Forbedret Northern Blot Påvisning av små RNA Arter i

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Målet med denne publikasjonen er å visualisere og diskutere de operative trinnene i en Enhanced Northern Blot protokollen på RNA hentet fra Drosophila melanogaster embryoer, celler og vev. Denne protokollen er spesielt nyttig for effektiv detektering av små RNA-arter.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De siste tiårene har vært vitne til eksplosjonen av vitenskapelig interesse rundt genuttrykk kontrollmekanismer på RNA-nivå. Denne grenen av molekylærbiologi har vært sterkt drevet av oppdagelsen av ikke-kodende RNA som store aktører i post-transcriptional regulering. Slik revolusjonerende perspektiv har vært ledsaget og utløst av utviklingen av kraftige teknologier for profilering kort RNA uttrykk, både på high-throughput nivå (genom-wide identifikasjon) eller som enkelt kandidat analyse (steady state akkumulering av spesifikke arter). Selv om flere state-of-art strategier er for tiden tilgjengelig for dosering eller visualisere slike flyktet molekyler, forblir Northern Blot analysen den kvalifiserte tilnærming i molekylærbiologi for umiddelbar og nøyaktig vurdering av RNA uttrykk. Det representerer et første skritt mot bruk av mer avanserte, kostbare teknologier og, i mange tilfeller, forblir en fortrinnsrett metode for enkelt å få innsikti RNA biologi. Her oversikten vi en effektiv protokoll (Enhanced Northern Blot) for å påvise svakt uttrykt micrornas (eller andre små regulatoriske RNA arter) fra Drosophila melanogaster hele embryoer, manuelt dissekert larver / voksen vev eller in vitro dyrkede celler. En meget begrenset mengde av RNA er nødvendig, og bruken av materiale fra flowcytometri-isolerte celler kan også tenkes.

Introduction

RNA biokjemi har opplevd spektakulære utvikler de siste årene en. Vår forståelse av RNA potensial i kontroll av genekspresjon er sprengt ved identifisering av effektive ikke-kodende ribo-regulatorer 2, av oppdagelsen av nye RNA-baserte regulatoriske mekanismer 3,4 og ved en dypere karakterisering av allerede kjente post-transkripsjonelle arrangementer 5. Alle sammen disse studiene har tillatt RNA biologi å dramatisk gjøre scenen, blir et stort forsknings emne i dagens vitenskapelige landskapet. Spesielt de siste årene får vi en følelse av gjennomgripende påvirkning av "RNA verden" på molekylær nevrobiologi 6, en av de mest dynamiske forsknings domener i moderne life science. I det siste tiåret av forrige århundre, har den samlede vitenskapelige scenario blitt revolusjonert av oppdagelsen av RNA-interferens 7,8 og av de små regulatoriske RNA 9,10med særlig hensyn til micrornas 11, endogent uttrykt små ikke-kodende RNA er implisert i kontrollen av nesten alle cellulære funksjoner som mitogen og kombinatoriske regulatorer av genekspresjon.

Nesten 10 år etter at miRNA første oppdagelsen i Caenorhabditis elegans med Ambros og Ruvkun laboratorier, ble fornyet oppmerksomhet slått til feltet når høyt antall mirnas ble identifisert i Drosophila og i humane celler samt 12-15. Siden da, takket være allsidige transgene nærmer seg, har Drosophila melanogaster sto ut som et verdifullt biologisk kontekst for hulene i miRNA biosyntese og aktivitet. Drosophila mirnas har avdekket distinkte funksjoner i insekt-spesifikke eller evolusjonært konserverte prosesser, som spenner fra aldring til metabolisme, signalveier , oppførsel og, selvfølgelig, nevrogenesen. Langs denne retningen, vi nylig avduket en roman kobling 16 i den spennende correlation oppstår mellom master genet GCM / gli og RNA sti. Flua transkripsjonsfaktor GCM / Glide 17-19 utgjør et unikt eksempel på celle skjebne determinant, som dikterer glial vs nevronale skjebne valg i multipotent fly nevrale forløpere 20. Tjue år lang forskning på dette temaet har tydelig understreket forekomsten av flere og overlappende tilførsler av genuttrykk regulering konvergerende løpet GCM / glir 21-28 å etablere terskelnivå for å balansere den delikate forholdet mellom nevronale og glial kolleger under nevral utvikling.

Vi oppdaget at regulering via DMEL-miR279 målretting representerer en ytterligere kontrollnivå bidrar til post-transcriptional finjustering av GCM / glir uttrykk 16. Globalt har disse forsknings linjer som kreves konkrete metodiske forbedringer: langs år, flere teknologier opprinnelig utviklet for å analysere traditional RNA har blitt konvertert for å kvantifisere små ikkekodende RNA, som som RNase beskyttelse analyser, cDNA arrays 29-31, real-time PCR-metoder 32-35 og sekvenser 36,37. På den andre siden, har kalibrering av tekniske tilnærminger fostret kontinuerlige utvikler i felten.

Northern blot-analyse (NB, eller RNA gel blot-analyse) utgjør et representativt eksempel: det er i stor grad anvendt for å profilere RNA-akkumulering, siden den sikrer både uttrykket nivået kvantifisering samt størrelsen bestemmelse. Imidlertid er den iboende dårlig sensitivitet for metoden begrensende når det skal anvendes til lav-rike genekspresjon fin-mottakere, slik som korte RNA. En ugunstig konsekvens er kravet om store mengder av total-RNA, som gjør vanskelig dens anvendelse til spesifikke biologiske prøver. Av slike grunner, spesifikke NB varianter for små RNA deteksjon er utviklet 38-40: vi tok fordel av en forbedret NB procedure 41 (ENB, Enhanced Northern Blot), mens belyse ovennevnte samspillet mellom DMEL-miR279 og GCM / glid.

Denne fremgangsmåte er avhengig av en kjemisk kryssbindingstrinn basert på aktiviteten av et karbodiimid-derivat [1-etyl-3 (3-dimetylaminopropyl) karbodiimid, EDC] for å feste nukleinsyren til faste bærere. Karbodiimid er et allsidig kryssbindings kjent for å katalysere dannelsen av amidbindinger mellom aktiverte karboksyl-eller fosfat-grupper og amingrupper 42. Denne egenskapen kan utnyttes for å kovalent par små RNAer via deres mono-fosforylert 5'-hydroksylgruppen til aminogrupper på overflaten av nylonmembraner. Det resulterende feste konfigurasjon øker tilgjengeligheten av den immobiliserte nukleinsyre og, i sin tur, effektiviteten av probe-target-hybridisering, som resulterer i påvisning bemerkelsesverdig forbedring 43.

Teknikken foruts bestemt relevance i Drosophila molekylære studier, der forekomsten av nye og særegne klasser av små ikke-kodende RNA fremstår 44. Blant disse rasirnas 45,46 utgjør en bestemt subtype av piwi-samspill RNA (piRNAs 47), som er involvert i sekvens-spesifikke genet demping. Operative detaljer ved denne metoden er fullstendig beskrevet i det følgende og visualisert, i forhold til analysen av micrornas DMEL-miR279 og DMEL-miR286 og, for første gang, på en rasiRNA, rasi4. Vi satt på spissen denne metoden, som tillot oss å avsløre dårlig uttrykt mål fra minimale mengder RNA (mindre enn 1 mikrogram).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Prøvetaking

  1. Løsne semi-tilhenger Schneiders to celler, (1-5 x 10 6 celler i gjennomsnitt), ved pipettering og høste dem ved sentrifugering (100 xg i 1 min). I tilfelle av in vitro dyrkede adherente celler, trypsinize dem i standardforhold eller direkte samle dem fra platene i en passende mengde av RNA-ekstraksjon reagens, ved hjelp av en celleskrape.
  2. For embryo samling, vokse Drosophila stammer i flue bur og la embryoer samle på egg legging plater. Tørk embryoer av ved en pensel i destillert vann (dH 2 O), forkaste rusk av sil filtrering, skyll og gjenopprette embryoer i et hetteglass 48.
  3. Som en alternativ teknikk, manuelt dissekere vev / organer. Isoler testes (en preferansesystem for Pirna analyse) fra Drosophila abdomen i fosfatbufret saltvann (PBS) under et stereomikroskop (forstørrelse 20X), ved hjelp av nåler eller disseksjon Pinsettang visualized i Sullivan et al 49.
  4. Støter homogen prøvene ved avhengighet av 0,5 volumer av RNA ekstraksjon reagens.

2. RNA Utvinning / Analyse

  1. Følgende produsentens instruksjoner utføre RNA isolering gjennom kommersielle reagenser. FORSIKTIG! RNA utvinning agenter er vanligvis giftig og etsende. Alternativt bruke en proteinase K-basert protokoll for RNA isolering 50, som følger:
    1. Fortynn prøvene inn i 400 pl av stopp Bland og inkuber ved romtemperatur i 15 min.
    2. Gjenopprette vannløse komponenter ved standard fenol: kloroform: isoamylalkohol og kloroform ekstraksjon og ved etanol (EtOH) nedbør / vask. Air tørke prøvene og resuspender inn diethylpyrocarbonate (DEPC) behandlede dobbelt destillert (dd) H 2 O.
  2. Vurdere RNA konsentrasjon av UV spektrofotometrisk måling. Også sikre at RNA renhet er høy, nær 2,0, based på A 260 / A 280 lesing.
  3. Kontroller RNA-preparatet på denaturerende agarosegel som følger:
    1. I et rent begerglass, oppløses 1,2 g agarose i 82 ml DEPC-DDH 2 O, under kontinuerlig omrøring. Kok til det er helt oppløst.
    2. La gelen løsning for å kjøle ned; Når temperaturen når 60 ° C tilsettes 10 ml 10X 4-morpholinepropanesulfonic syre (MOPS) buffer til 1X sluttkonsentrasjon (FC), og 8 ml 37% formaldehyd til 3% FC. FORSIKTIG! Formaldehyd er et karsinogen.
    3. Hell gelen inn i en horisontal elektroforese celle. La gelen til å størkne under en hette i minst 1 time. Etter herding, senk gel inn MOPS 1X.
    4. Delmengde 2 ug av RNA-prøven og 1 ug Stige (bruke et RNA-markør når nøyaktig evaluering er ønsket). Tilsett 3 volumer av agarose lasting fargestoff (ALD) til RNA og å stige. Oppvarm til 70 ° C i 5 min og øyeblikkelig avkjøles på is. CAUtion! Innhold av ALD (etidiumbromid og formamid, se Materialer) er mutagen og etsende, henholdsvis.
    5. Last inn prøvene og kjøre gel ved 50 V i ca 1 time med sporadiske buffer resirkulering. Sjekk RNA fraksjone oppskriften ved UV visualisering eller gel imaging. Gjenkjenne diskrete band som tilsvarer 28S og 18S rRNAs og til tRNAs (se figur 1).
  4. Fortsett til Nord-analyse eller butikken RNA ved -80 ° C.

3. Denaturing akrylamidgel Forberedelse

  1. Bruk en liten vertikal elektrofore apparat for denne fraksjonering trinn (platestørrelse ca 8 cm x 9 cm, kam tykkelse 0,75 mm).
  2. Monter rene glass sammen i en støperamme.
  3. Forbered 10 ml av 10% akrylamid / bis-akrylamid (19: 1) oppløsning i MOPS 1X, 7 M urea. Umiddelbart før helling, tilsett 100 pl av 10% ammoniumpersulfat og 10 ul TEMED og raskt blande løsningen. FORSIKTIGAkrylamid! Er nevrotoksisk og kreftfremkallende.
  4. Hell geleen mellom glassplater og sett godt kam forsiktig for å unngå bobler. La gelen polymerisere ved romtemperatur i minst 45 min før bruk. Alternativt, lagre gel O / N, innpakket i vann-gjennomvåt filterpapir og forseglet i Saran wrap.

4. Prøvepreparering

  1. Delmengde 0,5 til 20 mikrogram av total RNA for hver prøve. Hvis volumet overstiger 3-4 mL, vakuum tørke prøven.
  2. For størrelse besluttsomhet, kjøre en delmengde (20-30 cps) av radiomerket lav-range stige parallelt med prøvene, som en markør (se avsnitt 4.3 og 4.4 for forberedelse). Behandle det i parallell til prøvene, som beskrevet i trinn 4.5.
  3. Stige: sette opp en fosfat frem reaksjon ved hjelp av 0,1 mikrogram av en 10 bp-steg stige. Inkuber ved 37 ° C i 30 minutter og stopp reaksjonen ved tilsetning av etylendiamintetraeddiksyre (EDTA) til 20 mM FC.
  4. Rens ved EtOH nedbør / vask, lufttørke ogresuspender i DDH 2 O (ca. 100 ul). FORSIKTIG! 32 P er en radioaktiv kilde.
  5. Til hver prøve tilsettes samme volum av akrylamid blått fargestoff (ABD). Denaturere ved oppvarming til 80 ° C i 5 min og kjølig på is inntil lasting. FORSIKTIG! Formamide (innhold i ABD) er etsende.

5. Elektrofraksjone

  1. Fjern glassplatene fra støpe støtte og montere dem på riktig måte i elektroforese cellen. Fyll både indre og ytre kammer med tilstrekkelig Running Buffer (RB).
  2. Fjern forsiktig kammen og pre-gelen drives ved 200 V i 10 min. Før du legger inn prøver, vaske bort urea innskudd fra brønnene ved squirting noen RB gjennom en sprøyte.
  3. Bruk en flat tips å nøye stratifisere prøver fra trinn 4.5 i bunnen av hver brønn. Sjekk anoden og katoden tilkoblinger for å unngå invertert kjører. Etter at prøvene går inn i gelen ved 100 V i 5 min, increase spenningen til 200 V.
  4. For en fraksjone lengde på ca 7 cm, er en 45 min lang sikt tilstrekkelig. Unngå bromfenolblå (en sporings pigment i ABD) å renne over gelen.
  5. Visual on-gel de fraksjon lange RNA ved etidiumbromid (EtBr) flekker, som et valgfritt trinn:
    1. Skjær bort 2 cm fra toppen av gel og kort skyll stykket i DDH 2 O.
    2. Inkuber gel skive ved RT i 15 min med forsiktig shacking i RB, EtBr 0,5 mikrogram / ml FC.
    3. Destain gelen for 15 min i RB, visualisere lange rRNAs av UV-bestråling eller gel imaging. Sjekk for RNA lasting og kvalitet (se figur 1, Panel 7). FORSIKTIG! Etidiumbromid er et mutagen.
  6. I mellomtiden fortsetter blotting den nedre delen av gelen som inneholder små RNA arter.

6. Gel Blotting

  1. Skjær 6 stykker av trekkpapir for å passe blotting området og en tilsvarende stykke uncharged nylon membran. Fukt papirark, membran og 2 blotting pads i RB. Sørg for å helt suge pads ved gjentatte ganger å klemme dem i RB.
  2. Fjern gel fra apparatet og åpne glassene av gjennomsnittet av en slikkepott. Bruk en ren cutter å fjerne brønnene. Plasser et ark med vått Whatman papir på gel og forsiktig løfte den opp.
  3. Plasser nylonmembran på den frie overflaten av gelen. Markere et hjørne for å orientere filteret i henhold til prøven lasting. Fullfør "sandwich" (3 papir stykker hver side). Rull en plaststav på blot overflate, for å fjerne mulige luftbobler.
  4. Plasser blot mellom to blotting pads og deretter i blotting kassett. Monter kassett i blotting modul, fylle kammeret med RB og sjekk for riktig retning (nylon membran må bo mellom gelen og den positive terminus).
  5. Overføring ved 20 V i 20 min. Merk: For å sikre homogene forhold, etter 10 min åpne blotting modul og rRoter med sandwich ved 180 ° før du fullfører overføringen.

7. Membran Crosslinking

  1. Forbered 6 ml friskt Crosslinking Solution (XLS). Mette en 10 cm x 10 cm (større enn nylon membran) stykke trekkpapir med XLS. FORSIKTIG! HCl (en komponent av XLS) er sterkt etsende.
  2. Demonter blot og plassere membranen på den våte 3MM filterpapir. Merk: RNA må ikke være i direkte kontakt med det mettede papir. Plasser filteret og papir mellom to glassplater og pakk i Saran-wrap.
  3. Varm membranen ved 60 ° C i 2 timer, etterfulgt av en DDH 2 O vasking. Oppbevar ved -20 ° C eller gå videre til hybridisering.

8. Membran Prehybridization

  1. Hvis RNA lasting har blitt sjekket (valgfritt trinn 5.5), direkte videre til hybridisering. Ellers, skjære bort 1 cm fra til toppen av nylonfilter, for å unngå kryss-sonde hybridiseringns til fraksjon lange RNA.
  2. Forvarm 10 ml Hybridization Solution (HS) ved 37 ° C. Denaturere 1 mg laksesperma ved 95 ° C i 5 min, avkjøles på is og tilsett til HS.
  3. Inkuber filteret i HS ved 37 ° C i minst 1 time under rotasjon i en hybridiserings-ovn. Kontroller at RNA-siden av filteret vender HS.

9. Probe Synthesis

  1. Sett opp en fosfat forover reaksjon på 10 pmol av spesifikt antisense-oligonukleotid, som beskrevet i 4.3.
  2. Tilsett 5 volumer av Tris-EDTA-NaCl (TEN) buffer til reaksjonsblandingen og rense merkede primer fra unincorporated nukleotider ved gel utelukkelse kromatografi på G-25 Sephadex-kolonner (eller også ved EtOH utfelling). Probe-aktivitet kan vurderes ved væskescintillasjonsteller.

10. Membran Hybridisering

  1. Sett på oppbrukt HS med en frisk 10 ml aliquot (fremstilt og kompletteres som beskrevet ovenfor). Varm opp sonden på95 ° C i 10 min, avkjøles på is og legge til nye HS. Inkuber filteret ved 37 ° C på.

11. Membran Vasking

  1. Gjenopprett hybridiseringsoppløsningen og lagre det ved -20 ° C i et radioaktiviteten-skjermingsboksen.
  2. Skyll filteret i vaskebuffer (WB) og vask det grundig i 10 min ved RT.
  3. Bruk en Geiger Mueller Detektor for å sjekke rest radioaktivitet ved filteret hjørnene. Når bakgrunnen utslipp er rundt 5 CPS, fortsett til membran utstilling.

12. Signal Detection

  1. Expose filteret på Autoradiografi filmer eller på et molekylært imager på skjermen. Avslør signaler ved fotografiske behandling eller digital konvertering.
  2. Analyser bandet intensiteten av dedikerte kvantifisering programvare (ImageJ eller Optiquant).

13. Membran Stripping

  1. For å fjerne primærsignalene, dyppe membranen i 500 ml kokende løsning Stripping, Og deretter inkuberes ved RT i 1 min. Fortsett til romanen (pre) hybridisering eller lagre filteret ved -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ved å følge den generelle fremgangsmåte som er beskrevet i teksten, og er skjematisk representert på figur 1, vurderte vi små RNA ekspresjon fra komplekse RNA prøver av forskjellig opprinnelse. I forsøket vist i figur 1, ble RNA isolert fra Drosophila Schneider 2 celler etter Proteinase K ekstraksjon, sjekkes for integritet (valgfritt trinn: denaturerende agarosegel-fraksjonering), og som er lagt i dobbelt. Halvparten av gelen ble blottet på en nøytral membran og kjemisk tverrbundet ved EDC; den andre halvparten ble overført på en positivt ladet nylon filter, deretter UV tverrbundet (1,2 x 10 5 μJ / cm 2). Den endogene uttrykk for to micrornas tilhører DMEL-miR279 familie (DMEL-miR279 selv og DMEL-miR286 15) ble bekreftet i begge forhold. Den forbedrede prosedyren (ENB) sikrer høyere sensitivitet i forhold til standard en (SNB).

figurene 2 og 3. Den eksperimentelle rasjonale er den samme som ovenfor: her rapporterer at det er representativt resultat av Northern Blot autoradiografisk påvisning av Pirna rasi4 langs en ​​titrering av det totale RNA ekstrahert fra voksne testikler fly. ENB allerede kan oppdage en bestemt bandet når 0,5 mikrogram av RNA er lastet. Kvantifiseringen side viser hvordan signalet øker proporsjonalt med mengden av fraksjonert RNA, noe som indikerer at den dose / respons-forhold ligger i lineær rekke deteksjon. Panelet nedenfor godkjenner den forbedrede følsomhet av denne metoden i forhold til SNB. I dette tilfellet er et detekterbart signal som oppnås ved elektroforefraksjonering av 10 ug RNA i det minste for SNB.

Lignende resultater oppnås med en annen ikke-kodende RNA-arter, for eksempel, 5S rRNA, som rapportert i figur 3 </ Strong>.

Figur 1
Figur 1. Skjematisk fremstilling av den samlede Northern Blot prosedyre. Hovedprosedyresteg er oppført og progressivt nummerert. Resultatene er sammenliknet mellom Enhanced Northern Blot (ENB) og Standard Northern Blot (SNB), utført i samme forhold: RNA isolasjon fra Drosophila Schneiders 2 celler (panel 1), elektroforese (Faggruppe 2), transfer (Panel 3) og hybridisering ( Panel 5). ENB refererer til den forbedrede fremgangsmåte som er beskrevet i denne rapporten, noe som krever et nøytralt filter (panel 3, venstre halvdel av membranen) og EDC-basert tverrbindings (Panel 4) som etablerer en kovalent binding mellom target RNA 5'-ende og membranen ( rosa prikker i Panel 4). I SNB, blir RNA tverrbinding oppnås ved UV-behandling (Panel 4) på ​​en positivt ladet NYLOn membran (panel 3, høyre halvdel av membranen). 5s RNA spesifikke signalet er ikke en kalibrator i sammenlignende forhold, fordi den svarer også til forskjellene mellom SNB og ENB prosedyre. Således, en mengde (svarende til 10 cps) av en 5'-merkede (se punktene 4.3 og 4.4 i protokollen), 50 nt lange egge oligonukleotid ble tilsatt til hver prøve før elektroforese, for å fungere som en "pigg" referanse ( Panel 7). Laster kan også vurderes ved på-gel EtBr farging av lange rRNAs (se punkt 5.5 i protokollen). L = Ladder. FV = Frontal View, LV = Lateral View, HV = Horisontal View. Vennligst klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. ComparAtive Northern Blot analyse av rasi4 uttrykk. endogent nivå av testis-spesifikke Pirna rasi4 blir avslørt av forbedret (ENB) eller standard (SNB) Northern Blot, utført på økende mengder av total RNA (angitt ovenfor hvert kjørefelt) hentet fra voksne Drosophila testikler , eller fra hele underlivet (Abd). For hver metodikk, histogrammer til side rapportere de relative mengder av rasi4 hensyn til den samme mengden av en "pigg" loading kontroll. Kvantifiseringen fra de to metodene kombineres i avgjørende grafen plassert under gels. Vennligst klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Comparative Northern Blot analyse av 5s rRNA-ekspresjon. Som en positiv kontroll og eksperimentell kalibrering ble det foregående analysen utvides til 5S rRNA. Detaljer som i figur 2. Vennligst klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Selv om vår forståelse av sofistikert sammenflettingen der RNA regulerer neurogenesis er stadig økende, mekanistiske implikasjonene av RNA-baserte kretser påvirker nevrale stamcellebiologi, neuronal differensiering / funksjonell integrasjon, utvikling av nevrale sykdommer og kreft forbli uutforsket. Vedlikehold av slike nettverk gjennom riker gjør potensialet av genetiske systemer som Drosophila melanogaster instrumental å rakne uutforskede cellulære trasé, der kort ikke-kodende RNA og transkripsjonsfaktorer regnes som store molekylære spillere. I denne visningen, er profileringen av kandidat små RNA uttrykk nivåer propaedeutic til nøyaktige funksjonelle analyser: et eksempel kommer fra vår siste demonstrasjonen som DMEL-miR279 modulerer GCM / glide skjebne determinant in vivo, oppnådd gjennom en forbedret versjon av Northern Blotting analysen som et verktøy for ekspresjon analyse.

51, har NB vært ansett som en referansemetode for RNA-analyse. Til tross for noen iboende begrensninger i denne analysen, som den vanskelige omdannelse til multipleks-format eller mulige feil med signal kvantifisering, har nylige gjennombrudd i RNA molekylærbiologi gjenfunnet på konvensjonell teknikk som en "hurtig og rent" system for bestemmelse endogen ekspresjon av små ribonucleic syrer, eller til validering av effektiviteten av gevinst-eller tap-av-funksjon tilnærminger. Som paradigmatisk eksempel, legger Nord-analyse på grunnlag av den opprinnelige oppdagelsen av micrornas, mens tilnærmingen forblir i forkant for sin relevans i karakteriseringen av stadig nye egenskaper regulatoriske RNA 52.

Den variant som er beskrevet her er basert på økt følsomhet på grunn av kjemisk tverrbinding av RNA. Vi believethe metoden er fremdeles dårlig ansatt i Drosophila, bUT når utnyttet førte til betydelige funn 52, siden det gjør mulig profilering RNA uttrykk fra små prøver (mindre enn 1 mikrogram), med en gjennomsnittlig 10-30 ganger forbedring av RNA måldeteksjon 41,43, som vi har fått i vårt forhold (Tall 2 og 3).

RNA integritet utgjør et alvorlig problem for å oppnå konsistente og reproduserbare resultater. RNA manipulasjoner krever nøyaktighet og hurtighet for å begrense mulig sample degradering oppstår mellom utvinning og lasting. På dette formål er alle løsningene må være diethylpyrocarbonate- (DEPC) behandlet før bruk (2 timers inkubering i nærvær av 0,1% DEPC ved 37 ° C og deretter autoklavert) for å omgå RNase-aktivitet. Løsnings behandling garanterer bedre resultater når det gjelder å bruke DEPC vann som et løsningsmiddel. Alt utstyr vil bli like skylles i DEPC ddH20, etter rengjøring av en RNase-spesifikk overflate rengjøringsmiddel.

(f.eks rasi4, Figure2) eller når RNA-rensing ikke er utført på ferske prøver (for eksempel bevart i vev lagring reagenser). Fra erfaring, RNA isolering fra stabiliserte prøvene resulterte betydelig hardere og krevde mer drastiske utvinningsforhold. I standardbetingelser, den beskrevne Proteinase K-basert fremgangsmåte garanterer god kvalitet preparater i tillegg, (en signifikant eksempel er representert i Figur 1), men det er ikke det optimale valg for prøver bevart i lagrings reagenser.

Til slutt, siden denne fremgangsmåten tar sikte på å nes RNA spesifikk påvisning, dedikert kolonnerensing baserte sett kan anvendes for direkte små RNA isolering, selv om thIS gjør vanskeligere å verifisere RNA integritet. I alternativ til de klassiske gel-basert fremgangsmåte for RNA integritet kontroll som er beskrevet ovenfor, kan RNA kvalitet vurderes av instrumenter for on-chip miniatyrisert analyse av nukleinsyre-mønstre.

Buffer Choice: MOPS-NaOH buffer (pH 7) ble foreslått som en fortrinnsrett buffer for både Enhanced Northern gel elektroforese og blotting. Vi har også tilfredsstillende brukes Tris-borat-EDTA (TBE) buffer i våre eksperimenter. I dette tilfelle, siden nærvær av nukleofile amingrupper av Tris (hydroksymetyl) aminometan ville hydrolysere, og innaktivere DEPC under behandling i seg selv, er det anbefalt å oppløse Tris inn i DEPC-behandlet vann i stedet for behandling av TBE-buffer som allerede er fremstilt.

Elektrofore Run og Blotting: Pre-kjører gelen er avgjørende for å fjerne overflødig Persulfate og eliminere hyperfocusing. Pre-kjøreparametere bør opprettholdes også under fraksjonering, unngå for fort electrophoRetic løp. Før lasting, sørg for å fjerne mulige Urea sedimenter fra brønner, ved squirting buffer inne. Dette vil begrense utvalget spill-over og garantier nøyaktig RNA lagdeling, produsere løst autoradiografe band under signaler gjenkjenning. Enhver nøytral nylon membran kan brukes som en støtte for nukleinsyre overføring. Ikke blot RNA for mer enn 20-30 min på de angitte betingelsene.

Kryssbinding: EDC-basert kjemisk tverrbinding representerer den kritiske metodiske forkant av denne forbedrede Northern blot versjon. Muligheten for å tverrbinde korte RNA-arter til nøytrale overflater ved kovalente banen mellom RNA 5'mono-fosfatgruppe og nylon primære aminer etterlater størstedelen av baser tilgjengelig for hybridisering. Dette forbedrer følsomheten ved 10-20xrespect til tradisjonell kryssbinding. Det er viktig å tilberede frisk mengde av tverrbindingsløsning for hver blotting, i tilstrekkelig mengde for riktig membran metning.

Hybridisering og Vasking: Sonder bør helst være ferskt merket. Sonde spesifikk aktivitet (avhengig av den spesifikke aktivitet og mengden av innlemmet radioaktivt merket nukleotid, og også av mengden av probe for hybridisering) bestemmer følsomheten for måldetektering. Når [γ- 32P] ATP til en spesifikk aktivitet på 3000 Ci / mmol benyttes, er 10 6 cpm / pmol for 100% merking av 5'-ender forventet.

Hybridiser løsning kan gjenvinnes og gjenbrukes, tatt i betraktning at, som følge av 32 P råte, probe aktivitet halvdeler i ca 14 dager.

På grunn av membran nøytralitet, er lav bakgrunnsstøy forventet ved hybridisering. Hvis mer strenge vaskebetingelser er nødvendig, gradvis redusere vaskebuffer ionestyrke (opp til 0.2X SSPE) eller legge til økende mengder av ioniske vaskemidler (opp til 0,5% SDS), eller øke vasketemperaturen til 37 ° C.

Northern blot analyser er viktig når RNA størrelse måling er nødvendig. Selv om denne analysen kan mangle nøyaktigheten av fluorescens-basert qPCR tilnærminger for estimering av små RNA, stammer en fordel å bruke denaturering fraksjone / blotting og probe avhengig hybridisering som unike skritt før påvisning av målet RNA. Følgelig er åpenbaring av bestemte signaler fra prøven direkte og ikke krever noen ekstra trinn med enzymatisk behandling / konvertering / forsterkning, noe som ville innebære bruk av dedikerte kommersielle kits. RNA-nivåer kan kvantifiseres og sammenlignet mellom flere prøver på enkelt membraner. Dermed Northern blot er vanlig ansatt som en streng validering for qPCR data. Ansporet av spesifikke eksperimentelle krav, har metoden vært enda forbedret i løpet av de siste år, både på nivå av sensitivitet og oppløsning, slik at det begrensede mengde av RNA (se figurene 2 og 3) er nødvendig for vellykket analyse.

Protokollen vi presentert kan tilpasses en lang rekke anvendelser, spesielt hvor materialet er tilgjengelig i begrensede mengder. Den biologiske kilden for RNA-prøver kan være heterogen: så langt som Drosophila er opptatt, embryoer eller andre utviklingsstadier er egnet, men også manuelt dissekert vev eller organer, individuelle celler sortering-isolert cytotypes eller cellekulturer.

Videre, selv om micrornas er de mest tallrike klasse av korte regulatoriske RNA i cellen og stor gjenstand for undersøkelse i felten RNA-mediert gen-ekspresjon kontroll over, har de ikke ulemperpropell den eneste familien av cellulære ikke-kodende RNA. Mange klynger av små RNA fungere på tvers av riker (f.eks endogene sirnas, piRNAs, snoRNAs, anlegg tasiRNAs) og de ​​fleste av dem er preget av en gratis 5-terminalen (uendret), vanligvis stammer fra endo-ribonucleolytic behandling av forstadier molekyler. Dette trekk utgjør den unike strukturelle forutsetning strengt nødvendig for påføring av den spesifikke forbedret metode basert på kjemisk kryssbinding, selv om RNA-størrelse har til å bli betraktet som godt, når lengre RNA blir analysert. I figur 2 rapporterer vi en Northern Blot analyse forhold detektere nivåene av rasi4 54 et medlem av en klasse av bakterie-linjespesifikke små RNA (Piwi-samspill RNA eller piRNAs.) I forhold til fattige og spesifikke uttrykk nivåer, forbedret sensitivitet av denne metoden kan sanksjonere vellykkede resultater, spesielt med tanke på at den rapporterte protokollen kan bli ytterligere forbedret med kamining det med andre praktiske implementasjoner som allerede er beskrevet i litteraturen 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Dette arbeidet ble støttet av Institut National de la Santé et de la Recherche MEDICALE, den Centre National de la Recherche Scientifique, Université de Strasbourg, den Hôpital de Strasbourg, Association pour la Recherche sur le Cancer, Institut National du Cancer, Agence Nationale de la Recherche og regionen Alsace.

Pietro Laneve har vært støttet av Fondation pour la Recherche MEDICALE. For tiden er han en mottaker av en Istituto Italiano Tecnologia (IIT) fellesskap. Publiseringskostnadene støttes av Neurex nettverk (TriNeuron - Program Interreg IV Øvre Rhinen)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics