Küçük RNA Türlerin Northern Blot Algılama geliştirilmiş

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Bu yayının amacı, görselleştirmek ve Drosophila çıkarılan RNA bir Geliştirilmiş Northern Blot protokolünün ameliyat adımları görüşmek embriyolar, hücreleri ve dokuları melanogaster etmektir. Bu protokol küçük RNA türünün etkin tespiti için özellikle yararlıdır.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Geçen yıl RNA düzeyinde gen ekspresyon kontrol mekanizmaları etrafında bilimsel ilgi patlaması yaşandı. Moleküler biyoloji dalı ölçüde post-transkripsiyonel düzenlenmesinde önemli oyuncu olarak RNA'lar kodlamayan keşfiyle tarafından desteklendi. Böyle bir devrimci perspektif yüksek verimlilik düzeyi (genom tanımlama) ya da tek aday analizi (spesifik türlerin kararlı durum birikimi) gibi hem, eşlik ve kısa RNA'lar ifade profilleme için güçlü teknolojilerin geliştirilmesi tarafından tetiklenen olmuştur. Birkaç state-of-sanat stratejileri dozlama veya kaçan moleküllerin görüntülenmesi için mevcut olmasına rağmen, Northern Blot tahlil RNA ifade anında ve doğru değerlendirilmesi için moleküler biyolojide uygun yaklaşım olmaya devam etmektedir. Bu birçok durumda daha sofistike, pahalı teknolojiler ve uygulama doğru bir ilk adım, kolayca anlayışlar kazanmak için tercih edilen bir yöntemdir kalır temsilRNA biyoloji içine. Burada elle larva / yetişkin dokular kesilmiş ya da in vitro kültürlenmiş hücrelerde, insan embriyosu Drosophila melanogaster ikinci zayıf eksprese microRNA (ya da diğer küçük düzenleyici RNA türlerini) tespit edilmesi için (Kuzey Benek Gelişmiş) verimli bir protokol genel bakış. RNA çok sınırlı bir miktarı ve sitometri izole edilmiş hücreler olabilir, akış malzeme kullanımı da öngörülmektedir.

Introduction

RNA biyokimya geçmiş yıllarda 1 muhteşem ilerlemeler yaşanmıştır. Gen ifadesinin kontrolü RNA potansiyeli son anlama yeni RNA bazlı düzenleyici mekanizmaların 3,4 keşfedilmesiyle ve bilinen transkripsiyon sonrası olayların bir derin karakterizasyonu ile, güçlü bir kodlayıcı olmayan ribo-düzenleyiciler 2'nin tanımlanması ile patlama edilmiştir 5. Hep birlikte bu çalışmalar izin RNA biyoloji dramatik güncel bilimsel peyzaj önemli bir araştırma konusu haline sahneyi yapmak. Özellikle, son yıllarda biz moleküler nörobiyoloji 6, modern hayatın bilimde en dinamik araştırma alanlarında birinde "RNA dünyası" yaygın etkisi duygusu alıyorsanız. Geçtiğimiz yüzyılın son on yılında, toplam bilimsel senaryo RNA müdahelesi 7,8 keşfiyle ve küçük düzenleyici RNA'ların 9,10 devrim olmuşturmicroRNA özellikle 11 ile ilgili olarak, endojen gen ekspresyonu ve kombinasyon pleiotropik düzenleyici olarak hemen hemen tüm hücre fonksiyonlarının düzenlenmesinde implike küçük kodlayıcı olmayan RNA'lar ifade edilmiştir.

MiRNA'ların yüksek sayıda Drosophila ve de 12-15 insan hücrelerinde tespit edildiğinde neredeyse 10 yıl Ambros ve Ruvkun laboratuarlarında tarafından Caenorhabditis elegans miRNA ilk keşiften sonra, yenilenen dikkat alanına döndü. O zamandan beri, çok yönlü transgenik yaklaşımları sayesinde, Drosophila melanogaster miRNA biyosentezi ve aktivite araştırılacağı değerli bir biyolojik bağlamda olarak durdu. Drosophila miRNA'ların yolları, metabolizma yaşlanma sinyalizasyonu kapsayan,-böcek spesifik veya evrimsel olarak korunmuş süreçlerinde farklı işlevleri ortaya çıkarmıştır , davranış ve, elbette, nörojenez. Bu doğrultuda, son zamanlarda ilginç co bir roman bağlantı 16 tanıttıana gen gsm / kayma ve RNA yolun arasında meydana gelen rrelation. Sinek transkripsiyon faktörü GCM / Glide 17-19 multipotent glial vs nöronal kaderi seçim nöral öncüleri 20 uçmak dikte hücre kaderinin belirleyicisi, eşsiz bir örneğini oluşturmaktadır. Yirmi yıl bu konu üzerinde uzun araştırmalar gsm / üzerinde yakınsak gen ekspresyon düzenleme çoklu ve çakışan girdilerin oluşumunu nöral gelişim sırasında nöronal ve glial meslektaşları arasındaki hassas oranını dengelemek için gerekli eşik seviyelerini kurmak için 21-28 kayma altını açıkça gelmiştir.

Biz DMEL-miR279 hedefleme yoluyla düzenlemenin gsm yayınlayabilmesine-transkripsiyonel ince ayar / ifadesini 16 kayma katkıda bulunan bir diğer kontrol düzeyi temsil keşfetti. Küresel olarak, bu araştırma çizgiler gerektirmiştir belirli metodolojik iyileştirmeler: yıllar boyunca, çeşitli teknolojiler aslında trad analiz etmek için geliştirilmişitional RNA'lar gibi küçük olmayan bir kodlama RNA miktarının belirlenmesi için dönüştürülmüş, RNase koruma tahlilleri, cDNA dizileri 29-31, gerçek zamanlı PCR yöntemleri 32-35 ve 36,37 dizi analizi gibi. Diğer taraftan, teknik yaklaşımlar yeniden kalibre alanında sürekli ilerlemeler önemli avantajlar sağlamaktadır.

Northern blot analizi (nb ya da RNA jel leke analizi) temsili bir örneğini teşkil eder: Bu boyut belirlenmesi yanı sıra, her iki ekspresyon seviyesi kantitatif sağladığından büyük ölçüde, RNA birikmesine profil kullanılır. Bununla birlikte, yöntemin içsel zayıf hassasiyet kısa RNA gibi, düşük miktarda gen ifadesi ince ayarlayıcıları uygulanacak olduğunda sınırlayıcıdır. Bir zararlı sonucu belirli biyolojik numunelerin zor başvurusunu yapan toplam RNA, büyük miktarda gerekliliktir. Bu gibi sebeplerle, küçük RNA'lar tespiti için spesifik NB varyantları için 38-40 geliştirilmiştir: Biz geliştirilmiş NB yordam yararlandıedure 41 (ENB, Gelişmiş Northern Blot), DMEL-miR279 ve gsm / kayma arasındaki yukarıda belirtilen etkileşimi durulaştırmada ederken.

Bu yöntem, bir karbodiimid türevi aktivitesine dayanarak diğer kimyasal çapraz bağlama adımı dayanır [1-etil-3-(3-dimetilaminopropil) karbodiimid, EDC] bir katı destek üzerine sabitlemek için bir nükleik asit. Karbodiimid aktive karboksil veya fosfat grupları ve amin grupları arasında amid 42 bağların oluşumunu katalize etmek üzere bilinen çok yönlü bir çapraz bağlayıcıdır. Bu özellik, naylon membran yüzeyinde amino gruplarına da mono-fosforile edilmiş 5'-hidroksil grubu vasıtasıyla kovalent olarak çift küçük RNA'ların etmek için kullanılabilir. Elde edilen bağlantı konfigürasyonu, sırayla, dikkate değer tespiti ile sonuçlanan iyileştirme 43 prob hedef hibridizasyon verimliliğini hareketsizleştirilmiş nükleik asidin erişilebilirliğini arttırmaktadır.

Bu teknik belli relevanc kabulDrosophila moleküler çalışmalar e, hangi küçük kodlamama RNA'lar yeni ve farklı sınıfların oluşumu 44 ortaya çıkmaktadır. Bunlar arasında, 45,46 diziye özgü gen susturma katılan piwi etkileşen RNA'lar (piRNAs 47), belirli bir alt tipi teşkil rasiRNAs. Bu yöntemin operasyon detayları tam olarak tarif edilen ve bir rasiRNA, rasi4 arasında, ilk kez, microRNA DMEL-miR279 ve DMEL-miR286 analizine göre ve bundan sonra görselleştirilebilir. Biz RNA (az 1 mikrogram) minimal miktardaki kötü ifade hedeflerini ortaya bize izin bu yöntemi, extremes itti.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Numune Toplama

  1. Pipetleme yarı yapışık Schneider'in 2 hücreleri, (ortalama 1-5 x 10 6 hücre), ayırmak ve santrifüj (1 dakika için 100 xg) hasat. In vitro kültürlenmiş hücrelere yapışık durumunda, standart koşullarda bunları trypsinize veya doğrudan bir hücre kazıyıcı yardımı ile, RNA ekstraksiyon reaktifi için uygun bir miktar içine levhalardan toplarlar.
  2. Embriyo toplanması için, sinek kafeslerde Drosophila suşları büyümeye ve izin embriyolar yumurta döşeme plakaları üzerinde birikir. Damıtılmış su içinde bir fırça (dH 2 O) embriyolar siliniz, elek filtreleme tarafından enkaz atmak yıkayınız ve bir şişe 48 embriyolar kurtarmak.
  3. Bir diğer yöntem olarak, elle dokular / organlar teşrih. Vis gibi diseksiyon iğneler veya forseps kullanılarak, bir stereo mikroskop (20 X büyütme) altında, fosfat tamponlu tuzlu su (PBS) içinde, Drosophila karın testisler (piRNA analizi için tercih edilen bir sistem) yalıtmakSullivan ve arkadaşları 49 ayırd.
  4. Pestle RNA ekstraksiyon reaktifi 0.5 hacim bağımlılığı üzerine örnekleri homojenize.

2. RNA Ekstraksiyon / Analiz

  1. Aşağıdaki Üreticilerin talimatları ticari reaktif ile RNA izolasyonu gerçekleştirmek. DİKKAT! RNA ekstraksiyon ajanlar genellikle zehirli ve yakıcı vardır. Alternatif bir şekilde, RNA izolasyonu için bir 50 Proteinaz K tabanlı bir protokol uygulanır:
    1. Durdurma Mix 400 ul numune içine seyreltilir ve 15 dakika boyunca oda sıcaklığında inkübe edin.
    2. Kloroform: izoamil alkol ve kloroform ekstraksiyonu ve etanol (EtOH) çöktürme / yıkama, standart fenol suda çözülebilen komponentlerin reküperasyonu. Hava örnekleri kuru ve dietilpirokarbonat (DEPC) içine tekrar süspansiyon çift (dd) H 2 O damıtılmış -lı
  2. UV spektrofotometrik ölçümü ile RNA konsantrasyonu değerlendirin. Ayrıca, RNA saflık 2.0 civarındadır, yüksek bas sağlamakA 260 üzerindeki ed / A 280 okuma.
  3. Aşağıdaki gibi agaroz jeli denatüre edici RNA, hazırlık Kontrol
    1. Bir temiz bir beher içinde, sürekli karıştırma altında, DEPC ile GKD 2 O 82 ml, 1.2 g Agaroz çözülür. Tamamen eriyene kadar kaynatın.
    2. Jel solüsyon soğumaya bırakın; sıcaklığı 60 ° 10X 4-morfolinpropansülfonik asit 10 ml eklemek C ulaştığında (MOPS) 1X son konsantrasyonda (YP) için tampon, ve 8 ml 3 formaldehit% 37% FC. DİKKAT! Formaldehit kanserojen.
    3. Yatay elektroporez hücresine jel dökün. Jel en az 1 saat boyunca bir başlık altında katılaşması için izin verin. Katılaşma sonrasında, MOPS 1X içine jel daldırın.
    4. Tümbölen RNA numunesinin 2 mikrogram ve Ladder 1 mikrogram (doğru değerlendirilmesi istendiğinde bir RNA işaretleyici kullanın). RNA agaroz yükleme boyası (ALD) 3 cilt ve Ladder'a. Sıcaklık 70 ° C'de 5 dakika boyunca buz üzerinde ve hemen serin. CAKatkı! ALD İçeriği (etidyum bromür ve formamiddir, Malzeme bakınız) sırasıyla, mutajen ve aşındırıcı.
    5. Örnekleri yükleyin ve arada tampon geri dönüşümü ile yaklaşık 1 saat boyunca 50 V de jel çalıştırın. UV görselleştirme veya jel görüntüleme ile RNA fraksiyon desenini kontrol edin. 28S ve 18S rRNA ve tRNAs tekabül eden somut bantları tanır (Şekil 1).
  4. -80 ° C'de Kuzey Testi veya saklamak RNA devam edin.

3. denatüre Akrilamid Jel Hazırlanması

  1. Bu bölme aşamasında için küçük bir dikey elektroforetik cihazı (plaka boyutu yaklaşık 8 cm x 9 cm, tarak kalınlığı 0,75 mm) kullanın.
  2. Bir döküm çerçeve içinde birbirine temiz gözlük birleştirin.
  3. (19: 1), MOPS 1X çözelti, 7 M üre,% 10 akrilamid / bis-akrilamid, 10 ml hazırlayın. Dökümden hemen önce,% 10 amonyum persülfat ve TEMED 100 ul, 10 ul ve süratli bir şekilde karıştırın. DİKKAT! Akrilamid nörotoksik ve kanserojendir.
  4. Cam plakalar arasındaki jel dökün ve kabarcıkları önlemek için dikkatli iyi tarak yerleştirin. Jel, kullanılmadan önce en az 45 dakika boyunca oda sıcaklığında polimerize edelim. Alternatif olarak, jel O / N, su ile ıslatılmış filtre kağıdı ile sarılmış ve saran sargısına kapalı olarak muhafaza edilebilmesi.

4. Numune Hazırlama

  1. 0,5-20 kısım her numune için toplam RNA'nın ug. 3-4 ul hacim aşarsa, vakum örnek kurutun.
  2. Boyut tayini için bir belirteç olarak (hazırlanması için, Bölüm 4.3 ve 4.4), örnekler paralel radyo-etiketli düşük frekans merdivenin bir kısım (20-30 cps) çalıştırın. Aşama 4.5 de tarif edildiği gibi, örnekler paralel olarak işleme tabi tutmaktadır.
  3. Merdiven: 10 bp-merdivene 0.1 ug kullanılarak fosfat ileri reaksiyonu kurmak. 30 dakika boyunca 37 ° C'de inkübe edilir ve 20 mM FC kadar etilendiamintetraasetik asit (EDTA) ilave ederek reaksiyonu durdurun.
  4. EtOH yağış / yıkama, kuru hava ve saflaştırarakGKD 2 O (yaklaşık 100 ul). tekrar süspansiyon DİKKAT! 32 P radyoaktif bir kaynağıdır.
  5. Her bir numune için akrilamid mavi boya (ABD) bir eşit hacmi ekleyin. 5 dakika boyunca 80 ° C'de ısıtılarak denatüre etmek ve yükleme. DİKKAT kadar buz üzerinde serin! Formamid (ABD cinsinden) aşındırıcıdır.

5. Elektroforetik Fraksiyonasyon

  1. Döküm destek cam plakalar çıkarın ve düzgün elektroforez hücrede bir araya. Yeterli Running Buffer (RB), her iki iç ve dış bölmeyi doldurun.
  2. Yavaşça tarak kaldırmak ve 10 dakika boyunca 200 V'de jel ön çalıştırın. Yükleme örnekleri önce, bir şırınga aracılığıyla bazı RB squirting kuyulardan üre mevduat silsin.
  3. Düz ipuçlarına her oyuğa altındaki aşama dikkatlice 4,5 tabakalandırmak örnekleri için. Ters akmasını önlemek için anot ve katot bağlantıları kontrol edin. Numuneler 5 dakika boyunca 100 V'ta jel girdikten sonra, ben200 V'a voltajı arttırın
  4. Yaklaşık 7 cm uzunluğunda, bir fraksiyonlara ayırma, bir 45 dakika süren bir çalışma yeterlidir. Jel taşma Bromofenol mavisi (ABD bir izleme pigment) kaçının.
  5. Tercihe bağlı bir adım olarak, etidiyum bromür (EtBr) boyama ile parçalanmış uzun RNA jel üzerinde: Görsel
    1. Jel üstünden uzağa 2 cm kesmek ve kısaca GKD 2 O. dilim durulayın
    2. RB, EtBr 0.5 ug / ml YP nazik karı koca gibi yaşayacaklar ile 15 dakika boyunca oda sıcaklığında jel dilim inkübe edin.
    3. RB 15 dakika jel destain, UV ışınlaması veya jel görüntüleme uzun rRNA görselleştirmek. RNA yükleme ve kalitesi (bkz Şekil 1, Panel 7). DİKKAT edin! Etidyum bromür bir mutajen.
  6. Bu arada küçük RNA türlerini içeren jel alt kısmı blot devam edin.

6. Jel Blot

  1. 6 lekeleme alanına sığdırmak için kurutma kağıdı parçaları ve uncharge eşdeğer bir parça kesmekd naylon membran. Kağıt yapraklarını, membran ve RB 2 blot pedleri nemlendirin. Tamamen art arda RB onları sıkarak pedleri emmek için emin olun.
  2. Aygıtından jel çıkarın ve bir spatula ile ortalama gözlük açın. Kuyu kaldırmak için temiz bir kesici kullanın. Jel ıslak whatman bir kağıt yerleştirin ve hafifçe yukarı kaldırın.
  3. Jelin serbest yüzünde bir naylon zar yerleştirin. Numune yükleme işlemi göre olan filtre yönlendirmek için bir köşe işaretleyin. "Sandviç" (3 Kağıt parçalarını her tarafı) tamamlayın. Olası bir hava kabarcıklarını çıkarmak için, yüzey üzerinde leke plastik çubuk döndürün.
  4. Blot kaset iki lekeleme pedleri ve daha sonra arasındaki blot yerleştirin. , Blot modülü kaseti monte RB ile bölmeyi doldurup (jel ve pozitif terminali arasında kalmalıdır naylon membran) doğru yönde kontrol edin.
  5. 20 dakika boyunca 20 V aktarın. Not: 10 dakika kurutma modülü ve r açtıktan sonra, homojen koşulları sağlamak içintransferi tamamlamadan önce 180 ° sandviç otate.

7. Membran Çapraz

  1. Taze Çapraz Çözüm (XLS) 6 ml hazırlayın. Doyurabilecek 10 cm (naylon membran daha büyük) 10 cm XLS. DİKKAT kurutma kağıdı parçası x! HCI (XLS bir bileşeni) son derece yakıcıdır.
  2. Blot sökün ve ıslak 3MM filtre kağıdı üzerinde membran yerleştirin. Not: RNA, doymuş kağıt ile doğrudan temas halinde olmamalıdır. Iki cam levha arasında filtresi ve kağıdı yerleştirin ve Saran-şal sarın.
  3. Bir GKD 2 O yıkama, ardından 2 saat boyunca 60 ° C 'de membran, ısıtın. -20 ° C'de saklayın veya melezleşme geçin.

8. Membran melezleme

  1. RNA yükleme (isteğe bağlı adım 5.5) kontrol edilmiş ise, doğrudan melezleme devam edin. Ya da, bir naylon filtreden en üstüne uzak 1 cm kesmek sistemi çapraz hybridizatio bilmekparçalanmış uzun RNA'lar ns.
  2. 37 ° C'de hibridizasyon çözeltisi (HS) 10 ml ön ısıtma. , 5 dakika boyunca 95 ° C 'de somon spermi, 1 mg denatüre buz üzerinde serin ve hümik ekleyin.
  3. , Bir hibridizasyon etüvü içinde dönme altında, en az 1 saat boyunca 37 ° C'de HS filtreyi inkübe edin. Filtrenin RNA tarafı HS karşı karşıya olduğunu kontrol edin.

9. Probe Sentez

  1. 4.3 de tarif edildiği gibi, belirli bir antisens oligonükleotid olarak 10 pmol bir fosfat ön reaksiyonu ayarlayın.
  2. (EtOH ya da çökeltme yoluyla) Tris-EDTA-NaCl (TEN) 5 hacim, reaksiyona tampon ve bir Sephadex G-25 sütun üzerinde jel dışlama kromatografisi ile birleşmemiş nükleotidlerden işaretli primer arındırmak ekleyin. Prob aktivitesi sıvı parıltı sayacı ile değerlendirilebilir.

10. Membran Hibridizasyon

  1. 10 ml taze alikot (yukarıda tarif edildiği gibi hazırlanan ve tamamlanan) ile bitmiş HS değiştirin. Isı için sondaBuz üzerinde serin ve yeni ekle HS 10 dakika boyunca 95 ° C olarak ölçülmüştür. 37 ° C AÇIK filtreyi inkübe.

11. Membran Yıkama

  1. Hibridizasyon çözüm kurtarmak ve bir radyoaktivite-koruyucu kutusuna -20 ° C'de saklayın.
  2. Yıkama Tamponu (WB) 'de durulayın ve oda sıcaklığında 10 dakika süre ile iyice yıkayın.
  3. Filtre köşelerde bakiye radyoaktivite kontrol etmek için bir Geiger Mueller Dedektörü kullanın. Arka plan emisyon yaklaşık 5 cps olduğunda, fuar zar geçin.

12. Sinyal Algılama

  1. Otoradyografisidir filmlerde ya da moleküler görüntüleme ekranı ON filtreyi Açığa. Fotografik işleme veya dijital dönüşüm ile sinyallerini veriyor.
  2. Özel ölçüm yazılımı (İmageJ veya Optiquant) tarafından bant yoğunluğu analiz edin.

13. Membran sıyırma

  1. Soyma çözeltisi kaynayan 500 ml su altında, zar birincil sinyalleri kaldırmak için, Daha sonra 1 dakika boyunca oda sıcaklığında inkübe edin. Yeni bir (ön) hibridizasyon ile devam ya da -20 ° C'de filtre saklayın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Şekil 1 'de metinde tarif edilen ve şematik bir şekilde temsil genel prosedür takip edilerek, farklı kökenlerden gelen karmaşık bir RNA örneklerinden küçük RNA'ların tanımını inceledik. (: Agaroz jel fraksiyonasyon denatüre bağlı bir adım) ve çift yüklü Şekil 1'de sunulan deneyde, RNA bütünlüğü açısından kontrol Proteinaz K ekstre Drosophila Schneider 2 hücrelerinden izole edilmiştir. Jelin yarısı nötr bir zar üzerinde kurutulur ve kimyasal olarak çapraz bağlantılı EDC; ikinci yarısında, daha sonra UV çapraz bağlantılı, pozitif yüklü bir naylon filtre üzerinde (1,2 x 10 5 μJ / cm 2) transfer edilmiştir. DMEL-miR279 ailesine ait iki microRNA endojen ifadesi (DMEL-miR279 kendisi ve DMEL-miR286 15) her iki durumda da doğrulandı. Geliştirilmiş işlem (ENB) standart bir (SNB) daha yüksek hassasiyet saygı sağlar.

Şekil 2 ve 3 vurgulanır. Deney Mantığı yukarıdaki ile aynıdır: burada testisler inen yetişkin ekstrakte edilen toplam RNA titrasyonu boyunca piRNA rasi4 Northern Blot otoradyografik algılama temsili bir sonuç rapor etmektedir. RNA, 0.5 ug yüklendiğinde ENB önceden özel bir bant tespit sağlar. Ölçüm kenara orantılı bir sinyal, doz / yanıt oranının saptanması lineer aralığında bağlı olduğunu göstermektedir, parçalanmış RNA miktarı ile orantılı olarak artar gösterir. Grubu aşağıda SNB göre bu yöntemin daha iyi hassasiyet onayladı. Bu durumda, tespit edilebilir bir sinyal en az SNB için RNA 10 ug elektroforetik ayırma ile elde edilir.

Şekil 3 <belirtildiği gibi benzer sonuçlar, örneğin, farklı bir kodlayıcı olmayan RNA türünün, 5S rRNA elde edilir/ Strong>.

Şekil 1
Genel Northern Blot prosedürü 1. şematik Şekil. Ana prosedürel adımlar listelenmiş ve giderek sayılı. Sonuçlar aynı koşullarda gerçekleştirilen Geliştirilmiş Kuzey Blot (ENB) ve Standart Kuzey Blot (SNB), arasında karşılaştırıldı: Drosophila Schneider'in 2 hücreleri (Panel 1), elektroforez (Panel 2), transfer (Panel 3) ve melezleşme (RNA izolasyonu Panel 5). ENB hedef RNA 5'-ucunda ve membran arasına bağlanan bir kovalent (kurar nötr bir filtre (3 Panel membran sol yarısı) ve EDC-esaslı çapraz bağlama (Panel 4) gerektirir, bu raporda tarif edilen gelişmiş prosedürden söz eder Panel 4 pembe nokta). SNB RNA, çapraz pozitif Nylo yüklü bir UV tedavisi (Panel 4) elde edilirn, membran (3 panel, zarın sağ yarısı). O da SNB ve ENB prosedürü arasındaki farklar yanıt verdiği 5'ler RNA spesifik sinyal, karşılaştırmalı koşullarda bir kalibratör değildir. Bu durumda, bir 5'-etiketli (10 cps tekabül eder) bir miktar (bir referans "başak" olarak işlev, 50 nt uzunluğunda karıştırılmış oligonükleotit elektroforezden önce her bir örneğe ilave edildi (puan 4.3 ve protokolün 4.4) Panel 7). Yükleme aynı zamanda uzun rRNA (protokol noktası 5.5) on jelde EtBr boyanması ile tespit edilebilir. L = Merdiven. FV = Frontal View, LV = Yandan Görünüm, YG = Yatay Görünüm. , bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 2
Şekil 2. Comparrasi4 ifade akseptör kuzey benek analizi. testis özel piRNA rasi4 endojen seviyelerinin yüksek (ENB) veya standartlar (SNB), Northern blot ile açığa çıkarılır, Drosophila ergin testis çıkarılan (Her kuşaktan, yukarıda belirtilmiştir), toplam RNA üzerinde gerçekleştirilmiştir artan miktarları , veya tüm karınlarının dan (Abd). Her metodoloji için, bir kenara histogramlar yükleme kontrolü "başak" a aynı miktarda rasi4 saygı göreceli miktarlarını rapor. İki yöntemlerden sayımsal jeller altına yerleştirilen kesin grafiğinde birleştirilir. , bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Şekil 3,
5s r Şekil 3. Karşılaştırmalı Northern Blot analizleriRNA ifade. Pozitif kontrol ve deneysel kalibrasyon gibi bir önceki analiz 5'ler rRNA'nın uzatıldı. Detaylar Şekil 2 deki gibi. , bu rakamın büyük bir versiyonunu görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

RNA nörogenezi düzenleyen hangi aracılığıyla intertwining sophisticate bizim takdir sürekli artmasına rağmen, nöral kök hücre biyolojisi, nöronal farklılaşma / fonksiyonel entegrasyon, sinir patolojileri ve kanser gelişimini etkileyen RNA bazlı circuitries mekanik etkileri keşfedilmemiş kalır. Drosophila kısa kodlamama RNA'lar ve transkripsiyon faktörleri majör moleküler oyuncuları olarak hangi keşfedilmemiş hücresel yollar, çözülmeye enstrümantal melanogaster gibi krallıklar aracılığıyla bu ağların bakım genetik sistemlerin potansiyelini yapar. Bu görüşe göre, aday küçük RNA ekspresyon seviyelerinin profil doğru işlevsel analizleri için propaedeutic gerçekleştirilir: Örnek Kuzey Beneklenmesi deneyi geliştirilmiş bir versiyonu olarak aracılığıyla gerçekleştirilir DMEL-miR279 in vivo gsm / kayma kaderi belirleyicisi modüle eden yeni gösterimi, gelen ekspresyon analizi için bir araç.

51 yılında ilk kalkınma beri class = "jove_content">, NB RNA analizi için referans yöntem olarak kabul edilmiştir. Sinyal ölçümü ile biçim veya olası hataları multiplex zor dönüşüm olarak bu testin bazı içsel sınırlamaları rağmen, RNA moleküler biyolojisinde son atılımlar küçük ribonükleik endojen ifadesini denemeye yönelik bir "hızlı ve temiz" sistemi olarak bu geleneksel tekniği yeniden keşfedilen var asitler veya gain- veya kayıp fonksiyon-yaklaşımların etkinliğini doğrulamak için. Yaklaşım düzenleme RNA'lar 52 sürekli yeni özellikleri karakterizasyonu kendi alaka için ön planda kalırken paradigmatik örneği olarak, Kuzey analizi, microRNA orijinal keşif temelinde yatmaktadır.

Burada tarif edilen varyant bağlı RNA kimyasal çapraz bağlama için artmış duyarlılık dayanmaktadır. Biz believethe yöntemi hala kötü Drosophila istihdam, bBu RNA hedef tespit 41,43 ortalama 10-30 kat artış ile küçük örnekler (az 1 ug), mümkün profilleme RNA ifadesini yapar beri bizim koşullarda elde edilen ut istismar, önemli keşiflerinden 52 yol açmıştır (Şekil 2 ve 3).

RNA bütünlüğü tutarlı ve tekrarlanabilir sonuçlar elde etmek için kritik bir sorunu oluşturmaktadır. RNA manipülasyonlar çıkarma ve yükleme arasında meydana gelen olası örnek bozulmayı sınırlamak için doğruluk ve hız gerektirir. Bu amaçla, tüm solüsyonlar, RNaz etkinliği engelleyecek şekilde (DEPC) (otoklav daha sonra 37 ° C'de% 0.1 DEPC varlığında 2 saat inkübasyona bırakıldı ve) kullanımı, daha önce işleme tabi diethylpyrocarbonate- olması gerekir. Çözelti tedavi, bir çözücü olarak su kullanılarak DEPC ile daha iyi sonuçlar saygı garanti eder. Tüm ekipman eşit bir Rnase-spesifik yüzey temizleyici ile temizledikten sonra, DEFPC ddH20 durulanmalıdır olacaktır.

(örneğin, rasi4, Şekil 2) veya RNA saflaştırma (taze numuneler üzerinde gerçekleştirilmiştir olmadığında, örneğin, doku depoya korunmuş reaktif). Deneyim, stabilize örneklerinden RNA izolasyonu ölçüde sert sonuçlandı ve daha şiddetli çıkarma şartları. Standart koşullarda, açıklanan proteinaz K-tabanlı bir yöntem de, (önemli bir örnek Şekil 1'de temsil edilir) iyi kalitede hazırlıklarını garanti ama depolama reaktiflerdeki korunmuş örnekler için uygun bir seçim değildir.

Bu prosedür, küçük RNA, spesifik olarak saptanması için hedeflediği için, son olarak, özel kolon saflaştırma dayalı kitler de th da, doğrudan küçük RNA izolasyonu için kullanılabilecektirisimli RNA bütünlüğünü doğrulamak için zor hale getirir. Yukarıda tarif RNA bütünlüğü kontrol için klasik bir jel bazlı prosedürüne bir alternatif olarak, nükleik asit, RNA, kalite desen çip üzerinde küçültülmüş analiz cihazları ile değerlendirilebilir.

Tampon seçimi: MOPS-NaOH tamponu (pH 7) Geliştirilmiş Kuzey lekeleme ve jel elektroforezi her ikisi için tercih edilen bir tampon olarak önerilmiştir. Biz de tatmin edici bizim deneylerde Tris-borat-EDTA (TBE) tamponu kullanılmıştır. Tris (hidroksimetil) aminometan nükleofil amin gruplarının varlığı kendini hidrolize olan ve tedavi sırasında DEPC inaktive olur çünkü bu durumda ise, bu DEPC ile muamele edilmiş su yerine tedavi TBE tamponu içine önceden hazırlanmış Tris çözülmesiyle tavsiye edilir.

Elektroforetik çalıştırın ve Blot: jel Ön çalışan fazla persülfat kaldırılması ve hyperfocusing ortadan kaldırmak için gereklidir. Ön çalışma parametreleri çok hızlı electropho kaçınarak, parçalanması sırasında da muhafaza edilmelidirRetikülosit çalıştırın. Yüklemeden önce, içeride tampon squirting, kuyulardan mümkün Üre tortuları kaldırmak için emin olun. Bu sinyaller tespit sırasında çözüldü otoradyografik bantları üreten, örnek dökülmesine ve teminatlar doğru RNA tabakalaşma sınırlayacaktır. Herhangi bir nötr naylon zar nükleik asit aktarımı için bir destek olarak kullanılabilir. Belirtilen koşullarda fazla 20-30 dakika boyunca RNA leke yoktur.

Çapraz bağlama: EDC-bazlı kimyasal çapraz bu gelişmiş Northern Blot sürümü kritik metodolojik ilerlemeyi temsil etmektedir. Olasılığı RNA 5'mono-fosfat grubu ve naylon primer aminler arasında kovalent sınır tarafından nötr yüzeylere kısa RNA türlerini çapraz bağlanması için melezleşme için kullanılabileceği bazların çoğunluğu bırakır. Bu geleneksel çapraz bağlama için 10-20xrespect olarak duyarlılığı arttırır. Bu uygun bir membran doygunluk için yeterli bir miktarda, her bir lekeleme için çapraz bağlama çözeltisine taze miktarının hazırlanması için çok önemlidir.

Hibridizasyon ve Yıkama: Sondalar tercihen taze etiketli olmalıdır. (Melezleşme için kullanılabileceği sonda miktarı, ayrıca spesifik aktivitesine bağlı olarak ve bu buluşa katılan radyoaktif olarak işaretlenmiş nükleotid miktarı ve benzeri) bir spesifik aktivitesinin Prob, hedef saptama hassasiyetini belirler. 3000 Ci / mmol bir özgül etkinliğe ATP kullanılmıştır [32P γ-] olduğunda, 5 'uçlarında, 100% etiketleme için 10 6, cpm / pmol beklenmektedir.

Hibridizasyon Çözelti geri kazanılabilir ve göz önünde yeniden kullanılabilir, nedeniyle bu 32P bozunma, yaklaşık 14 gün içinde sistemi aktivitesi değinmektedir.

Nedeniyle membran tarafsızlık, düşük arka plan gürültü melezleşme üzerine bekleniyor. Daha sıkı yıkama koşulları gerekli olması halinde, aşamalı olarak (0.2x SSPE kadar) yıkama tamponu iyonik kuvvetini azaltmak ya da 37 ° C yıkama sıcaklığı yükseltmek iyonik deterjanlar ya da (en fazla% 0.5 SDS ile) artan bir şekilde artırmıştır.

RNA, boyut ölçümü ne zaman gerekli olduğunu Northern leke analizi önemlidir. Bu tahlil floresan tabanlı QPCR minik RNA'lar tahmini için yaklaşımlarının doğruluğunu yoksun olsa bile, bir avantaj / denatüre parçalaması kullanılarak kurutma ve hedef RNA'lar algılama önce benzersiz adımlar olarak prob-bağımlı hibridizasyon türemiştir. Bu nedenle, örneğin belirli sinyallerin açığa doğrudan ve özel ticari kit kullanımını ima enzimatik işlem / dönüşüm / amplifikasyonu herhangi bir ek aşamasını gerektirmez. RNA seviyeleri ölçülür ve tek dokular üzerinde birçok örnek arasmda karşılaştırılabilir. Böylece NortheRN benek yaygın QPCR verileri için sıkı bir doğrulama olarak kullanılır. Spesifik deneysel koşullara bağlı olarak tetiklenen yöntem RNA'ların sınırlı miktarda (Şekil 2 ve 3), böylece de her iki hassasiyet ve çözünürlük seviyesinde, son yıllarda geliştirilmiştir başarılı bir analiz için gereklidir.

Biz sunulan protokol malzeme, sınırlı miktarlarda mevcuttur, özellikle geniş bir uygulama yelpazesi için adapte edilebilir. RNA örneklerinin biyolojik kaynağı heterojen olabilir: Drosophila söz konusu kadarıyla, embriyolar ya da diğer gelişim aşamaları, tek tek hücrelerin izole Ayırma cytotypes veya hücre kültürleri, uygun olan, ama aynı zamanda el ile dokuları ya da organları kesildi.

Ayrıca, microRNA hücre ve RNA aracılı gen ifade kontrolü alanında soruşturma önemli konu kısa düzenleme RNA'lar en bol sınıf rağmen onlar dezavantajları mutlakaHücresel kodlayıcı olmayan RNA'lar tek aile titute. Küçük RNA'ların Çok sayıda küme genellikle ön moleküllerinin endo-ribonucleolytic işleme türeyen krallıklar (örneğin, endojen siRNA'lar, piRNAs, snoRNAs, bitki tasiRNAs) ve bunların çoğu (modifiye edilmemiş) bir serbest 5 'ucundan itibaren özelliği, işleyiş. Bu özellik uzun RNA'lar bakıldığında RNA boyutu yanı dikkate alınması olsa bile, kesinlikle kimyasal çapraz dayalı özel geliştirilmiş metodolojisini uygulamak için gerekli benzersiz yapısal önkoşul oluşturmaktadır. Şekil 2 de, geliştirilmiş bir hassasiyet Northern Blot analizleri nispeten zayıf rasi4 54 ve spesifik ekspresyon düzeylerinin koşullarında germ-çizgisi küçük RNA özgü bir sınıf (RNA ya da piRNAs Piwi etkileşen.) Üyesi seviyelerini tespit rapor Bu yöntemin, özellikle bilgi protokolü ayrıca tarak tarafından geliştirilebilir göz önüne alındığında, daha iyi sonuç yaptırımLiteratürde daha önce 55,56 açıklanan diğer pratik uygulamaları ile içerebilen.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Bu çalışma Institut National de la Sante et de la Recherche Médicale tarafından desteklenen, Centre National de la Recherche Scientifique, Université de Strasbourg, Hopital de Strasbourg, pour la Recherche Derneği sur le Kanser, Institut National du Kanser, Agence Nationale de la Recherche ve Bölge Alsace.

Pietro LaNeve la Recherche Médicale Fondation tarafından dökün desteklenmiştir. Şu anda, o bir Istituto Italiano Tecnologia (İİT) bursu bir alıcı. Yayın maliyetleri Neurex ağı tarafından desteklenmektedir (TriNeuron - Program İnterreg IV Yukarı Ren)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics