Maggiore Northern Blot rilevazione di piccoli RNA specie in

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Lo scopo di questa pubblicazione è quello di visualizzare e discutere le fasi operative di un protocollo Northern Blot avanzata su RNA estratto da Drosophila melanogaster embrioni, cellule e tessuti. Questo protocollo è particolarmente utile per il rilevamento efficiente delle piccole specie di RNA.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Gli ultimi decenni hanno visto l'esplosione di interesse scientifico intorno a meccanismi di controllo dell'espressione genica a livello di RNA. Questa branca della biologia molecolare è stato notevolmente alimentata dalla scoperta di RNA non codificanti come principali attori regolazione post-trascrizionale. Tale prospettiva rivoluzionaria è stata accompagnata e innescata dallo sviluppo di tecnologie avanzate per la profilazione dell'espressione RNA breve, sia a livello di high-throughput (identificazione genome-wide) o come l'analisi singolo candidato (accumulo stato stazionario di determinate specie). Anche se diverse strategie state-of-art sono attualmente disponibili per il dosaggio o la visualizzazione di tali molecole in fuga, saggio Northern blot rimane l'approccio ammissibile in biologia molecolare per la valutazione immediata e precisa di espressione dell'RNA. Esso rappresenta un primo passo verso l'applicazione delle più sofisticate tecnologie, costose e, in molti casi, rimane un metodo preferenziale per guadagnare facilmente intuizioniin RNA biologia. Qui PANORAMICA un protocollo efficiente (Enhanced Northern Blot) per rilevare microRNA debolmente espresse (o altre piccole specie di RNA regolatori) da Drosophila melanogaster embrioni interi, sezionato manualmente tessuti / adulti larvali o in cellule coltivate in vitro. È necessaria una quantità molto limitata di RNA e l'uso di materiale dal flusso citometria cellule isolate possono essere anche previsto.

Introduction

RNA biochimica ha sperimentato progressi spettacolari negli ultimi anni 1. La nostra comprensione del potenziale RNA nel controllo dell'espressione genica è stata scoppiata dall'identificazione dei potenti non codificanti Ribo-regolatori 2, dalla scoperta di nuovi a base di RNA-meccanismi regolatori 3,4 e da una caratterizzazione più profonda di eventi post-trascrizionali già noti 5. Tutti biologia dell'RNA insieme questi studi hanno permesso di rendere drammaticamente la scena, diventando un importante soggetto di ricerca nel panorama scientifico attuale. In particolare, negli ultimi anni stiamo ottenendo un senso di impatto pervasivo del "mondo RNA" in neurobiologia molecolare 6, uno dei settori di ricerca più dinamiche della moderna scienza della vita. Nell'ultimo decennio del secolo scorso, lo scenario scientifico generale è stata rivoluzionata dalla scoperta del RNA interference 7,8 e dei piccoli RNA regolatori 9,10con particolare riguardo alle microRNA 11, endogenamente espressi piccoli RNA non codificanti implicati nel controllo di quasi tutte le funzioni cellulari come regolatori pleiotropici e combinatorie di espressione genica.

Quasi 10 anni dopo la scoperta iniziale miRNA in Caenorhabditis elegans di Ambros e laboratori di Ruvkun, rinnovata attenzione è stata rivolta al campo quando un alto numero di miRNA sono stati identificati in Drosophila e in cellule umane e 12-15. Da allora, grazie ad approcci transgenici versatili, Drosophila melanogaster è distinto come un contesto biologico prezioso per approfondire miRNA biosintesi e di attività. Drosophila miRNA hanno rivelato funzioni distinte in processi specifici insetti o evolutivamente conservati, che vanno dall'invecchiamento al metabolismo, vie di segnalazione , il comportamento e, naturalmente, neurogenesi. Lungo questa direzione, abbiamo recentemente presentato un link romanzo 16 nella co intriganterrelation che si verificano tra il gene maestro GCM / planata e il percorso di RNA. Il fattore di trascrizione mosca Gcm / Glide 17-19 costituisce un esempio unico del destino delle cellule determinante, che condiziona la scelta destino neuronale gliale vs in multipotenti vola precursori neurali 20. Venti anni di lunghe ricerche su questo argomento ha chiaramente sottolineato la presenza di molteplici e sovrapposte ingressi di regolazione dell'espressione genica convergenti su gcm / glide 21-28 per stabilire i livelli di soglia richiesti per bilanciare il delicato rapporto tra controparti neuronali e gliali durante lo sviluppo neurale.

Abbiamo scoperto che la regolamentazione tramite DMEL-miR279 il targeting rappresenta un ulteriore livello di controllo che contribuiscono alla post-trascrizionale messa a punto di GCM / espressione 16 planare. Globalmente, queste linee di ricerca sono necessari miglioramenti metodologici specifici: lungo anni, diverse tecnologie sviluppate originariamente per analizzare tradRNA transitorie, sono stati convertiti per quantificare piccoli RNA non codificanti, come come saggi di RNase protection, array di cDNA 29-31, real-time PCR metodi 32-35 e sequenziamento 36,37. Dall'altro lato, ricalibrazione degli approcci tecnici ha favorito continui progressi nel campo.

Northern Blot test (NB, o gel RNA blot) costituisce un esempio rappresentativo: è in gran parte utilizzato per il profilo accumulo di RNA, in quanto garantisce sia a livello di espressione quantitativa nonché la determinazione dimensione. Tuttavia, la scarsa sensibilità intrinseca del metodo è limitante quando è applicato a bassa abbondanti espressione genica accordatori, come piccoli RNA. Una conseguenza dannosa è il requisito di grandi quantità di RNA totale, il che rende difficile la sua applicazione a campioni biologici specifici. Per tali ragioni, le varianti NB specifici per il rilevamento di piccoli RNA sono stati sviluppati 38-40: abbiamo approfittato di una migliore proc NBedure 41 (ENB, avanzato Blot Nord), mentre chiarire la suddetta interazione tra DMEL-miR279 e GCM / planata.

Questo metodo si basa su un gradino chimica di reticolazione basato sull'attività di un derivato carbodiimmide [1-etil-3-(3-dimetilamminopropil) carbodiimmide, EDC] fissare acido nucleico su supporti solidi. Carbodiimide è un linker croce versatile conosciuta per catalizzare la formazione di legami ammidici tra attivati ​​gruppi carbossilici o fosfato e gruppi amminici 42. Questa proprietà può essere sfruttata per coppia covalentemente piccoli RNA attraverso il loro gruppo 5'-idrossile mono-amino fosforilata a gruppi sulla superficie delle membrane di nylon. La configurazione risultante attaccamento aumenta l'accessibilità dell'acido nucleico immobilizzato e, a sua volta, l'efficienza di ibridazione sonda-bersaglio, che si traduce in notevole miglioramento rilevamento 43.

La tecnica assume particolare relevance in studi molecolari Drosophila, dal quale, al verificarsi di nuovi e distintivi classi di piccoli RNA non codificanti sta emergendo 44. Tra questi, rasiRNAs 45,46 costituiscono uno specifico sottotipo di RNA-piwi interagenti (piRNAs 47), coinvolti nella sequenza-specifico silenziamento genico. Dettagli operativi di questo metodo sono descritti e visualizzati in appresso, relative all'analisi del DMEL microRNA-miR279 e DMEL-miR286 e, per la prima volta, di una rasiRNA, rasi4. Abbiamo spinto all'estremo questo metodo, che ci ha permesso rivelare bersagli poco espressi da quantità minime di RNA (meno di 1 mg).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 Raccolta dei campioni

  1. Staccare 2 celle semi-aderente di Schneider, (1-5 x 10 6 cellule in media), pipettando e raccolta per centrifugazione (100 xg per 1 min). Nel caso di cellule aderenti coltivate in vitro, li trypsinize in condizioni standard o direttamente raccoglierli da piastre in una conveniente quantità di RNA reagente di estrazione, con l'aiuto di un raschietto cellulare.
  2. Per la raccolta degli embrioni, crescere i ceppi di Drosophila in gabbie fly e lasciare che gli embrioni si accumulano sui piatti deposizione delle uova. Pulire gli embrioni fuori da un pennello in acqua distillata (dH 2 O), eliminare i detriti da filtrazione setaccio, lavare e recuperare gli embrioni in un flaconcino 48.
  3. Come tecnica alternativa, sezionare manualmente tessuti / organi. Isolare testicoli (un sistema preferenziale per l'analisi piRNA) da Drosophila addome in tampone fosfato (PBS) allo stereomicroscopio (ingrandimento 20X), utilizzando aghi dissezione o pinze come visCrown perso- nalizzate a Sullivan et al 49.
  4. Pestello omogeneizzare campioni sulla tossicodipendenza a 0,5 volumi di reagente di estrazione di RNA.

2. RNA Estrazione / Analisi

  1. Le istruzioni del fabbricante eseguire l'isolamento di RNA attraverso reagenti in commercio. ATTENZIONE! Agenti di estrazione di RNA sono generalmente tossici e caustici. In alternativa, applicare un protocollo basato-proteinasi K per l'isolamento dell'RNA 50, come segue:
    1. Diluire i campioni in 400 ml di arresto Mescolare ed incubare a temperatura ambiente per 15 min.
    2. Recuperare componenti idrosolubili di fenolo serie: cloroformio: alcool isoamilico e estrazioni cloroformio e di etanolo (EtOH) precipitazione / lavaggio. Aria asciugare i campioni e risospendere in dietilpirocarbonato (DEPC) -treated bidistillata (dd) H 2 O.
  2. Valutare la concentrazione di RNA mediante misurazione spettrofotometrica UV. Anche assicurare la purezza dell'RNA è alta, vicino a 2.0, basEd su A 260 / A 280 lettura.
  3. Controllare la preparazione di RNA su gel di agarosio denaturante come segue:
    1. In un bicchiere pulito, sciogliere 1,2 g di agarosio in 82 ml di DEPC-DDH 2 O, sotto continua agitazione. Far bollire fino a completa dissoluzione.
    2. Lasciare che la soluzione di gel raffreddare; quando la temperatura raggiunge i 60 ° C aggiungere 10 ml di acido 4-10X morpholinepropanesulfonic (MOPS) tampone 1X a concentrazione finale (FC), e 8 ml di formaldeide al 37% al 3% FC. ATTENZIONE! La formaldeide è una sostanza cancerogena.
    3. Versare il gel in una cella per elettroforesi orizzontale. Lasciare che il gel di solidificare sotto una cappa per almeno 1 ora. A seguito di solidificazione, immergere il gel in MOPS 1X.
    4. Aliquota 2 mg di campione di RNA e 1 mg di Scala (utilizzare un marcatore RNA quando si desidera una valutazione accurata). Aggiungere 3 volumi di agarosio colorante di caricamento (ALD) per RNA e Ladder. Riscaldare a 70 ° C per 5 minuti e raffreddare immediatamente su ghiaccio. CATENZIONE! Contenuti di ALD (etidio bromuro e formammide, vedi Materiali) sono mutageno e corrosivo, rispettivamente.
    5. Caricare i campioni ed eseguire il gel a 50 V per circa 1 ora con occasionali riciclo buffer. Controllare il modello di RNA frazionamento da visualizzazione UV o immagini gel. Riconoscere bande discrete corrispondenti a 28S e 18S rRNA e tRNA (vedi Figura 1).
  4. Procedere alla Northern Assay o negozio di RNA a -80 ° C.

3. Denaturing acrilamide Gel Preparazione

  1. Utilizzare un piccolo apparato per elettroforesi verticale per questo passo frazionamento (dimensioni piastra circa 8 cm x 9 cm, pettine spessore di 0,75 millimetri).
  2. Montare bicchieri puliti insieme in una cornice di casting.
  3. Preparare 10 ml di 10% di acrilammide / bis-acrilamide (19: 1) soluzione in MOPS 1X, 7 M urea. Immediatamente prima di versare, aggiungere 100 ml di 10% di persolfato di ammonio e 10 ml di TEMED e rapidamente mescolare la soluzione. ATTENZIONE! L'acrilammide è neurotossico e cancerogeno.
  4. Versare il gel tra lastre di vetro e inserire con cautela il pettine bene per evitare bolle. Lasciate che il gel di polimerizzare a temperatura ambiente per almeno 45 minuti prima dell'uso. In alternativa, conservare il gel O / N, avvolto in carta da filtro imbevuta di acqua e sigillati in involucro di saran.

Preparazione del campione 4

  1. Aliquotare 0,5-20 mg di RNA totale per ogni campione. Se il volume supera 3-4 microlitri, vuoto asciugare il campione.
  2. Per la determinazione della dimensione, eseguire una aliquota (20-30 cps) del radiomarcato scala della gamma bassa in parallelo ai campioni, come marcatore (vedere paragrafo 4.3 e 4.4 per la preparazione). Trattare in parallelo ai campioni, come descritto al punto 4.5.
  3. Scala: istituito una reazione in avanti fosfato con 0.1 mg di una scala di 10 bp-passo. Incubare a 37 ° C per 30 minuti e interrompere la reazione aggiungendo acido etilendiamminotetraacetico (EDTA) per 20 FC mM.
  4. Purificare da EtOH precipitazione / lavatrice, aria secca erisospendere in DDH 2 O (circa 100 ml). ATTENZIONE! 32 P è una sorgente radioattiva.
  5. Per ogni campione aggiungere un uguale volume di acrilammide colorante blu (ABD). Denaturare da riscaldamento a 80 ° C per 5 minuti e lasciare raffreddare su ghiaccio fino caricamento. ATTENZIONE! Formammide (contenuto in ABD) è corrosivo.

5. elettroforetica Frazionamento

  1. Rimuovere le lastre di vetro dal supporto colata e correttamente li assemblano in cella elettroforesi. Riempire sia camera interna e esterna con sufficiente tampone di corsa (RB).
  2. Rimuovere delicatamente il pettine e pre-eseguire il gel a 200 V per 10 min. Prima di caricare i campioni, lavare via i depositi di urea dai pozzetti spruzzando qualche RB attraverso una siringa.
  3. Utilizzare punte piatte per stratificare i campioni attentamente dal punto 4.5 al fondo di ciascun pozzetto. Controllare i collegamenti anodo e catodo per evitare il funzionamento invertito. Dopo i campioni entrano nel gel a 100 V per 5 minuti, iaumentare l tensione di 200 V.
  4. Per una lunghezza frazionamento di circa 7 cm, 45 min-lungo periodo è sufficiente. Evitare di blu di bromofenolo (un pigmento inseguimento in ABD) traboccare il gel.
  5. Visualizza on-gel i frazionati lunghi RNA di etidio bromuro (EtBr) colorazione, come un passaggio facoltativo:
    1. Tagliare 2 cm dalla parte superiore del gel e sciacquare brevemente la fetta in DDH 2 O.
    2. Incubare la fetta gel a temperatura ambiente per 15 minuti con dolce Shacking in RB, EtBr 0,5 mg / ml FC.
    3. Destain il gel per 15 minuti in RB, visualizzare lunghi rRNA di irradiazione UV o immagini gel. Verificare la presenza di RNA di carico e di qualità (vedi Figura 1, pannello 7). ATTENZIONE! Etidio bromuro è un agente mutageno.
  6. Procedere frattempo assorbente la parte inferiore del gel contenente piccole specie di RNA.

6. Gel Blotting

  1. Tagliare 6 pezzi di carta assorbente per adattarsi all'area blotting e un pezzo di uncharge equivalentemembrana di nylon d. Inumidire fogli di carta, membrana e 2 pastiglie blotting in RB. Assicurati di immergere completamente le pastiglie ripetutamente spremitura a RB.
  2. Rimuovere il gel dall'apparecchio e aprire gli occhiali per mezzo di una spatola. Utilizzare un cutter pulito per rimuovere i pozzi. Mettere un foglio di carta Whatman bagnato sul gel e sollevare delicatamente verso l'alto.
  3. Posizionare la membrana di nylon sulla faccia libera del gel. Segna un angolo per orientare il filtro secondo il campione di carico. Completa il "sandwich" (3 pezzi di carta ogni lato). Roll un asta di plastica sulla superficie blot, per rimuovere eventuali bolle d'aria.
  4. Posizionare la macchia tra due pastiglie blotting e poi nella cassetta assorbente. Montare la cassetta nel modulo assorbente, riempire la camera con RB e verificare il corretto orientamento (membrana di nylon deve stare tra il gel e il capolinea positivo).
  5. Trasferimento a 20 V per 20 min. Nota: al fine di garantire condizioni omogenee, dopo 10 min aprire il modulo assorbente e rotate il panino di 180 ° prima di completare il trasferimento.

7 Membrana reticolazione

  1. Preparare 6 ml di soluzione di reticolazione fresca (XLS). Saturare di 10 cm x 10 cm (più grandi rispetto membrana di nylon) pezzo di carta assorbente con XLS. ATTENZIONE! HCl (un componente di XLS) è altamente corrosivo.
  2. Smontare la macchia e posizionare la membrana sulla carta da filtro 3MM bagnato. Nota: RNA non deve essere a contatto diretto con la carta satura. Posizionare il filtro e la carta tra due lastre di vetro e avvolgere in saran-wrap.
  3. Riscaldare la membrana a 60 ° C per 2 ore, seguita da un DDH 2 O lavaggio. Conservare a -20 ° C o procedi alla ibridazione.

8 Membrana prehybridization

  1. Se RNA di carico è stata controllata (passo opzionale 5.5), procedere direttamente al ibridazione. Oppure, asportate a 1 cm dalla parte superiore del filtro di nylon, per evitare sonda trasversale hybridizations a lunghi RNA frazionati.
  2. Preriscaldare 10 ml di soluzione di ibridazione (HS) a 37 ° C. Denaturare 1 mg di sperma di salmone a 95 ° C per 5 minuti, raffreddare su ghiaccio e aggiungere al HS.
  3. Incubare il filtro in HS a 37 ° C per almeno 1 ora, in rotazione in un fornetto. Controllare che l'RNA-lato del filtro facce HS.

9 Sonda Sintesi

  1. Impostare una reazione in avanti fosfato, il 10 pmol di specifici oligonucleotidi antisenso, come descritto in 4.3.
  2. Aggiungere 5 volumi di Tris-EDTA-NaCl (TEN) tampone di reazione e purificare il primer marcato da nucleotidi non incorporati mediante cromatografia di esclusione gel su colonne G-25 Sephadex (o anche da EtOH precipitazione). L'attività della sonda può essere valutata scintillazione Contatore Liquid.

10 Membrana Ibridazione

  1. Sostituire la HS esaurito con un nuovo 10 ml aliquota (preparata e completato come descritto sopra). Riscaldare la sonda a95 ° C per 10 minuti, raffreddare su ghiaccio e aggiungere al romanzo HS. Incubare il filtro a 37 ° C ON.

11 Membrana di lavaggio

  1. Recuperare la soluzione di ibridazione e conservarlo a -20 ° C in una scatola-radioattività di schermatura.
  2. Sciacquare il filtro in lavaggio Buffer (WB) e lavarlo accuratamente per 10 minuti a temperatura ambiente.
  3. Utilizzare un rivelatore Geiger Mueller per il controllo radioattività residua agli angoli del filtro. Quando emissione sfondo è di circa 5 cps, procedere alla membrana esposizione.

12 Rilevamento segnale

  1. Esporre il filtro sui film autoradiografia o su uno schermo imager ON molecolare. Rivela segnali di elaborazione fotografica o conversione digitale.
  2. Analizzare l'intensità della banda da un software dedicato quantificazione (ImageJ o Optiquant).

13 Membrana Stripping

  1. Per rimuovere i segnali primari, immergere la membrana in 500 ml di soluzione bollente Spogliarello, Poi incubare a temperatura ambiente per 1 min. Procedere al romanzo (pre) ibridazione o conservare il filtro a -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Seguendo la procedura generale descritta nel testo e schematicamente rappresentato in figura 1, abbiamo valutato l'espressione piccoli RNA da campioni di RNA complessi di diversa origine. Nell'esperimento illustrato nella figura 1, l'RNA è stato isolato da di Drosophila Schneider 2 celle di estrazione proteinasi K, controllato per l'integrità (passaggio facoltativo: denaturante di agarosio gel frazionamento) e caricato in doppio. Una metà del gel è stato cancellato su una membrana chimicamente neutro e cross-linked da EDC; la seconda metà è stato trasferito su un filtro di nylon caricata positivamente, UV reticolato (1,2 x 10 5 μJ / cm 2). L'espressione endogena di due microRNA appartenenti alla famiglia DMEL-miR279 (DMEL-miR279 stesso e DMEL-miR286 15) è stata verificata in entrambe le condizioni. La procedura perfezionata (ENB) assicura una maggiore sensibilità rispetto a quella standard (SNB).

figure 2 e 3. La logica sperimentale è lo stesso come sopra: qui riportiamo il risultato rappresentante di Northern Blot rilevazione autoradiografica del rasi4 piRNA lungo una titolazione di RNA totale estratto da adulto volare testicoli. ENB già permette di rilevare una banda specifica quando viene caricato 0,5 mg di RNA. La quantificazione mostra parte come il segnale proporzionale aumenta con la quantità di RNA frazionata, indicando che il rapporto di dose / risposta sta nella gamma lineare di rilevamento. Il pannello sotto ratifica il miglioramento della sensibilità di questo metodo rispetto alla BNS. In questo caso, un segnale rilevabile è ottenuta al frazionamento elettroforetico di 10 mg di RNA almeno per il SNB.

Risultati simili si ottengono con una specie diversa codificante RNA, ad esempio, rRNA 5S, come riportato in figura 3 </ Strong>.

Figura 1
Figura 1 Rappresentazione schematica del procedimento complessivo Northern Blot. Le principali fasi procedurali sono elencate e numerate progressivamente. I risultati vengono confrontati tra Enhanced Blot Nord (ENB) e Standard Northern Blot (BNS), eseguiti in medesime condizioni: RNA isolamento da 2 cellule di Drosophila Schneider (pannello 1), elettroforesi (gruppo 2), trasferimento (pannello 3) e di ibridazione ( Pannello 5). ENB fa riferimento alla procedura perfezionata descritto nella presente relazione, che richiede un filtro neutro (Panel 3, metà sinistra della membrana) e reticolazione a base di EDC (Panel 4) che stabilisce un legame tra obiettivo RNA 5'-end e membrana covalente ( puntini rosa in Pannello 4). In BNS, RNA reticolazione si ottiene un trattamento UV (Panel 4) su una carica positiva NYLOn membrana (Panel 3, metà destra della membrana). Segnale specifico 5s RNA non è un calibratore in condizioni di confronto, perché risponde anche alle differenze tra BNS e procedura ENB. Così, un importo (corrispondente a 10 cps) di un marcato 5'(vedi punti 4.3 e 4.4 del protocollo), 50 oligonucleotide nt lungo criptato è stato aggiunto ad ogni campione prima di elettroforesi, di funzionare come un "picco di" riferimento ( Panel 7). Caricamento in corso può essere valutata anche on-gel EtBr colorazione dei lunghi rRNA (vedi punto 5.5 del protocollo). L = Scala. FV = Vista Frontale, LV = Vista Laterale, HV = orizzontale Vista. Cliccate qui per vedere una versione più grande di questa figura.

Figura 2
Figura 2 Comparanalisi ative Northern Blot dell'espressione rasi4. livelli endogeni di piRNA rasi4 specifica-testicolo sono rivelato da una maggiore (ENB) o standard (BNS) Northern Blot, eseguita su quantità crescenti di RNA totale (indicato sopra ogni corsia) estratto da adulti Drosophila testicoli , o da addomi interi (Abd). Per ogni metodologia, istogrammi parte segnalare le quantità relative di rispetto rasi4 per la stessa quantità di un "picco di" controllo di carico. Quantificazioni dei due metodi sono combinati nel grafico conclusiva posto sotto il gel. Cliccate qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3 comparativa Northern Blot analisi di 5s rRNA espressione. Come controllo positivo e calibrazione sperimentale, l'analisi precedente è stata estesa a 5s rRNA. Dettagli come in Figura 2. Cliccate qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Anche se il nostro apprezzamento per il sofisticato intreccio attraverso il quale l'RNA regola la neurogenesi è in continuo aumento, le implicazioni meccanicistiche di circuiterie di RNA che influenzano neurali biologia delle cellule staminali, differenziamento neuronale / integrazione funzionale, sviluppo di patologie neurali e tumori rimangono inesplorate. Il mantenimento di tali reti attraverso regni rende il potenziale dei sistemi genetici come Drosophila melanogaster strumentale per svelare vie cellulari inesplorati, in cui RNA non codificanti breve e fattori di trascrizione sono considerati come i principali attori molecolari. In questa prospettiva, la profilazione dei candidati piccoli livelli di espressione di RNA è propedeutico alle analisi funzionali precisi: un esempio viene dalla nostra recente dimostrazione che DMEL-miR279 modula la gcm / glide destino determinante in vivo, realizzato attraverso una versione migliorata del dosaggio del Nord Blotting come uno strumento per l'analisi di espressione.

51, NB è stato considerato come un metodo di riferimento per l'analisi di RNA. Nonostante alcune limitazioni intrinseche di questo test, come la difficile conversione al Multiplex errori di formato o possibili con segnale quantificazione, recenti scoperte nel campo della biologia molecolare dell'RNA hanno riscoperto questa tecnica convenzionale, come un sistema "rapido e pulito" per saggiare l'espressione endogena di piccola ribonucleico acidi o per validare l'efficacia di GAIN- o approcci perdita-di-funzione. Come esempio paradigmatico, analisi Northern pone alla base della scoperta originale di microRNA, considerando che l'approccio rimane in prima linea per la sua rilevanza nella caratterizzazione di sempre nuove proprietà di RNA regolatori 52.

La variante qui descritto è basato sulla sensibilità aumentata a causa di reticolazione chimica dell'RNA. Abbiamo believethe metodo è ancora poco impiegato in Drosophila, bUT quando sfruttata ha portato a importanti scoperte 52, dal momento che rende possibile profilo di espressione di RNA da campioni di piccole dimensioni (meno di 1 mcg), con una media di 10-30 volte il miglioramento di rilevamento di target RNA 41,43, come abbiamo ottenuto nelle nostre condizioni (Figure 2 e 3).

Integrità dell'RNA rappresenta una questione critica per ottenere risultati costanti e riproducibili. Manipolazioni RNA richiedono precisione e rapidità di limitare possibile degradazione del campione che si verificano tra l'estrazione e il caricamento. A questo proposito, tutte le soluzioni devono essere diethylpyrocarbonate- (DEPC) trattati prima dell'uso (2 ore di incubazione in presenza di 0,1% DEPC a 37 ° C e poi autoclavato) per eludere l'attività di RNasi. Soluzione di trattamento garantisce risultati migliori rispetto all'utilizzo di acqua DEPC come solvente. Tutte le attrezzature saranno ugualmente risciacquato in DEPC ddH20, dopo la pulizia da una superficie decontaminante specifica-RNasi.

(ad esempio, rasi4, Figura 2) o quando la purificazione dell'RNA non viene eseguita su campioni freschi (ad esempio, conservato in stoccaggio dei tessuti reagenti). Per esperienza, l'isolamento di RNA da campioni stabilizzati risultato significativamente più duro e richiede condizioni di estrazione più drastiche. In condizioni normali, il metodo basato-K proteinasi descritto garantisce preparazioni di buona qualità così, (un esempio significativo è rappresentato in Figura 1), ma non è la scelta ottimale per i campioni conservati nei reagenti di stoccaggio.

Infine, dal momento che questa procedura ha lo scopo di rilevamento di piccoli RNA specifico, i kit a base di purificazione colonne dedicato possono essere impiegati per l'isolamento diretto piccolo RNA, anche se thIS rende più difficile per verificare l'integrità dell'RNA. In alternativa alla procedura basata gel classico per il controllo dell'integrità dell'RNA sopra descritto, la qualità dell'RNA può essere valutato da strumenti per l'on-chip miniaturizzato analisi dei modelli di acidi nucleici.

Buffer Scelta: MOPS-NaOH tampone (pH 7) è stato proposto come un buffer preferenziale sia per elettroforesi su gel Nord avanzato e blotting. Abbiamo anche usato in modo soddisfacente Tris-borato-EDTA (TBE) del buffer nei nostri esperimenti. In questo caso, poiché la presenza di gruppi amminici nucleofili di Tris (idrossimetil) aminometano sarebbe idrolizzare e inattivare DEPC durante il trattamento stesso, si raccomanda Tris dissoluzione in acqua trattata con DEPC invece di trattare tampone TBE già preparato.

Elettroforetica Run e Blotting: Pre-esecuzione il gel è essenziale per rimuovere l'eccesso Persolfato ed eliminando hyperfocusing. Parametri pre-run dovrebbero essere mantenute anche nel corso di frazionamento, evitando electropho troppo velocerun Retic. Prima del caricamento, assicurarsi di rimuovere eventuali sedimenti urea da pozzi, spruzzando del buffer interno. Ciò limiterà campione di spill-over e le garanzie accurata stratificazione RNA, producendo bande autoradiografici risolti durante il rilevamento dei segnali. Qualsiasi membrana di nylon neutro può essere utilizzato come supporto per il trasferimento dell'acido nucleico. Non asciugare la RNA per più di 20-30 minuti alle condizioni specificate.

La reticolazione: reticolazione chimica a base di EDC rappresenta la prima critica metodologica di questa versione Northern blot migliorata. La possibilità di reticolazione specie breve RNA a superfici neutre dai confini covalenti tra il 5'mono-fosfato gruppo RNA e nylon ammine primarie lascia la maggior parte delle basi disponibili per l'ibridazione. Questo migliora la sensibilità 10-20xrespect a reticolazione tradizionale. E 'fondamentale preparare quantità fresca di soluzione di reticolazione per ogni blotting, in quantità sufficiente per la saturazione della membrana corretta.

Ibridazione e lavaggio: sonde devono essere preferibilmente freschi etichettati. Sonda attività specifica (dipendente dalla attività specifica e la quantità di nucleotidi incorporati radiomarcato e anche dalla quantità di sonda disponibili per l'ibridazione) determina la sensibilità di rilevamento del bersaglio. Quando [γ- 32 P] ATP viene utilizzato con una specifica attività di 3.000 Ci / mmol, è previsto 10 6 cpm / pmol per l'etichettatura del 100% del 5 'estremità.

La soluzione di ibridazione può essere recuperata e reimpiegata, considerando che, durante 32 P decadimento, metà attività sonda a circa 14 giorni.

A causa di neutralità membrana, a basso rumore di fondo è prevista su di ibridazione. Se sono necessarie condizioni di lavaggio più rigorose, ridurre progressivamente tampone di lavaggio forza ionica (fino a 0.2x SSPE) o aggiungere quantità crescenti di detergenti ionici (fino al 0,5% SDS) o aumentare la temperatura di lavaggio a 37 ° C.

Analisi Northern blot è essenziale quando è necessaria misura di formato RNA. Anche se questo test può mancare la precisione di approcci qPCR basato sulla fluorescenza per la stima di piccoli RNA, un vantaggio derivante dall'utilizzo di denaturazione frazionamento / blotting e ibridazione sonda-dipendente come passi unici prima rilevazione di RNA bersaglio. Di conseguenza, la rivelazione di segnali specifici del campione è diretto e non richiede alcuna ulteriore fase di trattamento enzimatico / conversione / amplificazione, che comporterebbe l'uso di kit commerciali dedicati. Livelli di RNA possono essere quantificati e confrontati tra più campioni su singole membrane. Così Northemacchia RN è comunemente impiegato come una convalida rigorosa per i dati qPCR. Spinto da esigenze sperimentali specifiche, il metodo è stato addirittura migliorato nel corso degli ultimi anni, sia a livello di sensibilità e risoluzione cosicché limitata quantità di RNA (vedi figure 2 e 3) sono necessari per l'analisi di successo.

Il protocollo abbiamo presentato può essere adattato ad una vasta gamma di applicazioni in particolare quando il materiale è disponibile in quantità limitate. La fonte biologica di campioni di RNA può essere eterogenea: per quanto Drosophila è interessato, embrioni o altre fasi di sviluppo sono adatte, ma anche sezionato manualmente tessuti o organi, cellule individuali di smistamento-isolato citotipi o colture cellulari.

Inoltre, anche se i microRNA sono la classe più abbondante di brevi RNA regolatori nella cella e principale oggetto di indagine nel campo del gene di controllo dell'espressione di RNA-mediata, che non constitute l'unica famiglia di RNA non codificanti cellulari. Molti grappoli di piccoli RNA funzionano attraverso regni (ad esempio, siRNA endogeni, piRNAs, snoRNAs, impianti tasiRNAs) e la maggior parte di essi sono caratterizzati da un libero 5 capolinea '(non modificato), in genere derivanti dalla lavorazione endo-ribonucleolytic precursori di molecole. Questa caratteristica costituisce il presupposto strutturale unico strettamente necessario per applicare la metodologia migliorata specifico basato su reticolazione chimica, anche se dimensioni RNA devono essere considerati come bene, quando RNA più lunghe sono analizzati. In figura 2 riportiamo una analisi Northern Blot relativamente rilevare i livelli di rasi4 54 un membro di una classe di piccoli RNA germinale-specifica linea (Piwi interagenti RNA o piRNAs.) In condizioni di livelli di espressione poveri e specifici, la maggiore sensibilità di questo metodo può sanzionare risultati di successo, soprattutto se si considera che il protocollo riportato può essere ulteriormente migliorata con pettineo ra zione con altre implementazioni pratiche già descritti in letteratura 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Questo lavoro è stato sostenuto dall'Institut National de la Santé et de la Recherche Médicale, il Centre National de la Recherche Scientifique, l'Université de Strasbourg, l'Hôpital de Strasbourg, l'Associazione pour la Recherche sur le Cancer, l'Institut National du Cancer, l'Agence Nationale de la Recherche e la regione dell'Alsazia.

Pietro Laneve è stata sostenuta dalla Fondation pour la Recherche Médicale. Attualmente, egli è destinatario di un Istituto Italiano Tecnologia (IIT) borsa di studio. Spese di pubblicazione sono supportati dalla rete Neurex (TriNeuron - Programma Interreg IV Alto Reno)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics