tamanho da placa de cerca de 8 cm x 9 cm, espessura pente 0,75 milímetros).
  2. Montar copos limpos juntos em um quadro de qualidade.
  3. Preparar 10 ml de 10% de acrilamida / bis-acrilamida (19: 1) solução de MOPS 1X, 7 M de ureia. Imediatamente antes de servir, adicione 100 ml de 10% de persulfato de amónio e 10 ml de Temed e misture rapidamente a solução. CUIDADOA acrilamida! É neurotóxica e cancerígena.
  4. Despeje o gel entre as placas de vidro e inserir o pente bem cuidado para evitar bolhas. Deixar o gel de polimerizar à temperatura ambiente durante pelo menos 45 min antes da utilização. Em alternativa, guarde o O gel / N, embrulhado em papel de filtro umedecidos com água e selado em saran wrap.

Preparação 4 Amostra

  1. Aliquota 0,5-20 ug de ARN total para cada amostra. Se o volume for superior a 3-4 mL, a amostra seca sob vácuo.
  2. Para a determinação do tamanho, executar-se uma alíquota (20-30 cps) radiomarcado de escada de baixa gama de amostras em paralelo, tal como um marcador (ver secções 4.3 e 4.4 para a preparação). Tratá-lo em paralelo com as amostras, como descrito no passo 4.5.
  3. Ladder: criar uma reação direta de fosfato utilizando 0,1 g de uma escada de 10 bp-passo. Incubar a 37 ° C durante 30 minutos e parar a reacção pela adição de ácido etilenodiaminotetracético (EDTA) a 20 mM de FC.
  4. Purifica-se por precipitação de EtOH / lavagem, ar seco eressuspender em ddH 2 O (cerca de 100 mL). CUIDADO 32 P é uma fonte radioactiva.
  5. Para cada amostra, adicionar um volume igual de corante azul de acrilamida (ABD). Desnaturação por aquecimento a 80 ° C durante 5 minutos e deixar arrefecer sobre gelo até à carga. ATENÇÃO! Formamida (conteúdo em ABD) é corrosivo.

5. Electrophoretic Fracionamento

  1. Retirar as placas de vidro a partir do suporte de fundição e montá-los adequadamente na célula de electroforese. Preencha ambos câmara interna e externa com suficiente tampão de corrida (RB).
  2. Remova cuidadosamente o pente e pré-executar o gel a 200 V durante 10 min. Antes de colocar as amostras, lavar depósitos de uréia dos poços por esguichar alguns RB através de uma seringa.
  3. Utilizar pontas planas para estratificar cuidadosamente amostras de 4,5 passo no fundo de cada poço. Verifique as conexões de ânodo e do cátodo para evitar a execução invertida. Após as amostras de entrar no gel a 100 V durante 5 minutos, increase a tensão de 200 V.
  4. Para um comprimento de fraccionamento de cerca de 7 cm, a 45 min-longo prazo é suficiente. Evite Azul de bromofenol (um pigmento de rastreamento em ABD) a transbordar o gel.
  5. Visualizar no gel os RNAs longos fraccionados por brometo de etídio (EtBr) a coloração, como um passo opcional:
    1. Cortar a 2 cm da superfície do gel e lavar rapidamente a fatia em ddH 2 O.
    2. Incubar a fatia de gel, à temperatura ambiente, durante 15 min com Shacking suave em RB, EtBr a 0,5 ug / ml de FC.
    3. Destain o gel durante 15 minutos em RB, visualizar longos rRNAs por irradiação de UV ou de imagem em gel. Verifique se há carga RNA e qualidade (veja a Figura 1, Painel 7). CUIDADO! Brometo de etídio é um agente mutagênico.
  6. Enquanto isso proceder blotting a parte inferior do gel contendo as espécies de ARN pequenas.

6. Gel Blotting

  1. Corte 6 pedaços de papel mata-borrão para caber na área da mancha e uma peça equivalente de uncharged membrana de nylon. Umedeça as folhas de papel, membrana e duas almofadas de mancha em RB. Certifique-se de mergulhar completamente as almofadas por várias vezes apertando-as em RB.
  2. Remover o gel a partir do aparelho e abrir os vidros por meio de uma espátula. Usar um cortador limpa para remover os poços. Coloque uma folha de papel filtro molhado no gel e cuidado, retire-se.
  3. Colocar a membrana de nylon sobre a face livre do gel. Marcar um canto para orientar o filtro de acordo com a carga da amostra. Complete o "sanduíche" (3 peças de papel de cada lado). Rolar uma vareta de plástico na superfície da mancha, para remover eventuais bolhas de ar.
  4. Coloque a mancha entre duas almofadas de mata-borrão e, em seguida, na cassete borrar. Monte o cassete no módulo de mata-borrão, encher a câmara com RB e procure a orientação correta (membrana de nylon deve ficar entre o gel eo terminal positivo).
  5. Transferir a 20 V durante 20 min. Nota: para garantir condições homogêneas, depois de 10 min abrir o módulo de mata-borrão e rotate o sanduíche em 180 ° antes de completar a transferência.

7 Membrana reticulação

  1. Prepare a 6 ml de solução de reticulação fresco (XLS). Saturar com 10 cm x 10 cm (maiores do que uma membrana de nylon) pedaço de papel mata-borrão com XLS. ATENÇÃO! HCl (um componente de XLS) é altamente corrosivo.
  2. Desmantelar o blot e colocar a membrana sobre o papel de filtro 3MM molhado. Nota: RNA não deve estar em contato direto com o papel saturada. Colocar o filtro eo papel entre duas placas de vidro e enrole em Saran-wrap.
  3. Aquece-se a membrana a 60 ° C durante 2 horas, seguido por uma lavagem ddH2O. Armazenar a -20 ° C ou prosseguir para a hibridação.

8 Membrana pr�hibrida�o

  1. Se RNA carregamento tenha sido verificado (etapa opcional 5.5), vá diretamente para a hibridização. Ou então, cortado distância de 1 cm para a parte superior do filtro de nylon, a fim de evitar sonda cruzada hybridizations a RNAs longos fraccionados.
  2. Pré-aqueça 10 ml de solução de hibridação (HS) a 37 ° C. Desnaturar um mg de esperma de salmão a 95 ° C durante 5 min, em gelo frio e adicionar a SH.
  3. Incubar o filtro em HS a 37 durante pelo menos 1 hora, sob rotação, em um forno de hibridação. Verifique se o RNA-side do filtro enfrenta HS.

9 Probe Synthesis

  1. Configurar uma reação direta de fosfato em 10 pmol de oligonucleotídeo antisense específico, conforme descrito no item 4.3.
  2. Adicionam-se 5 volumes de Tris-EDTA-NaCl (RT) para o tampão de reacção e purifica-se o iniciador marcado de nucleótidos não incorporados por cromatografia de exclusão em gel numa coluna de Sephadex G-25 (ou também por precipitação de EtOH). Sonda actividade pode ser avaliada por cintilação líquida contador.

10 Membrana Hibridização

  1. Substitua o HS exausto com um novo 10 ml alíquota (preparado e complementado conforme descrito acima). Aqueça a sonda em95 ° C durante 10 min, em gelo fresco e adiciona-se a novos HS. Incubar o filtro a 37 ° C NA.

11 Membrana de lavar

  1. Recuperar a solução de hibridização e armazená-lo a -20 ° C numa caixa de blindagem de radioactividade.
  2. Lave o filtro em tampão de lavagem (WB) e lave-o bem por 10 minutos em temperatura ambiente.
  3. Use um Geiger Mueller Detector para verificação radioatividade residual nos cantos de filtro. Quando a emissão de fundo é de cerca de 5 cps, proceder à membrana exposição.

Detecção de Sinal 12

  1. Exponha o filtro em filmes de autorradiografia ou na tela de um gerador de imagens molecular ON. Revelar sinais por processamento fotográfico ou conversão digital.
  2. Analisar a intensidade da banda por software quantificação dedicado (ImageJ ou Optiquant).

13 Membrana Stripping

  1. Para remover sinais primários, submergir a membrana em 500 mL de solução de decapagem de ebulição, Em seguida incubar à temperatura ambiente durante 1 min. Proceder-se a novos (pré) hibridação ou armazenar o filtro a -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Seguindo o procedimento geral descrito no texto e esquematicamente representado na Figura 1, avaliou-se a expressão pequenos RNAs de amostras de ARN de complexos de diferentes origens. Na experiência apresentada na Figura 1, o RNA foi isolado a partir de duas células de Schneider de Drosophila por proteinase K, extracção controlados quanto à integridade (passo opcional: desnaturação de fraccionamento em gel de agarose) e carregado em duas vezes. Uma metade do gel foi transferido para uma membrana neutra e quimicamente reticulada de EDC; a segunda metade foi transferida através de um filtro de nylon carregada positivamente, então UV reticulado (1,2 x 10 5 μJ / cm 2). A expressão endógena de dois microRNAs pertencentes à família DMEL-miR279 (si DMEL-miR279 e DMEL miR286-15) foi verificado em ambas as condições. O melhor procedimento (ENB) garante maior respeito sensibilidade para o padrão (SNB).

Figuras 2 e 3. A lógica experimental é o mesmo que o anterior: aqui relatamos o resultado representativo de Northern Blot detecção autoradiográfica do rasi4 piRNA ao longo de uma titulação de RNA total extraído de adulto testículos voar. ENB já permite detectar uma banda específica, quando 0,5 ug de ARN é carregado. A quantificação de lado mostra a forma como o sinal aumenta proporcionalmente com a quantidade de RNA fraccionado, indicando que a razão de dose / resposta reside na gama linear de detecção. O painel abaixo ratifica a maior sensibilidade deste método em relação ao SNB. Neste caso, um sinal detectável é obtida após fraccionamento por electroforese de 10 ug de ARN de, pelo menos, para o BNS.

Resultados semelhantes são obtidos com diferentes espécies de ARN, por exemplo, não-codificante, 5s do rRNA, como apresentado na Figura 3 </ Strong>.

Figura 1
Figura 1 representação esquemática do procedimento geral de transferência de Northern. Principais etapas processuais são listados e numerados progressivamente. Os resultados são comparados entre o avançado Blot Norte (ENB) e Standard Northern Blot (SNB), realizado em mesmas condições: isolamento de RNA a partir de 2 células de Drosophila Schneider (Painel 1), eletroforese (Painel 2), transferência (Painel 3) e hibridização ( Painel 5). ENB refere-se ao melhor procedimento descrito neste relatório, o que requer um filtro neutro (Painel 3, a metade esquerda da membrana) e reticulação com base em EDC (Painel 4) que estabelece uma ligação entre o RNA alvo 5'-end e membrana covalente ( pontos-de-rosa no Painel 4). Em SNB, ARN de reticulação é obtida por tratamento com UV (painel 4) em um carregado positivamente nylon membrana (Painel 3, a metade direita da membrana). 5s RNA sinal específico não é um calibrador em condições comparativas, pois ele também responde a diferenças entre SNB e procedimento ENB. Assim, numa quantidade (que corresponde a 10 cps) de uma 5'-rotulado (ver pontos 4.3 e 4.4 do protocolo), 50 nt de comprimento mexidos oligonucleótido foi adicionado a cada amostra antes da electroforese, para funcionar como um "pico de" referência ( Painel 7). Carregando pode também ser avaliado por EtBr coloração on-gel de rRNAs longos (ver ponto 5.5 do protocolo). L = Escada. FV = Frontal View, LV = Lateral View, HV = Horizontal View. Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2. Comparoperatória análise de mancha de Northern da expressão rasi4. níveis endógenos da piRNA rasi4 específico do testículo são revelados por reforçada (ENB) ou padrão (SNB) de transferência de Northern, efectuada em quantidades crescentes de ARN total (indicado por cima de cada pista) extraído de testículos de adulto de Drosophila , ou a partir de abdómens inteiros (ABD). Para cada método, histogramas de lado relatar as quantidades relativas de rasi4 respeito à mesma quantidade de um "pico de" controlo de carga. Quantificações dos dois métodos são combinados no gráfico conclusivo colocado abaixo dos géis. Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura análise comparativa 3 Northern Blot de 5s rARN de expressão. Como um controlo positivo e calibração experimental, análise anterior foi alargada a 5s do rRNA. Detalhes como na Figura 2. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Embora a nossa apreciação do sofisticado entrelaçamento por meio do qual o RNA regula a neurogênese é cada vez maior, as implicações mecanicistas de circuitos baseados no RNA que afetam a biologia neural de células-tronco, a diferenciação neuronal / integração funcional, desenvolvimento de patologias neurais e cânceres permanecem inexplorados. A manutenção dessas redes através de reinos faz com que o potencial dos sistemas genéticos como Drosophila melanogaster instrumental para desvendar caminhos celulares inexploradas, em que RNAs não-codificantes curto e fatores de transcrição são considerados como os principais jogadores moleculares. Nessa visão, o perfil dos candidatos pequenos níveis de expressão de RNA é propedêutico para análises funcionais precisos: um exemplo vem da nossa recente demonstração de que DMEL-miR279 modula o destino determinante GCM / glide in vivo, realizado por meio de uma versão melhorada do ensaio Northern Blotting como uma ferramenta para análise de expressão.

51, NB tem sido considerada como um método de referência para a análise de RNA. Apesar de algumas limitações intrínsecas deste ensaio, como a conversão difícil para Multiplex erros de formatação ou possíveis com a quantificação do sinal, os avanços recentes em biologia molecular RNA ter redescoberto esta técnica convencional como um sistema "rápido e limpo" para ensaiar a expressão endógena de pequeno ribonucléico ácidos ou para validar a eficácia das abordagens gain- ou perda de função. Como exemplo paradigmático, a análise do Norte coloca na base da descoberta original de microRNAs, ao passo que a abordagem se mantém na vanguarda por sua relevância na caracterização de sempre novas propriedades de RNAs regulatórios 52.

A variante aqui descrita baseia-se no aumento da sensibilidade devido a reticulação química de ARN. Nós believethe método ainda é pouco empregada em Drosophila, but quando explorada conduziu a importantes descobertas 52, uma vez que torna possível a expressão de ARN de perfis a partir de amostras pequenas (menos do que 1 ug), com uma melhoria de 10-30 vezes média de detecção de alvos de ARN 41,43, como obtido nas nossas condições (Figuras 2 e 3).

A integridade de ARN constitui um problema crítico para a obtenção de resultados consistentes e reproduzíveis. Manipulações RNA exigem precisão e rapidez para limitar uma possível degradação da amostra ocorre entre extração e carregamento. Por este propósito, todas as soluções devem ser diethylpyrocarbonate- (DEPC) tratado antes de utilização (2 horas de incubação na presença de 0,1% de DEPC a 37 ° C e, em seguida autoclavado) para contornar a actividade de ARNase. Solução de tratamento garante melhor resultados respeito ao uso de água como solvente DEPC. Todo o equipamento vai ser igualmente enxaguado em DEPC ddH20, depois da limpeza por uma superfície específica descontaminante-RNase.

(por exemplo, rasi4, Figura 2) ou quando a purificação de ARN não é realizada em amostras frescas (por exemplo, armazenamento em tecido preservado reagentes). A partir da experiência, o isolamento de RNA a partir de amostras estabilizadas resultou significativamente mais duras e necessárias condições de extração mais drásticas. Em condições normais, o método baseia-Proteinase K descrito garante preparações de boa qualidade, bem como, (um exemplo significativo está representada na Figura 1), mas não é a escolha óptima para as amostras conservadas em reagentes de armazenamento.

Finalmente, uma vez que este processo tem por objectivo a detecção específica de ARN pequenos, baseada em kits de purificação de coluna dedicada pode ser utilizada para o isolamento de RNA pequeno directa, embora thé torna mais difícil de verificar a integridade do RNA. Em alternativa ao processo à base de gel clássico de controlo da integridade de ARN descrito acima, a qualidade do RNA pode ser avaliada por instrumentos de análise on-chip miniaturizado de padrões de ácidos nucleicos.

Tampão de Escolha: MOPS-NaOH (pH 7) foi proposto como um tampão preferencial para electroforese em gel de Northern blotting e reforçada. Também usado satisfatoriamente-borato-EDTA Tris tampão (TBE) em nossos experimentos. Neste caso, uma vez que a presença de grupos amina nucleófilo de Tris (hidroximetil) aminometano se hidrolisar e inactivar DEPC durante o tratamento em si, recomenda-se a dissolução de Tris em água tratada com DEPC em vez de tampão TBE tratamento já preparado.

Electrophoretic Run e Blotting: Pré-executar o gel é essencial para remover o excesso de persulfato e eliminando hyperfocusing. Parâmetros pré-execução também deve ser mantida durante o fraccionamento, evitando electropho muito rápidorun retic. Antes de carregar, certifique-se de remover possíveis sedimentos de uréia a partir de poços, esguichando tampão dentro. Isto limitará amostra spill-over e garantias estratificação RNA precisas, produzindo bandas autoradiográficos resolvidos durante a detecção de sinais. Qualquer membrana de nylon neutro pode ser usado como um suporte para a transferência de ácido nucleico. Não blot do ARN por mais de 20-30 minutos nas condições especificadas.

A reticulação: reticulação química com base em EDC representa o avanço metodológico crítica desta versão melhorada de transferência de Northern. A possibilidade de ligação cruzada de espécies de RNA curto para superfícies limites neutros por covalentes entre o grupo ARN 5'mono-fosfato e nylon aminas primárias deixa a maioria de bases disponível para hibridação. Isso melhora a sensibilidade por 10-20xrespect a reticulação tradicional. É crucial para preparar quantidade fresca da solução de reticulação de cada blot, em quantidade suficiente para a saturação da membrana adequada.

A hibridação e lavagem: As sondas devem ser de preferência recém marcado. Sonda actividade específica (dependente da actividade especifica e quantidade de nucleótido marcado radioactivamente incorporado e também da quantidade de sonda disponível para hibridização) determina a sensibilidade de detecção do alvo. Quando [γ- 32 P] ATP, com uma actividade específica de 3000 Ci / mmol é usado, é esperado 10 6 cpm / pmol para 100% de rotulagem da extremidades 5 '.

A solução de hibridação pode ser recuperado e re-utilizado, considerando-se que, devido ao 32 P decaimento, metades de actividade sonda em cerca de 14 dias.

Devido à neutralidade membrana, baixo nível de ruído de fundo é esperado após hibridação. Se forem necessárias condições de lavagem mais rigorosas, reduzir progressivamente tampão de lavagem força iônica (até 0.2x SSPE) ou adicionar quantidades crescentes de detergentes iônicos (até 0,5% SDS) ou elevar a temperatura de lavagem a 37 ° C.

A análise de Northern blot é essencial quando a medição de tamanho de ARN é necessária. Mesmo que este ensaio pode não ter a precisão de qPCR baseado em fluorescência abordagens para a estimativa de pequenos RNAs, uma vantagem deriva usando desnaturação fracionamento / borrar e hibridação dependente da sonda como etapas únicas antes detecção de RNAs alvo. Consequentemente, a revelação de sinais específicos da amostra é direto e não exige nenhuma etapa adicional de tratamento enzimático / conversão / amplificação, o que implicaria o uso de kits comerciais dedicados. Os níveis de ARN pode ser quantificada e comparada entre múltiplas amostras em membranas individuais. Assim Northern blot é comumente empregada como uma validação rigorosa para os dados de qPCR. Estimulados por requisitos experimentais específicos, o método tem sido ainda melhorado ao longo dos últimos anos, tanto a nível de sensibilidade e resolução de modo a que a quantidade limitada de ARN (ver Figuras 2 e 3) são necessários para a análise bem sucedida.

O protocolo que pode ser apresentado adaptado a uma ampla gama de aplicações, especialmente em que o material está disponível em quantidades limitadas. A fonte biológica de amostras de ARN podem ser heterogéneos: tanto quanto Drosophila está em causa, embriões ou outras fases de desenvolvimento são apropriados, mas também dissecada manualmente tecidos ou órgãos, células individuais isoladas de triagem-citotipos ou culturas celulares.

Além disso, embora microRNAs são a classe mais abundante de RNAs reguladores curtas na célula e importante assunto de investigação no campo do controlo de expressão do gene mediada por ARN, que não faça contrastitute a única família de RNAs não codificadores celulares. Muitos grupos de pequenos RNAs funcionar através de reinos (por exemplo, siRNAs endógenos, piRNAs, snoRNAs, planta tasiRNAs) ea maioria deles são caracterizados a partir de um livre 5 '(sem modificações), geralmente decorrente do processamento de endo-ribonucleolítica de moléculas precursoras. Esta característica constitui o pré-requisito estrutural original estritamente necessária para a aplicação da metodologia melhorada específica com base na reticulação química, embora o tamanho de ARN tem de ser considerada, assim, quando se analisam os ARN mais longos. Na Figura 2 apresentamos uma análise de Northern Blot comparativamente detectar os níveis de rasi4 54 um membro de uma classe de germe específico da linha de pequenos RNAs (RNA ou piRNAs Piwi-interagindo.) Em condições de níveis de expressão pobres e específicos, a maior sensibilidade deste método pode punir bons resultados, especialmente considerando que o protocolo relatado pode ser ainda melhorada por penteining-lo com outras implementações práticas já descritas na literatura 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Este trabalho foi apoiado pelo Institut National de la Santé et de la Recherche Médicale, o Centre National de la Recherche Scientifique, da Université de Strasbourg, o Hôpital de Estrasburgo, a Associação pour la Recherche sur le Câncer, o Instituto Nacional do Câncer du, a Agence Nationale de la Recherche ea região da Alsácia.

Pietro Laneve tem sido apoiado pela Fondation pour la Recherche Médicale. Atualmente, ele é um receptor de um companheirismo Istituto Italiano Tecnologia (IIT). Os custos de publicação são suportados pela rede Neurex (TriNeuron - Programa Interreg IV Alto Reno)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics