Förbättrad Northern blot detektering av små RNA arter i
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Syftet med denna skrift är att visualisera och diskutera de operativa stegen i en Enhanced Northern Blot-protokollet på RNA extraherat från Drosophila melanogaster embryon, celler och vävnader. Detta protokoll är särskilt användbar för effektiv detektering av små RNA-species.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De senaste decennierna har bevittnat en explosion av vetenskapligt intresse kring genuttryck kontrollmekanismer på RNA-nivå. Denna gren av molekylärbiologin har kraftigt underblåst av upptäckten av icke-kodande RNA som stora aktörer inom posttranskriptionell reglering. Ett sådant revolutionärt perspektiv har åtföljts och utlösas av att utveckla kraftfulla teknik för profilering korta RNA uttryck, både på hög genomströmning nivå (genomet hela identifiering) eller som enkel kandidat analys (stationär ackumulering av specifika arter). Även om flera state-of-art strategier är för närvarande tillgängliga för dosering eller visualisera sådana flyr molekyler förblir Northern blot-analys den stödberättigande tillvägagångssätt inom molekylärbiologi för omedelbar och noggrann utvärdering av RNA-uttryck. Det utgör ett första steg mot att tillämpa mer sofistikerade, dyr teknik och i många fall fortfarande en förmånlig metod för att enkelt få insiktertill RNA biologi. Här översikten vi en effektiv protokoll (Enhanced Northern Blot) för att detektera svagt uttryckta mikroRNA (eller andra små reglerande RNA-arter) från Drosophila melanogaster hela embryon, manuellt dissekeras larver / vuxna vävnader eller in vitro odlade celler. En mycket begränsad mängd av RNA krävs och användningen av material från flödescytometri-isolerade celler kan förutses också.

Introduction

RNA biokemi har upplevt spektakulära framsteg under de senaste åren ett. Vår förståelse av RNA potential i kontrollen av genuttryck har burst av en identifiering av kraftfulla icke-kodande ribo-regulatorer 2, genom upptäckten av nya RNA-baserade reglerande mekanismer 3,4 och genom en djupare karakterisera redan kända posttranskriptionell händelser 5. Tillsammans dessa studier har tillåtit RNA biologi att dramatiskt göra scenen, att bli ett stort forskningsämne i den aktuella vetenskapliga landskapet. Särskilt under de senaste åren får vi en känsla av den genomgripande effekterna av "RNA-världen" på molekylär neurobiologi 6, en av de mest dynamiska forskningsområden inom modern life science. Under det senaste decenniet av det senaste århundradet, har det övergripande vetenskapliga scenario revolutionerats genom upptäckten av RNA-interferens 7,8 och av de små reglerande RNA 9,10med särskild hänsyn till mikroRNA 11 endogent uttryckt små icke-kodande RNA inblandade i kontrollen av nästan alla funktioner cellulära som pleiotropiska och kombinatoriska regulatorer av genuttryck.

Nästan 10 år efter miRNA första upptäckten i Caenorhabditis elegans av Ambros och Ruvkun labb, förnyades uppmärksamhet vände sig till området när ett stort antal miRNA identifierades i Drosophila och humana celler och 12-15. Sedan dess, tack vare mångsidiga transgena metoder har Drosophila melanogaster stått som en värdefull biologisk kontext för djupdykning i miRNA biosyntes och aktivitet. Drosophila miRNA har avslöjat olika funktioner i insektsspecifika eller evolutionärt bevarade processer, som spänner från åldrande till ämnesomsättningen, signalvägar , beteende och, naturligtvis, neurogenes. Längs denna riktning, avtäckte vi nyligen en ny länk 16 i spännande samarbeterrelation inträffar mellan befälhavaren genen gcm / glid och RNA vägen. Flugan transkriptionsfaktor GCM / Glide 17-19 utgör ett unikt exempel på cell öde determinant, som dikterar gliaceller vs neuronal öde val i multi flyga neurala prekursorer 20. Tjugo år långa forskning om detta ämne har tydligt visat att förekomsten av multipla och överlappande ingångar genuttryck reglering konvergerar över gcm / glida 21-28 för att fastställa tröskelnivåer som krävs för att balansera den känsliga förhållandet mellan neuronala och gliaceller motsvarigheter under neural utveckling.

Vi upptäckte att reglering via DMEL-miR279 inriktning innebär ytterligare kontrollnivå som bidrar till post-transkription finjustering av gcm / glida uttryck 16. Globalt sett har dessa forskningslinjer som krävs specifika metodförbättringar: längs åren, flera tekniker som ursprungligen utvecklades för att analysera tradnella RNA har konverterats för att kvantifiera små icke-kodande RNA, likasom RNAs skyddsanalyser, cDNA arrayer 29-31 realtid PCR-metoder 32-35 och sekvense 36,37. På andra sidan, har omkalibrering av tekniska tillvägagångssätt främjas kontinuerliga framsteg inom området.

Northern blot-analys (NB, eller RNA gel blot-analys) utgör ett representativt exempel: det är till stor del används för att profilera RNA ackumulation, eftersom det garanterar både uttrycksnivå kvantifiering och storleksbestämning. Emellertid är den inneboende dåliga känsligheten hos förfarandet begränsande när den skall anbringas på låg rikliga genuttryck fina tuners, liksom korta RNA. En skadlig konsekvens är kravet på stora mängder totalt RNA, vilket försvårar dess tillämpning på specifika biologiska prover. Av sådana skäl, särskilda NB varianter för små RNA upptäckt har utvecklats 38-40: vi drog fördel av en förbättrad NB procedure 41 (ENB, Enhanced Northern Blot), samtidigt belysa den ovannämnda samspelet mellan DMEL-miR279 och gcm / glid.

Denna metod förlitar sig på en kemisk tvärbindningssteget baserat på aktiviteten av en karbodiimid-derivat [1-etyl-3-(3-dimetylaminopropyl) karbodiimid, EDC] att fixera nukleinsyran på fasta bärare. Karbodiimid är en mångsidig tvärbindare kända för att katalysera bildningen av amidbindningar mellan aktiverade karboxylgrupper eller fosfatgrupper och amingrupper 42. Denna egenskap kan utnyttjas för att kovalent par små RNA via deras mono-fosforylerad 5'-hydroxylgrupp till aminogrupper på ytan av nylonmembran. Den resulterande fäst konfiguration ökar tillgängligheten till den immobiliserade nukleinsyra och i sin tur effektiviteten i prob-target-hybridisering, vilket resulterar i anmärkningsvärd upptäckt förbättring 43.

Tekniken förutsätter särskilt relevance in Drosophila molekylära studier, genom vilken förekomsten av nya och distinkta klasser av små icke-kodande RNA växer fram 44. Bland dessa, rasiRNAs 45,46 utgör en särskild subtyp av Piwi-interagerande RNA (piRNAs 47), som verkar för sekvensspecifika geners uttryck. Operativa detaljer om denna metod är fullständigt beskrivna och visualiserades nedan, i förhållande till analysen av microRNAs DMEL-miR279 och DMEL-miR286 och, för första gången, av en rasiRNA, rasi4. Vi knuffade till ytterligheter här metoden, som tillät oss att avslöja dåligt uttryckta mål från minimala mängder RNA (under 1 mikrogram).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 Provtagning

  1. Dra av semi-vidhäftande Schneiders 2 celler, (1-5 x 10 6 celler i genomsnitt), genom att pipettera och skörda dem genom centrifugering (100 xg i 1 min). Vid in vitro odlade vidhäftande celler, trypsinize dem i standardförhållanden eller direkt samla in dem från plattorna i lämplig mängd RNA extraktion reagens, genom hjälp av en cellskrapa.
  2. För embryosamlings, växa Drosophila stammar in fly burar och låta embryon samlas på ägg om plattor. Torka embryon av med en pensel i destillerat vatten (dH 2 O), kasta skräp genom sikt filtrering, skölj och återhämta embryon i en flaska 48.
  3. Som en alternativ teknik, manuellt dissekera vävnader / organ. Isolera testiklar (ett förmånssystem för Pirna-analys) från Drosophila buken i fosfatbuffrad saltlösning (PBS) under ett stereomikroskop (20 gångers förstoring), med hjälp av dissektion nålar eller pincett så visualized i Sullivan et al 49.
  4. Pestle homogenisera prover vid missbruk av 0,5 volymer RNA-extraktion reagens.

2. RNA extraktion / Analys

  1. Enligt tillverkarens instruktioner utför RNA isolering genom kommersiella reagenser. OBSERVERA! RNA extraktionsmedel är oftast giftiga och frätande. Alternativt tillämpa en proteinas K-baserade protokoll för RNA-isolering 50, enligt följande:
    1. Späd prover i 400 pl av Stop Blanda och inkubera vid RT i 15 min.
    2. Recover hydrolösliga komponenter från standard fenol: kloroform: isoamylalkohol och kloroform-extraktioner och från etanol (EtOH) utfällning / tvättning. Lufttorka proverna och slamma i dietylpyrokarbonat (DEPC) -behandlat dubbeldestillerat (dd) H2O
  2. Bedöm RNA-koncentration genom UV-spektrofotometrisk mätning. Se också till RNA renheten är hög, nära 2,0, based på A 260 / A 280 läsning.
  3. Kontrollera RNA preparatet på denaturering agarosgel enligt följande:
    1. I en ren bägare, lös 1,2 g agaros i 82 ml DEPC-DDH 2 O, under kontinuerlig omrörning. Koka tills allt löst.
    2. Tillåt gellösningen svalna; när temperaturen når 60 ° C tillsätts 10 ml av 10X 4-morpholinepropanesulfonic syra (MOPS) buffert till 1X slutkoncentration (FC), och 8 ml 37% formaldehyd till 3% FC. VARNING! Formaldehyd är ett cancerframkallande ämne.
    3. Häll gelen i ett horisontellt elektroforescell. Tillåt gelén att stelna under en huv under minst 1 tim. Efter stel, dränka gelen i MOPS 1X.
    4. Alikvotera 2 pg av RNA-prov och 1 pg av stege (använd en RNA markör när noggrann utvärdering önskas). Lägg 3 volymer agaros laddningsfärg (ALD) till RNA och stege. Värm vid 70 ° C i 5 min och omedelbart svalt på is. CAMepannor! Innehåll i ALD (etidiumbromid och formamid, se Material) är mutagent och frätande, respektive.
    5. Ladda proverna och köra gelen vid 50 V under ca 1 h med tillfällig buffert återvinning. Kontrollera RNA fraktione mönstret genom UV-visualisering eller gel avbildning. Recognize diskreta band motsvarande 28S och 18S rRNA och tRNA (se figur 1).
  4. Gå vidare till norra analys eller lagra RNA vid -80 ° C.

3 Denaturing Akrylamid Gel Preparation

  1. Använd en liten vertikal elektrofores apparater för fraktioneringssteg (plattstorlek ca 8 cm x 9 cm, kam tjocklek 0,75 mm).
  2. Montera ren glasögon tillsammans i en gjutningsramen.
  3. Bered 10 ml av en 10% akrylamid / bis-akrylamid (19: 1) lösning i MOPS 1X, 7 M urea. Omedelbart före hälla, tillsätt 100 pl 10% ammoniumpersulfat och 10 pl TEMED och snabbt blanda lösningen. FÖRSIKTIGT! Akrylamid är neurotoxiskt och cancerframkallande.
  4. Häll gelen mellan glasplattor och sätt i väl kammen försiktigt för att undvika bubblor. Låt gelén polymerisera vid rt under minst 45 min före användning. Alternativt förvara gel O / N, insvept i vattendränkt filterpapper och förseglas i Saran wrap.

4. Provberedning

  1. Alikvot 0,5-20 | ig av totalt RNA för varje prov. Om volymen överstiger 3-4 pl, vakuum torka provet.
  2. För storleksbestämning, kör en alikvot (20-30 cps) av radioaktivt märkt låg range stege parallellt med prover, som en markör (se avsnitt 4.3 och 4.4 för beredning). Behandla det parallellt med prover, som beskrivs i steg 4,5.
  3. Stege: inrätta en fosfat framåt reaktion med användning av 0,1 pg av ett 10 bp steg stege. Inkubera vid 37 ° C under 30 minuter och stoppa reaktionen genom tillsats av etylendiamintetraättiksyra (EDTA) till 20 mM FC.
  4. Rena med EtOH utfällning / tvätt, lufttorka ochresuspendera i DDH 2 O (ca 100 l). 32 P är en radioaktiv källa VARNING!.
  5. Till varje prov tillsätt en lika volym av akrylamid blått färgämne (ABD). Denaturera genom upphettning vid 80 ° C under 5 minuter och låt svalna på is tills lastning. OBSERVERA! Formamid (innehåll i ABD) är frätande.

5. Elektroforefraktione

  1. Ta bort glasplattorna från gjutning stöd och korrekt monterar dem i elektroforescellen. Fyll både inre och yttre kammaren med tillräcklig löpbuffert (RB).
  2. Ta försiktigt bort kammen och pre-run gelen vid 200 V under 10 min. Innan proverna, tvätta bort urea inlåning från brunnarna genom att spruta lite RB genom en spruta.
  3. Använd plana tips för att noggrant skikta prov från steg 4,5 i botten av varje brunn. Kontrollera anod och katodanslutningar för att undvika inverterad drift. Efter proven in i gelén vid 100 V under 5 min, iöka skärpan b spänningen till 200 V.
  4. För en fraktione längd av ca 7 cm, är en 45 min-långa loppet tillräcklig. Undvik Bromfenolblått (en spårning pigment i ABD) att svämma över gelen.
  5. Visualisera on-gel de fraktione långa RNA efter etidiumbromid (EtBr) färgning, som ett valfritt steg:
    1. Skär bort 2 cm från toppen av gelen och skölj hastigt segmentet i DDH 2 O.
    2. Inkubera gelskivan vid RT under 15 min med försiktig shacking i RB, EtBr 0,5 | ig / ml FC.
    3. Avfärga gelen i 15 min i RB, visualisera långa rRNA från UV-bestrålning eller gel avbildning. Kontrollera för RNA-laddning och kvalitet (se fig 1, panel 7). VARNING! Etidiumbromid är en mutagen.
  6. Under tiden fortsätter läsk den nedre delen av gelén innehållande små RNA-arter.

6. Gel Blotting

  1. Skär 6 stycken läskpapper för att passa blotting området och en motsvarande bit urladdad nylonmembran. Fukta pappersark, membran och två läsk kuddar i RB. Se till att helt dra kuddarna genom att upprepade gånger klämma dem i RB.
  2. Ta bort gelen från apparaten och öppna glasen med medelvärdet av en spatel. Använd en ren skäraren för att avlägsna brunnarna. Placera ett ark av vått Whatmanpapper på gelén och lyft försiktigt upp den.
  3. Placera nylonmembran på den fria ytan på gelén. Markera ett hörn för att orientera filtret enligt provbelastning. Fyll i "sandwich" (3 papper bitar varje sida). Rulla en plaststav på blot ytan, för att ta bort eventuella luftbubblor.
  4. Placera blot mellan två läsk dynor och sedan i läsk kassetten. Montera kassetten i läskmodulen, fylla kammaren med RB och kontrollera rätt orientering (nylonmembran måste stanna mellan gel och den positiva terminalen).
  5. Transfer vid 20 V under 20 minuter. OBS: för att säkerställa homogena betingelser, efter 10 min öppna läskmodulen och rotate smörgåsen 180 ° innan du flyttar.

7. Membrantvärbindning

  1. Förbered 6 ml färskt Tvärbindning Solution (XLS). Mätta en 10 cm x 10 cm (större än nylonmembran) bit läskpapper med XLS. OBSERVERA! HCI (en komponent i XLS) är starkt frätande.
  2. Demontera blot och placera membranet på den våta 3MM filterpapper. OBS: RNA får inte vara i direkt kontakt med den mättade papperet. Placera filtret och papper mellan två glasskivor och linda in Saran-wrap.
  3. Värm membranet vid 60 ° C under 2 h, följt av en DDH 2 O tvättning. Förvara vid -20 ° C eller gå vidare till hybridisering.

8. Membrane Förhybridisering

  1. Om RNA belastning har kontrollerats (valfritt steg 5,5), direkt vidare till hybridisering. Eller annars, skär bort en cm från till toppen av nylonfiltret, för att undvika prob kors hybridizations till fraktione långa RNA.
  2. Värm 10 ml hybridiseringslösning (HS) vid 37 ° C. Denaturera 1 mg laxsperma vid 95 ° C under 5 min, kyla på is och tillsätt till HS.
  3. Inkubera filtret i HS vid 37 ° C i minst 1 timme, under rotation i en hybridisering ugn. Kontrollera att RNA-sidan av filtret vetter HS.

9. Probe Synthesis

  1. Sätt upp en fosfat framåt reaktion på 10 pmol av särskild antisensoligonukleotid, enligt beskrivningen i 4.3.
  2. Lägg 5 volymer Tris-EDTA-NaCl (TEN) buffert till reaktionsblandningen och rena den märkta primem från ej inkorporerade nukleotider genom gel exclusion kromatografi på G-25 Sephadex-kolonner (eller också genom EtOH utfällning). Probe aktivitet kan bedömas genom vätskescintillationsräknare.

10. Membrane Hybridisering

  1. Byt ut utmattad HS med en färsk 10 ml alikvot (beredd och kompletteras enligt ovan). Värm sond vid95 ° C i 10 minuter, svalna på is och lägga till nya HS. Inkubera filtret vid 37 ° C ON.

11. Membrane Tvättning

  1. Recover hybridiseringslösningen och förvara den vid -20 ° C i en radioaktivitet avskärmande låda.
  2. Skölj filtret i tvättbuffert (WB) och tvätta den noggrant för 10 min vid RT.
  3. Använd en Geiger Mueller Detektor för kontroll av kvarvarande radioaktivitet på filterhörn. När bakgrunds utsläpp är cirka 5 cps, fortsätt till membran utläggning.

12. Signal

  1. Exponera filtret på autoradiografifilmer eller på en molekylär avbildningsskärm ON. Avslöja signaler från fotografisk bearbetning eller digital konvertering.
  2. Analysera bandintensitet genom dedicerad kvantifiering programvara (ImageJ eller Optiquant).

13. Membrane stripp

  1. För att avlägsna primära signaler, nedsänka membranet i 500 ml kokande Stripp lösning, Sedan inkubera vid RT i 1 min. Gå vidare till nya (för)-hybridisering eller förvara filtret vid -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Genom att följa det allmänna förfarandet som beskrivits i texten och som schematiskt representeras i figur 1, utvärderas vi små RNA expression från komplexa RNA-prover av olika ursprung. I experimentet presenteras i figur 1, isolerades RNA från Drosophila Schneiders 2 celler med proteinas K utvinning, kontrolleras för integritet (valfritt steg: denaturering agarosgel fraktionering) och lastas i dubbel. Ena halvan av gelén blottades på ett neutralt membran och kemiskt tvärbundna genom EDC; den andra halvan överfördes på ett positivt laddat nylonfilter, därefter UV-tvärbunden (1,2 x 10 5 μJ / cm 2). Den endogena uttrycket av två mikroRNA tillhör DMEL-miR279 familj (DMEL-miR279 självt och DMEL-miR286 15) verifierades i båda förhållanden. Den förbättrade förfarande (ENB) säkerställer högre känslighet i förhållande till det normala (SNB).

figurerna 2 och 3. Den experimentella grunden är samma som ovan: Här rapporterar vi den representativa resultat av Northern blot-autoradiografisk detektion av Pirna rasi4 längs en ​​titrering av totalt RNA extraherat från vuxen flyga testiklar. ENB redan medger detektering av ett specifikt band då 0,5 mikrogram av RNA är laddad. Kvantifieringen visar åt sidan hur signalen ökar proportionellt med mängden fraktionerad RNA, vilket indikerar att dosen / respons-förhållande ligger i linjära området för upptäckt. Panelen nedan ratificerar förbättrad känslighet med denna metod jämfört med SNB. I detta fall är en detekterbar signal som erhölls vid elektroforetisk fraktionering av 10 pg av RNA åtminstone för SNB.

Liknande resultat erhålles med en annan icke-kodande RNA-species, t.ex., 5S-rRNA, som rapporterats i fig 3 </ Strong>.

Figur 1
Figur 1 Schematisk representation av den övergripande Northern Blot-förfarandet. Viktigaste stegen i förfarandet är listade och successivt numrerade. Resultaten jämförs mellan Enhanced Northern Blot (ENB) och Standard Northern Blot (SNB), utförs i samma förhållanden: RNA isolering från Drosophila Schneiders 2 celler (Panel 1), elektrofores (panel 2), överföra (Panel 3) och hybridisering ( Panel 5). ENB hänvisar till det förbättrade förfarande som beskrivs i denna rapport, vilket kräver ett neutralt filter (Panel 3, vänstra halvan av membranet) och EDC-baserade tvärbindning (panel 4) som fastställer en kovalent bindning mellan mål-RNA 5'-änden och membran ( rosa prickar i panelen 4). I SNB är RNA tvärbindning erhålls genom UV-behandling (panel 4) på ​​en positivt laddad NYLOn membran (Panel 3, högra halvan av membranet). 5s RNA specifik signal är inte en kalibrator i jämförande förhållanden, eftersom den svarar också på skillnader mellan SNB och ENB förfarande. Således ett belopp (motsvarande 10 cps) i en 5'-märkt (se punkterna 4.3 och 4.4 i protokollet), 50 nt lång scrambled oligonukleotid sattes till varje exemplar före elektrofores, för att fungera som en "spik i" referens ( Panel 7). Laddar kan även bedömas av den-gel EtBr färgning av långa rRNA (se punkt 5.5 i protokollet). L = Ladder. FV = Frontal View, LV = Lateral View, HV = Horisontell View. Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2 Compartivt Northern blot-analys av rasi4 uttryck. Endogena nivåer av testiklarna specifika Pirna rasi4 avslöjas genom förstärkt (ENB) eller standard (SNB) Northern Blot ske på ökande mängder totalt RNA (anges ovanför varje bana) utvinns från vuxna Drosophila testiklar , eller från hela bakkroppen (Abd). För varje metod, histogram åt sidan rapporterar de relativa mängderna av rasi4 avseende på samma mängd av en "spik i" lastkontroll. Kvantifieringar från de två metoderna kombineras i avgörande diagrammet placeras under gelerna. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3 Jämförande Northern blot-analys av 5s rRNA-expression. Som en positiv kontroll och experimentell kalibrering, var tidigare analys utvidgas till 5s rRNA. Uppgifter som i figur 2. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Även om vår uppskattning av sophisticate sammanflätning genom vilken RNA reglerar neurogenes ökar ständigt, de mekanistiska konsekvenserna av RNA-baserade circuitries påverkar neural stamcellsbiologi, neuronal differentiering / funktionell integration, utveckling av neurala sjukdomar och cancer är fortfarande outforskade. Underhållet av sådana nätverk genom riken gör potentialen av genetiska system Drosophila melanogaster avgörande att riva upp outforskade cellulära vägar, där korta icke-kodande RNA och transkriptionsfaktorer betraktas som viktiga molekylära aktörerna. I denna mening är propaedeutic till korrekt funktionsanalyser profilering av kandidat små RNA-uttryck nivåer: ett exempel kommer från vår senaste demonstration som DMEL-miR279 modulerar gcm / glid öde faktor in vivo, uppnås genom en förbättrad version av Northern blotting-analys som ett verktyg för expressionsanalys.

51, har NB betraktats som en referensmetod för RNA-analys. Trots vissa inneboende begränsningar av denna analys, som den svåra övergången till multiplexar format eller eventuella fel med signal kvantifiering har nya genombrott inom RNA-molekylärbiologi återupptäckt denna konventionella tekniken som en "snabb och ren"-system för analys av endogen expression av små ribonucleic syror eller för att validera effektiviteten av GAIN- eller förlust-av-funktion metoder. Som paradigmatiskt exempel lägger Northern analys på grundval av den ursprungliga upptäckten av mikroRNA, medan det tillvägagångssätt kvar i täten för dess relevans i karakteriseringen av ständigt nya egenskaper regulatoriska RNA 52.

Den variant som beskrivs här bygger på ökad känslighet på grund av kemisk tvärbindning av RNA. Vi believethe metod fortfarande dåligt anställd i Drosophila, but när utnyttjas lett till betydande upptäckter 52, eftersom den möjliggör profilering RNA uttryck från små prov (mindre än 1 mikrogram), med en genomsnittlig 10-30 gångers förbättring av RNA måldetektering 41,43, som vi fått i våra förhållanden (Siffror 2 och 3).

RNA integritet utgör en kritisk fråga för att få konsekventa och reproducerbara resultat. RNA manipulationer kräver noggrannhet och snabbhet för att begränsa eventuella prov försämring inträffar mellan utvinning och lastning. På detta syfte, alla lösningar måste vara diethylpyrocarbonate- (DEPC) behandlat före användning (två timmars inkubering i närvaro av 0,1% DEPC vid 37 ° C och därefter autoklaveras) att kringgå RNas-aktivitet. Lösning behandling garanterar bättre resultat vad gäller användning av DEPC vatten som lösningsmedel. All utrustning kommer att vara lika sköljas i DEPC ddH20, efter rengöring av en RNas-specifik yta saneringsmedel.

(t.ex. rasi4, Figur 2) eller när RNA rening inte utförs på färska prover (till exempel bevarat i vävnadsförvaring reagens). Av erfarenhet, RNA isolering från stabiliserade proverna gav betydligt hårdare och kräver mer drastiska extraktionsbetingelser. I standardförhållanden, garanterar den beskrivna proteinas K-baserad metod god kvalitet preparat också, (ett viktigt exempel är representerade i Figur 1) men det är inte det optimala valet för prover bevarade i lager reagenser.

Slutligen, eftersom detta förfarande är att små RNA specifik detektion, dedikerad kolumnreningsbaserade byggsatser kan användas för direkt små RNA-isolering, även om thsäga gör svårare att kontrollera RNA integritet. I alternativ till den klassiska gelbaserad förfarande för RNA integritetskontroll som beskrivs ovan, kan RNA kvalitet utvärderas av instrument för on-chip miniatyriserad analys av nukleinsyra mönster.

Buffert Choice: MOPS-NaOH-buffert (pH 7) föreslogs som en förmåns buffert för både Enhanced Northern gelelektrofores och blotting. Vi tillfredsställande använde också Tris-borat-EDTA (TBE) buffert i våra experiment. I det här fallet, eftersom närvaron av nukleofila amingrupper Tris (hydroximetyl) aminometan skulle hydrolysera och inaktivera DEPC under behandlingen i sig, rekommenderas upplösning Tris i DEPC-behandlat vatten i stället för att behandla TBE-buffert redan förberett.

Elektro Kör och blotting: Pre-kör gelén är avgörande för att ta bort överskott av Persulfate och eliminera hyperfocusing. Pre-run parametrar bör bibehållas även under fraktione, undvika för fort electrophoRetic körning. Före lastning, se till att ta bort eventuella Urea sediment från brunnar, genom att spruta buffert inuti. Detta kommer att begränsa prov spridningseffekter och garantier korrekt RNA skiktning, producerar lösas autoradiografiska band under signaler upptäckt. Varje neutralt nylonmembran kan användas som ett stöd för nukleinsyra överföring. Inte blot RNA i mer än 20-30 minuter vid de angivna villkoren.

Tvärbindning: EDC-baserade kemisk tvärbindning representerar den kritiska metodologiska god tid före denna förbättrade blot version Norra. Möjligheten att tvärbinda korta RNA-arter till neutrala ytor genom kovalenta gränser mellan RNA 5'mono-fosfatgrupp och nylon primära aminer lämnar majoriteten av baser tillgängliga för hybridisering. Detta förbättrar känsligheten genom 10-20xrespect till traditionella tvärbindning. Det är viktigt att förbereda färskt mängd tvärbindningslösning för varje blotting, i tillräcklig mängd för korrekt membran mättnad.

Hybridisering och Tvätt: Sönder bör helst nyligen märkt. Probe specifik aktivitet (beroende på den specifika aktiviteten och mängden införlivad radiomärkt nukleotid och även på mängden prob för hybridisering) avgör känslighet måldetektering. När [γ- 32 P] ATP med en specifik aktivitet av 3000 Ci / mmol användes, 10 6 cpm / pmol för 100% märkning av 5'-ändarna förväntas.

Hybridiseringslösningen kan återvinnas och återanvända, med tanke på att, på grund av 32p förfall, sond aktivitets halvor i ca 14 dagar.

På grund av att membranet neutralitet, är lågt bakgrundsbrus förväntas vid hybridisering. Om mer stringenta tvättbetingelser krävs, gradvis minska tvättbuffert jonstyrka (upp till 0,2 X SSPE) eller lägga till ökande mängder av joniska detergenter (upp till 0,5% SDS) eller tar upp disktemperatur till 37 ° C.

Northern blot-analys är avgörande när det krävs RNA storleksmätning. Även om denna analys kan sakna riktigheten av fluorescens-baserade qPCR metoder för skattning av små RNA, härleder en fördel att använda denaturefraktione / blotting och sondberoende hybridisering som unika steg före detektion av mål-RNA. Följaktligen är uppenbarelsen av specifika signaler från provet direkt och kräver inga ytterligare steg för enzymbehandling / konvertering / förstärkning, vilket skulle innebära att använda dedikerade kommersiella kit. RNA-nivåer kan kvantifieras och jämföras mellan flera prover på enstaka membran. Sålunda Northern blot används vanligen som ett stringent validering för qPCR data. Sporrade av särskilda experimentella krav, har metoden även förbättrats under de senaste åren, både på känslighet och upplösning, så att begränsad mängd RNA (se figur 2 och 3) krävs för framgångsrik analys.

Protokollet som vi framlagt kan anpassas till ett brett spektrum av applikationer i synnerhet där materialet är tillgängliga i begränsade mängder. Den biologiska källan för RNA-prover kan vara heterogen: mån Drosophila är berörda, embryon eller andra utvecklingsstadier är lämpliga, men även manuellt dissekerade vävnader eller organ, enskilda celler sortering-isolerade cytotypes eller cellodlingar.

Även om mikroRNA är den vanligaste klassen av korta regulatoriska RNA i cellen och huvudämne för utredning inom RNA-medierad genuttryck kontroll, gör de inte nackdelartitute den enda familjen av cellulära icke-kodande RNA. Många kluster av små RNA fungera över riken (t.ex. endogena siRNA, piRNAs, snoRNAs, växt tasiRNAs) och de flesta av dem kännetecknas av en fri 5 'terminalen (omodifierad), i allmänhet härrör från endo-ribonucleolytic bearbetning av prekursorer molekyler. Denna funktion utgör den unika strukturella förutsättningen absolut nödvändigt för att tillämpa den specifika förbättrad metod som bygger på kemisk tvärbindning, även om RNA storlek måste beaktas också, då längre RNA analyseras. I figur 2 redovisar vi en Northern blot-analys jämförelsevis upptäcka nivåerna av rasi4 54 medlem av en klass av bakterie-linjespecifika små RNA (Piwi-interagerande RNA eller piRNAs.) I villkoren för fattiga och specifika uttryck nivåer, den ökade känsligheten med denna metod kan sanktionera framgångsrika resultat, särskilt med tanke på att det redovisade protokollet kan förbättras ytterligare genom kamining den med andra praktiska implementationer som redan beskrivits i litteraturen 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Detta arbete stöddes av Institut National de la Santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université de Strasbourg, den Hôpital de Strasbourg, Föreningen pour la Recherche sur le Cancer, Institut National du Cancer, Agence Nationale de la Recherche och Région Alsace.

Pietro Laneve har fått stöd av Fondation pour la Recherche Médicale. För närvarande är han en mottagare av ett Istituto Italiano Tecnologia (IIT) gemenskap. Publiceringskostnader stöds av Neurex nätverket (TriNeuron - Program Interreg IV övre Rhen)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics