Verbesserte Northern Blot Detektion von kleinen RNA-Spezies in
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Das Ziel dieser Publikation ist es, sichtbar zu machen und zu diskutieren, die operativen Schritte einer Enhanced Northern Blot-Protokoll auf RNA aus Drosophila melanogaster Embryonen entnommen, Zellen und Geweben. Dieses Protokoll ist besonders nützlich für eine effiziente Erkennung von kleinen RNA-Spezies.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die letzten Jahrzehnte haben die Explosion der wissenschaftlichen Interesse rund um die Genexpression Kontrollmechanismen auf RNA-Ebene erlebt. Dieser Zweig der Molekularbiologie wurde stark durch die Entdeckung von nicht-kodierenden RNAs als Hauptakteure im post-Transkriptionsregulation angeheizt. Solch eine revolutionäre Perspektive wurde begleitet und durch die Entwicklung von leistungsfähigen Technologien für die Profilierung von kurzen RNAs Ausdruck ausgelöst, sowohl auf der Hochdurchsatz-Ebene (genomweiten Identifikation) oder als Single-Kandidat Analyse (steady state Anreicherung von spezifischen Arten). Obwohl mehrere state-of-art-Strategien derzeit zur Dosierung oder zu visualisieren, wie Flucht-Moleküle vorhanden sind, bleibt Northern Blot-Test die zuschussfähigen Ansatz in der Molekularbiologie für die sofortige und genaue Auswertung der RNA-Expression. Es ist ein erster Schritt in Richtung der Anwendung von anspruchsvoller, kostenintensive Technologien und in vielen Fällen bleibt eine bevorzugte Methode, um einfach Einblickein RNA Biologie. Hier Übersicht wir ein effizientes Protokoll (erweitert Northern Blot) zum Erfassen schwach exprimierte microRNAs (oder andere kleine regulatorische RNA-Spezies) von Drosophila melanogaster ganze Embryonen, manuell zerlegt Larven / adulten Geweben oder in vitro kultivierten Zellen. Eine sehr begrenzte Menge an RNA erforderlich ist, und die Verwendung von Material aus der Durchflusszytometrie isoliert Zellen können auch in Betracht gezogen.

Introduction

RNA Biochemie hat spektakuläre Fortschritte in den vergangenen Jahren erlebt 1. Unser Verständnis von RNA-Potenzial in der Steuerung der Genexpression durch die Identifizierung von nicht-kodierenden leistungsstarke Ribo-Regulatoren 2 gesprengt, durch die Entdeckung von neuartigen RNA-basierte Regulationsmechanismen 3,4 und durch eine tiefere Charakterisierung der bereits bekannten posttranskriptionale Veranstaltungen 5. Alle zusammen haben diese Studien erlaubt RNA Biologie drastisch machen die Szene, zu einem wichtigen Forschungsthema in der aktuellen Wissenschaftslandschaft. Insbesondere in den letzten Jahren sind wir immer ein Gefühl von der allgegenwärtigen Auswirkungen der "RNA-Welt" auf der molekularen Neurobiologie 6, eines der dynamischsten Forschungsbereiche in der modernen Lebenswissenschaften. Im letzten Jahrzehnt des vergangenen Jahrhunderts hat sich die wissenschaftliche Gesamtszenario durch die Entdeckung der RNA-Interferenz 7,8 und der kleine regulatorische RNAs 9,10 revolutioniertinsbesondere im Bereich der Mikro-RNAs 11, endogen exprimiert kleinen nicht-kodierenden RNAs in der Kontrolle fast aller zellulären Funktionen als pleiotrope und kombiRegulaToren der Genexpression beteiligt ist.

Fast 10 Jahre nach miRNA ersten Entdeckung in Caenorhabditis elegans durch Ambros und Ruvkun-Labors, wurde die Aufmerksamkeit erneut auf das Feld eingeschaltet, wenn eine hohe Zahl von miRNAs wurden in Drosophila und in menschlichen Zellen als auch 12-15 identifiziert. Seitdem dank vielseitiger transgene Ansätze, Drosophila melanogaster hat sich als wertvolle biologische Kontext für das Eintauchen in miRNA Biosynthese und Aktivität stand. Drosophila miRNAs haben unterschiedliche Funktionen in Insektenspezifische oder evolutionär konservierten Prozesse aufgedeckt, die sich vom Altern, den Stoffwechsel, Signalwege , Verhalten und, natürlich, die Neurogenese. Entlang dieser Richtung, die wir vor kurzem eine neuartige Verbindung 16 in die faszinierende Zusammenarbeitrrelation zwischen dem Master-Gen gcm / Gleiten und der RNA-Weg stattfindet. Die Fliege Transkriptionsfaktor Gcm / Glide 17-19 stellt ein einzigartiges Beispiel für das Schicksal der Zelle Determinante, die diktiert die Glia gegen neuronale Schicksal Wahl in multi fliegen neuronalen Vorläufer 20. Zwanzig Jahre lang Forschung zu diesem Thema hat deutlich unterstrichen, das Auftreten von mehreren überlappenden und Eingänge der Genregulation konvergierenden über GCM / gleiten 21-28, die zum Ausgleich der zarte Verhältnis zwischen neuronalen und Gliazellen während der Entwicklung des Nervensystems Kollegen erforderlich Schwellenwerte festzulegen.

Wir entdeckten, dass die Verordnung über DMEL-miR279 Targeting stellt eine weitere Steuerungsebene einen Beitrag zur posttranskriptionale Feinabstimmung der GCM / 16 gleiten Ausdruck. Weltweit haben diese Forschungslinien erforderliche spezifische methodische Verbesserungen: entlang Jahren mehrere Technologien, die ursprünglich entwickelt, um zu analysieren traditional RNAs wurden zur Quantifizierung der kleine nicht kodierende RNAs wurden wie umgewandelt, wie RNAse-Schutzassays, cDNA-Arrays 29-31, Echtzeit-PCR-Verfahren 32-35 und Sequenzierung 36,37. Auf der anderen Seite hat Rekalibrierung technische Ansätze kontinuierlichen Fortschritte auf dem Gebiet gefördert.

Northern Blot-Assay (NB, oder RNA-Gel-Blot-Test) stellt eine repräsentative Beispiel: Es wird weitgehend eingesetzt, um RNA-Akkumulation Profil, da sie gewährleistet, sowohl quantitative Expressionsniveau sowie Größenbestimmung. Allerdings ist die Eigen geringe Empfindlichkeit der Methode begrenzen, wenn es um den Nieder reichlich Genexpression Feinstimmer wie kurze RNAs angewendet werden kann, ist. Eine nachteilige Folge ist das Erfordernis großer Mengen an Gesamt-RNA, die nur schwer ihre Anwendung auf bestimmte biologische Proben ermöglicht. Aus solchen Gründen bestimmte NB Varianten für kleine RNAs Erkennung entwickelt worden 38-40: wir nutzten eine verbesserte NB procEDURE 41 (ENB, Enhanced Northern Blot), während die Aufklärung der oben genannten Wechselspiel zwischen DMEL-miR279 und GCM / gleiten.

Dieses Verfahren beruht auf einer chemischen Vernetzungsschritt auf der Basis der Aktivität eines Carbodiimid-Derivats [1-Ethyl-3-(3-dimethylaminopropyl) carbodiimid, EDC] die Nucleinsäure auf festen Trägern zu fixieren. Carbodiimid ist ein vielseitiges Vernetzer bekannt, die Bildung von Amidbindungen zwischen den aktivierten Carboxy oder Phosphat-und Amingruppen 42 katalysieren. Diese Eigenschaft kann durch die Mono-phosphorylierten 5'-Hydroxylgruppe kovalent paar kleine RNAs ausgenutzt werden, um Gruppen an der Oberfläche der Nylonmembranen Amino ist. Die resultierende Befestigung Konfiguration erhöht die Zugänglichkeit des immobilisierten Nukleinsäure und wiederum die Effizienz der Sonden-Target-Hybridisierung, die in bemerkenswerter Detektionsverstärkung 43 führt.

Die Technik übernimmt insbesondere relevance in Drosophila molekulare Studien, mit denen das Auftreten von neuen und unverwechselbaren Klassen von kleinen nicht-kodierenden RNAs 44 entsteht. Unter diesen rasiRNAs 45,46 bilden einen bestimmten Subtyp von Piwi-interacting RNAs (piRNAs 47), in sequenzspezifische Gen-Silencing beteiligt. Operative Details dieses Verfahrens werden im Folgenden vollständig beschrieben und visualisiert, bezogen auf die Analyse der miRNAs DMEL--miR279 und DMEL--miR286 und zum ersten Mal von einem rasiRNA, rasi4. Wir schoben, diese Methode, die es uns erlaubt enthüllt schlecht ausgedrückt Ziele von minimalen Mengen von RNA (weniger als 1 ug) Extreme.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Probenentnahme

  1. Lösen halbhaft Schneider 2-Zellen (1-5 × 10 6 Zellen im Durchschnitt), und durch Pipettieren geerntet sie durch Zentrifugation (100 × g für 1 min). Im Falle von in vitro kultivierten adhärenten Zellen, trypsinize sie unter Standardbedingungen oder direkt sammeln sie von den Platten in eine geeignete Menge an RNA-Extraktionsreagenz, mit Hilfe eines Zellschabers.
  2. Für Embryo-Entnahme, wachsen Drosophila-Stämmen in Flugkäfigen und lassen Embryonen sammeln sich auf Legeplatten. Wischen Embryonen durch einen Pinsel in destilliertem Wasser (dH 2 O), entsorgen Trümmer durch Sieb-Filterung, spülen und erholen Embryonen in einer Ampulle 48.
  3. Als alternative Technik, manuell zu sezieren Gewebe / Organe. Isolieren Hoden (ein Präferenzsystem für piRNA Analyse) von Drosophila Leib in phosphatgepufferter Salzlösung (PBS) unter einem Stereomikroskop (Vergrßerung 20X) unter Verwendung von Nadeln oder Dissektion Zange gegenin Sullivan et al 49 ualized.
  4. Stößel homogenisieren Proben auf der Sucht nach 0,5 Volumen RNA-Extraktion Reagenz.

2. RNA-Extraktion / Analyse

  1. Den Anweisungen des Herstellers durchführen RNA-Isolierung durch kommerzielle Reagenzien. VORSICHT! RNA Extraktionsmittel sind in der Regel toxisch und ätzend. Alternativ Anwendung einer Proteinase K-basiertes Protokoll für die RNA-Isolierung 50, wie folgt:
    1. Verdünnen Sie die Proben in 400 ul Stop-Mix und Inkubation bei RT für 15 min.
    2. Recover wasserlöslichen Komponenten durch Standard Phenol: Chloroform: Isoamylalkohol und Chloroform-Extraktionen und Ethanol (EtOH) Fällung / Waschen. Luft trocknen die Proben und resuspendieren in Diethylpyrocarbonat (DEPC) behandelten doppelt destilliertem (dd) H 2 O.
  2. Beurteilen RNA-Konzentration durch UV-photometrische Messung. Auch dafür sorgen, das RNA-Reinheit hoch, in der Nähe von 2.0 ist, based auf der A 260 / A 280 Lesung.
  3. Überprüfen RNA-Präparation auf denaturierenden Agarose-Gel wie folgt:
    1. In einen sauberen Becher löst man 1,2 g Agarose in 82 ml DEPC-ddH 2 O, unter kontinuierlichem Rühren. Kochen, bis vollständig gelöst ist.
    2. Lassen Sie das Gel Lösung abkühlen; wenn die Temperatur 60 ° C erreicht 10 ml 10X 4-Morpholinpropansulfonsäure hinzufügen (MOPS) Puffer auf 1X Endkonzentration (FC) und 8 ml 37% Formaldehyd zu 3% FC. VORSICHT! Formaldehyd ist krebserregend.
    3. Gießen Sie das Gel in eine horizontale Elektrophorese-Zelle. Lassen Sie das Gel unter einer Haube für mindestens 1 Stunde fest werden. Nach der Erstarrung, tauchen das Gel in MOPS 1X.
    4. Aliquoten 2 ug RNA-Probe und 1 ug Ladder (verwenden Sie ein RNA-Marker, wenn genaue Auswertung gewünscht wird). Hinzufügen 3 Volumen Agarose-Ladefarbstoff (ALD), um RNA und Leiter. Wärme bei 70 ° C für 5 min und sofort auf Eis kühlen. CAUTION! Inhalt der ALD (Ethidiumbromid und Formamid, siehe Materialien) sind mutagen und korrosiven sind.
    5. Legen Sie die Proben und führen Sie das Gel bei 50 V für ca. 1 h mit gelegentlichen Puffer Recycling. Überprüfen Sie die RNA durch UV-Fraktionierung Muster Visualisierung oder Gel Imaging. Erkennen diskrete Banden, die 28S-und 18S-rRNAs und tRNAs (siehe Abbildung 1).
  4. Gehen Sie nach Nord Assay oder speichern RNA bei -80 ° C.

3. Denaturierung Acrylamid-Gel Vorbereitung

  1. Verwenden Sie eine kleine vertikale Elektrophorese-Apparat für diese Fraktionierung Schritt (Plattengröße ca. 8 cm x 9 cm, Kamm Dicke 0,75 mm).
  2. Montieren Sie saubere Gläser zusammen in einem Gussrahmen.
  3. Herstellung von 10 ml 10% Acrylamid / Bis-Acrylamid (19: 1)-Lösung in MOPS-1X, 7 M Harnstoff. Unmittelbar vor dem Gießen werden 100 ul 10% Ammoniumpersulfat und 10 ul TEMED und schnell mischen Sie die Lösung. VORSICHT! Acrylamid ist neurotoxischen und krebserregend.
  4. Gießen Sie das Gel zwischen Glasplatten und legen Sie die gut Kamm vorsichtig, um Blasen zu vermeiden. Lassen Sie das Gel polymerisiert bei Raumtemperatur mindestens 45 min vor der Verwendung. Alternativ speichern Sie das Gel O / N, in Wasser getränkten Filterpapiere eingewickelt und in Frischhaltefolie versiegelt.

4. Probenvorbereitung

  1. Aliquot 0,5-20 ug Gesamt-RNA pro Probe. Wenn Volumen 3-4 ul überschreitet, Vakuum trocknen die Probe.
  2. Für Größenbestimmung, führen Sie einen aliquoten (20-30 cps) von radioaktiv markiertem Low-Range-Leiter parallel zu Proben, als Marker (siehe Abschnitt 4.3 und 4.4 für Vorbereitung). Behandeln Sie es parallel zu Proben, wie in Schritt 4.5 beschrieben.
  3. Ladder: eine Phosphatvorwärtsreaktion unter Verwendung von 0,1 ug eines 10 bp-Schritt-Leiter eingestellt. Bei 37 ° C für 30 Minuten und stoppt die Reaktion durch Zugabe von Ethylendiamintetraessigsäure (EDTA) und 20 mM FC.
  4. Reinige durch EtOH Fällung / Waschen, trocknen undresuspendieren in ddH 2 O (etwa 100 ul). VORSICHT! 32 P ist eine radioaktive Quelle.
  5. Zu jeder Probe das gleiche Volumen von Acrylamid blauen Farbstoff (ABD). Denaturieren durch Erhitzen bei 80 ° C für 5 min auf Eis und kühlen, bis Belastung. VORSICHT! Formamid (Gehalt in ABD) ist ätzend.

5. Die elektrophoretische Fraktionierung

  1. Entfernen Sie die Glasplatten aus der Casting-Unterstützung und richtig montieren sie in der Elektrophorese-Zelle. Füllen inneren und äußeren Kammer mit ausreichender Laufpuffer (RB).
  2. Entfernen Sie vorsichtig den Kamm und Vorlauf das Gel bei 200 V für 10 min. Vor dem Laden der Proben, abzuwaschen Harnstoffablagerungen aus den Vertiefungen durch Spritzen einige RB durch eine Spritze.
  3. Verwenden Sie flache Spitzen sorgfältig stratify Proben aus Schritt 4.5 an der Unterseite von jedem gut. Überprüfen Anode und Kathode Verbindungen zu umgekehrten Lauf zu vermeiden. Nachdem die Proben in das Gel bei 100 V für 5 min, il zu erhöhen, um die Spannung 200 V.
  4. Für eine Fraktionierung Länge von etwa 7 cm, einer 45 min-Dauer ausreichend. Vermeiden Bromphenolblau (a Tracking Pigment in ABD), um das Gel überlaufen.
  5. Visualisieren auf-Gel-der fraktionierten lange RNAs durch Ethidiumbromid (EtBr)-Färbung, als optionaler Schritt:
    1. Schneiden Sie 2 cm von der Spitze des Gels und die Scheibe in ddH 2 O. kurz spülen
    2. Inkubieren Sie die Gel-Scheibe bei RT für 15 min unter leichtem shacking in RB, EtBr 0,5 ug / ml FC.
    3. Entfärben des Gels für 15 min in RB, visualisieren lange rRNAs durch UV-Bestrahlung oder Gel-Bildgebung. Überprüfen Sie für die RNA-Beladung und Qualität (siehe Abbildung 1, Tafel 7). VORSICHT! Ethidiumbromid ist mutagen.
  6. Unterdessen gehen Lösch den unteren Teil des Gels, die kleine RNA-Spezies.

6. Gel-Blotting

  1. Schneiden Sie 6 Stück Löschpapier, um die Blotting Bereich passen und eine äquivalente Stück uncharged Nylon-Membran. Dämpfen Papierbögen, Membran und 2 Schreibunterlagen in RB. Stellen Sie sicher, dass Sie die Pads vollständig genießen, indem Sie wiederholt drückte sie in RB.
  2. Entfernen Sie das Gel aus dem Gerät, und öffnen Sie die Gläser durch Mittel einer Spachtel. Verwenden Sie ein sauberes Schneider, um die Vertiefungen zu entfernen. Legen Sie ein Blatt feuchten Whatman-Papier auf dem Gel und heben es auf.
  3. Das Nylonmembran auf die freie Fläche des Gels. Markieren eine Ecke, um die Filter nach Probenbeladung zu orientieren. Füllen Sie das "Sandwich" (3 Papierstücke auf jeder Seite). Wirf einen Kunststoffstab auf dem Blot Oberfläche, um mögliche Luftblasen zu entfernen.
  4. Legen Sie den Fleck zwischen zwei Schreibunterlagen und dann in der Blotting-Kassette. Bauen Sie die Kassette in den Löschmodul, füllen die Kammer mit RB und kontrollieren die korrekte Ausrichtung (Nylonmembran muss zwischen dem Gel und der positive Terminus zu bleiben).
  5. Transfer bei 20 V für 20 min. Hinweis: Um homogenen Bedingungen zu gewährleisten, nach 10 Minuten öffnen Sie das Löschmodul und rOtate das Sandwich um 180 ° vor dem Abschluss der Übertragung.

7. Membran Vernetzung

  1. Bereiten Sie 6 ml frischem Vernetzungslösung (XLS). Tränken Sie ein 10 cm x 10 cm (größer als Nylonmembran) Stück Löschpapier mit XLS. VORSICHT! HCl (eine Komponente von XLS) ist stark ätzend.
  2. Blot die Demontage und legen Sie die Membran auf dem nassen 3MM Filterpapier. Hinweis: RNA muss nicht in direktem Kontakt mit der gesättigten Papier. Setzen Sie den Filter und Papier zwischen zwei Glasplatten und wickeln in Saran-Wrap.
  3. Erwärmen die Membran bei 60 ° C für 2 Stunden, gefolgt von einer ddH 2 O Waschen. Lagerung bei -20 ° C oder fahren Sie mit der Hybridisierung.

8. Membran Prähybridisierung

  1. Wenn RNA-Beladung überprüft wurde (optionaler Schritt 5.5), direkt an der Hybridisierung fortfahren. Oder aber, schneiden Sie 1 cm vom Anfang des Nylon-Filter, um die Sondenquer hybridizatio vermeidenns bis fraktionierten lange RNAs.
  2. Vorwärmkammer 10 ml Hybridisierungslösung (HS) bei 37 ° C aufweist. Denaturieren 1 mg Lachssperma bei 95 ° C für 5 min, cool auf Eis und in den HS.
  3. Den Filter in HS Inkubation bei 37 ° C für mindestens 1 h unter Rotation in einem Hybridisierungsofen. Überprüfen Sie, dass die RNA-Seite der Filterflächen HS.

9. Sondensynthese

  1. Ein Phosphat Vorwärtsreaktion eingestellt auf 10 pmol spezifischer Antisense-Oligonukleotid, wie in 4.3 beschrieben.
  2. Mit 5 Volumina von Tris-EDTA-NaCl (TEN)-Puffer, um die Reaktion und Reinigung des markierten Primers von nicht eingebauten Nukleotiden durch Gel-Ausschluß-Chromatographie auf G-25 Sephadex-Säulen (oder auch von EtOH-Fällung). Sonde Aktivität kann durch Flüssig-Szintillationszählers beurteilt.

10. Membran Hybridisierung

  1. Ersetzen Sie die HS mit einem frischen 10 ml Aliquot (vorbereitet und ergänzt, wie oben beschrieben). Erhitzen Sie die Sonde an95 ° C für 10 min, cool auf Eis und in den neuen HS. Inkubieren des Filters bei 37 ° C auf.

11. Waschen der Membran

  1. Wiederherstellen der Hybridisierungslösung und bei -20 ° C in einer Radioaktivität-Abschirmung-Box.
  2. Spülen Sie die Filter in Waschpuffer (WB) und waschen Sie es gründlich für 10 min bei RT.
  3. Verwenden Sie ein Geiger Mueller-Detektor zur Überprüfung Restradioaktivität an den Filter Ecken. Wenn Hintergrundemission ist etwa 5 cps, fahren Sie mit Membranexposition.

12. Signalerkennung

  1. Setzen Sie den Filter auf Autoradiographie-Filme oder auf einem Molecular Imager-Bildschirm auf. Zeigen Signale, die von der fotografischen Verarbeitung oder Digital-Wandlung.
  2. Analysieren Sie die Bandenintensität von engagierten Quantifizierungssoftware (ImageJ oder Optiquant).

13. Membran Stripping

  1. Um Primärsignale in 500 ml kochendes entkleiden Lösung zu entfernen, tauchen die Membran, Dann bei RT inkubieren für 1 min. Fahren Sie mit Roman (vor)-Hybridisierung oder den Filter bei -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Durch Befolgen der im Text beschrieben und schematisch in Abbildung 1 dargestellt Gesamtverfahren, untersuchten wir die Expression von RNAs kleine RNA-Komplex Proben unterschiedlicher Herkunft. In dem Experiment in Abbildung 1 dargestellt, wurde RNA aus Drosophila Schneider 2-Zellen durch Proteinase K-Extraktion, Integrität überprüft isoliert (optionaler Schritt: Denaturierung Agarose-Gel-Fraktionierung) und im Doppel geladen. Eine Hälfte des Gels wurde auf eine neutrale Membran geblottet und chemisch vernetzt durch EDC; Die zweite Hälfte wurde auf eine positiv geladene Nylonfilter übertragen und dann UV-vernetzt (1,2 x 10 5 uJ / cm 2). Die endogene Expression von zwei microRNAs an die Familie DMEL-miR279 gehört (DMEL-miR279 selbst und DMEL-miR286 15) wurde in beiden Bedingungen überprüft. Das verbesserte Verfahren (ENB) sorgt für höhere Empfindlichkeit gegenüber der Standard (SNB).

den Figuren 2 und 3 markiert. Die experimentelle Grundprinzip ist das gleiche wie oben: Hier berichten wir über die repräsentative Ergebnis der Northern-Blot-autoradiographische Nachweis der piRNA rasi4 entlang einer Titration des Gesamt-RNA extrahiert aus adulten Fliegen Hoden. ENB bereits ermöglicht Nachweis einer spezifischen Bande bei 0,5 ug RNA wird geladen. Die Quantifizierung zeigt beiseite, wie das Signal proportional mit der Menge der fraktionierten RNA, was darauf hinweist, daß die Dosis / Wirkungs-Verhältnis liegt im linearen Bereich der Nachweisgrenze. Unterhalb der Platte ratifiziert die verbesserte Sensitivität dieser Methode im Vergleich zu SNB. In diesem Fall wird ein nachweisbares Signal nach elektrophoretischer Auftrennung von 10 ug RNA zumindest für die SNB erhalten.

Ähnliche Ergebnisse werden mit einem anderen nicht-kodierenden RNA-Spezies, beispielsweise erhalten, 5S rRNA, wie in Abbildung 3 <berichtet/ Strong>.

Figur 1
Abbildung 1. Schematische Darstellung des Gesamt Northern Blot Verfahren. Hauptverfahrensschritte aufgelistet sind und nach und nach durchnummeriert. Die Ergebnisse werden zwischen dem erweiterten Northern Blot (ENB) und Standard Northern Blot (SNB), in gleichen Bedingungen verglichen: RNA-Isolierung aus Drosophila Schneider 2-Zellen (Panel 1), Elektrophorese (Panel 2), Transfer (Panel 3) und Hybridisierung ( Panel 5). ENB bezieht sich auf die in diesem Bericht, die ein Neutralfilter (Panel 3, linke Hälfte der Membran) und EDC-basierte Vernetzung (Panel 4) erfordert beschriebenen verbesserten Verfahren, die eine kovalente Bindung zwischen Ziel-RNA-5'-Ende und Membran (legt rosa Punkte in Panel 4). In SNB wird RNA Vernetzung durch UV-Behandlung (Tafel 4) auf eine positiv geladene NYLO erhaltenn-Membran (Panel 3, rechte Hälfte der Membran). 5s-RNA spezifische Signal ist nicht ein Kalibrator in Vergleichsbedingungen, denn es reagiert auch auf Unterschiede zwischen SNB und ENB Verfahren. So ein Betrag (entspricht 10 cps) eines 5'-markierten (siehe Punkte 4.3 und 4.4 des Protokolls), 50 nt lang Rührei Oligonukleotid wurde vor der Elektrophorese zu jeder Probe gegeben, als "Spitze in" Referenzfunktion ( Panel 7). Belastung kann auch durch auf-Gel-EtBr-Färbung der lang rRNAs (siehe Punkt 5.5 des Protokolls) bewertet werden. L = Leiter. FV = Frontal-Ansicht, LV = Seitenansicht, HV = Horizontalansicht. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Compartive Northern Blot Analyse von rasi4 Ausdruck. endogenen Konzentrationen der Hoden-spezifische piRNA rasi4 werden durch verbesserte (ENB) oder Standard (SNB) Northern Blot zeigte, auf steigende Mengen von Gesamt-RNA (über jeder Spur angegeben) aus adulten Drosophila Hoden extrahiert durchgeführt oder von ganzen Unterleib (ABD). Für jede Methode, Histogramme beiseite berichten die relativen Mengen von rasi4 bezüglich der gleichen Menge einer "Spitze in" Ladekontrolle. Quantifizierungen von den beiden Methoden sind in der Grafik unten schlüssig Gele gelegt kombiniert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. Vergleichende Northern Blot Analyse von 5s rRNA-Expression. Als positive Kontrolle und experimentelle Kalibrierung wurde vorherigen Analyse zu 5S-rRNA erweitert. Details wie in Abbildung 2. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Obwohl unsere Wertschätzung der Feingeist, durch die Verflechtung RNA reguliert die Neurogenese steigt kontinuierlich, die mechanistische Auswirkungen der RNA-basierten Schaltungen beeinflussen neuronalen Stammzellbiologie, die neuronale Differenzierung / Funktionsintegration, Entwicklung von neuronalen Erkrankungen und Krebserkrankungen bleiben unerforscht. Die Pflege solcher Netzwerke durch Reiche macht das Potenzial der genetischen Systemen wie Drosophila melanogaster Instrumental in unerforschte zelluläre Signalwege, in der nicht-kodierenden RNAs kurzen und Transkriptionsfaktoren sind als wichtige molekulare Spieler angesehen entwirren. In dieser Ansicht ist die Profilierung der Kandidaten kleinen RNA-Expressionsniveaus Propädeutik, um genaue Funktionsanalysen: ein Beispiel aus unserer letzten Demonstration, die DMEL-miR279 moduliert die GCM / glide Schicksal Determinante in vivo, durch eine verbesserte Version der Northern Blot-Test, wie erreicht ein Tool für die Expressionsanalyse.

51, hat NB als Referenzmethode für die RNA-Analyse betrachtet. Trotz einiger immanente Grenzen dieses Tests, wie die schwierige Umstellung auf Format oder mögliche Fehler mit Signal Quantifizierung multiplexen, haben die jüngsten Durchbrüche in der RNA-Molekularbiologie dieser herkömmlichen Technik als "schnell und sauber"-System zum Testen endogene Expression von kleinen Ribonukleinsäuren wiederentdeckt Säuren oder zur Überprüfung der Wirksamkeit der GAIN oder Loss-of-function Ansätze. Als paradigmatische Beispiel legt Northern-Analyse auf der Grundlage der ursprünglichen Entdeckung von microRNAs, während der Ansatz bleibt an der Spitze für ihre Bedeutung bei der Charakterisierung von immer neuen Eigenschaften von regulatorischen RNAs 52.

Die hier beschriebene Variante ist auf erhöhte Empfindlichkeit durch chemische Vernetzung von RNA basieren. Wir believethe Methode ist immer noch schlecht in Drosophila eingesetzt, but wenn ausgenutzt zu signifikanten Entdeckungen 52, da es ermöglicht Profilierung RNA-Expression von kleinen Proben (weniger als 1 ug) mit einer durchschnittlichen 10-30 fache Verbesserung der RNA-Zielerfassungs 41,43, wie in unserem Bedingungen (Figuren 2 und 3).

RNA-Integrität stellt eine kritische Frage, um konsistente und reproduzierbare Ergebnisse zu erhalten. RNA Manipulationen erfordern Genauigkeit und Schnelligkeit, um mögliche Probenabbau zwischen Extraktion und der Belastung zu begrenzen. An diesem Zweck müssen alle Lösungen diethylpyrocarbonate- sein (DEPC) behandelt, vor der Verwendung (2 h Inkubation in Gegenwart von 0,1% DEPC bei 37 ° C und dann im Autoklaven behandelt), um die RNase-Aktivität zu umgehen. Lösung Behandlung garantiert bessere Ergebnisse in Bezug auf mit DEPC-Wasser als Lösungsmittel. Alle Geräte werden zu gleichen Teilen in DEPC ddH20 gespült werden, nach der Reinigung durch eine RNase-Dekontaminations spezifische Oberfläche.

(zB rasi4, Abbildung 2) oder wenn die RNA-Reinigung ist nicht auf frische Proben durchgeführt (zum Beispiel in das Gewebe der Speicherung erhalten Reagenzien). Aus Erfahrung, RNA-Isolierung aus stabilisierten Proben ergab deutlich härter und erforderlich drastischere Extraktionsbedingungen. Unter Standardbedingungen garantiert der beschriebenen Proteinase K-basierte Verfahren mit guter Qualität Präparate als gut, (ein wichtiges Beispiel ist in Abbildung 1 dargestellt), aber es ist nicht die optimale Wahl für die Proben bei der Lagerung Reagenzien erhalten.

Schließlich, da diese Vorgehensweise zielt darauf ab, geringe RNA-spezifischen Nachweis, gewidmet Säulenreinigung basierenden Kits zur direkten kleine RNA-Isolierung verwendet werden, obwohl thist, macht härter, RNA-Integrität überprüfen. Alternativ zu den klassischen Gel-basiertes Verfahren zur oben beschriebenen RNA-Integritätskontrolle kann RNA Qualität von Instrumenten für On-Chip miniaturisierten Analyse von Nukleinsäuremuster ausgewertet werden.

Puffer Wahl: MOPS-NaOH-Puffer (pH 7) wurde als bevorzugte Puffer für sowohl erweiterter Northern-Gel-Elektrophorese und Blotting vorgeschlagen. Wir zufriedenstellend verwendet auch Tris-Borat-EDTA (TBE)-Puffer in unseren Experimenten. In diesem Fall, da die Gegenwart von nucleophilen Amingruppen von Tris (hydroxymethyl) aminomethan würde hydrolysieren und zu inaktivieren DEPC während der Behandlung selbst, ist es empfehlenswert, Tris Auflösen in DEPC-behandeltem Wasser anstelle der Behandlung TBE-Puffer bereits vorbereitet.

Elektrophoretische Run und Blot: Pre-Lauf des Gels ist für die Beseitigung von überschüssigen Persulfat und Beseitigung hyperfocusing. Vorlauf-Parameter sollten bei der Fraktionierung auch beibehalten werden, die Vermeidung zu schnell electrophoretic Lauf. Vor dem Laden, stellen Sie sicher, um mögliche Urea Sedimenten aus Brunnen zu entfernen, durch Spritzen Puffer innen. Dies wird Probe Spill-over und gewährleistet eine exakte Schichtung RNA zu begrenzen, Herstellung gelöst autoradiographische Bands während Signale Erkennung. Jede neutrale Nylonmembran kann als Träger für Nukleinsäure-Übertragung verwendet werden. Die RNA für mehr als 20-30 min tupfen nicht an den angegebenen Bedingungen.

Vernetzung: EDC-basierte chemische Vernetzung stellt den kritischen methodischen Fortschritt dieses erweiterten Northern Blot-Version. Die Möglichkeit, kurze RNA-Spezies in Neutral Oberflächen durch kovalente Bindungen zwischen der RNA 5'mono-Phosphatgruppe und Nylon primären Aminen zu vernetzen lässt den Großteil der Basen für die Hybridisierung verfügbar. Dies verbessert die Empfindlichkeit durch 10-20xrespect zu herkömmlichen Vernetzung. Es ist wichtig, an die frische Menge der Vernetzungslösung für jede Blotting vorzubereiten, in ausreichender Menge für die richtige Membran Sättigung.

Hybridisierung und Waschen: Die Sonden sollten vorzugsweise frisch gekennzeichnet werden. Sonde spezifische Aktivität (abhängig von der spezifischen Aktivität und der Menge an eingebautem Nukleotid radioaktiv markiert und auch von der Menge der Sonde für die Hybridisierung verfügbar) wird die Empfindlichkeit der Zielerfassung. Wenn [γ- 32 P] ATP mit einer spezifischen Aktivität von 3000 Ci / mmol verwendet wird, 10 6 cpm / pmol 100% Markierung des 5'-Enden wird erwartet.

Die Hybridisierungslösung kann zurückgewonnen und wiederverwendet, wenn man bedenkt, daß durch 32 P Zerfall Sonde Aktivität Hälften in etwa 14 Tagen.

Aufgrund Membran Neutralität wird geringem Hintergrundrauschen bei der Hybridisierung erwartet. Wenn mehr stringenten Waschbedingungen erforderlich sind, progressiv Waschpuffer Ionenstärke zu reduzieren (bis zu 0,2 × SSPE) oder fügen steigenden Mengen an ionischen Detergentien (bis zu 0,5% SDS) und auf 37 ° C Waschtemperatur zu erhöhen.

Northern Blot-Analyse ist wichtig, wenn die RNA-Größenmessung erforderlich ist. Obwohl dieser Assay kann die Genauigkeit der Fluoreszenzbasis qPCR nähert sich für die Abschätzung der kleinen RNAs fehlt, leitet ein Vorteil aus der Verwendung denaturierender Fraktionierung / Blotting und Hybridisierungssonde abhängigen einzigartig Schritte vor dem Nachweis von Ziel-RNAs. Folglich ist die Offenbarung von spezifischen Signalen aus der Probe direkt und keinen zusätzlichen Schritt der enzymatischen Behandlung / Umwandlung / Verstärkung, die die Verwendung von speziellen kommerziellen Kits bedeuten würde erfordern. RNA-Spiegel kann quantifiziert und zwischen mehreren Proben auf einzelne Membranen werden. So Northern-Blot ist allgemein als einer stringenten Validierung für qPCR-Daten beschäftigt. Durch spezielle experimentelle Anforderungen Beflügelt wurde das Verfahren auch in den letzten Jahren verbessert hat, sowohl auf der Ebene der Empfindlichkeit und Auflösung, so dass begrenzte Menge an RNAs (siehe Abbildungen 2 und 3) sind für eine erfolgreiche Analyse.

Das Protokoll stellten wir können auf eine Vielzahl von Anwendungen, insbesondere wenn Material in begrenzten Mengen angepaßt werden. Die biologische Quelle der RNA-Proben können heterogen sein: so weit wie Drosophila betrifft, sind Embryonen oder anderen Entwicklungsstufen geeignet, aber auch manuell zerlegt Geweben oder Organen, einzelnen Zellen Sortier isoliert Zytotypen oder Zellkulturen.

Darüber hinaus, auch wenn microRNAs sind die häufigsten Klasse von kurzen regulatorische RNAs in der Zelle und Hauptuntersuchungsgegenstand auf dem Gebiet der RNA-vermittelten Genexpression Kontrolle, nicht Nachteile haben sietitut die einzige Familie, die nicht-kodierenden RNAs der Zell. Viele Cluster von kleinen RNAs Funktion über Reichen (zB endogene siRNAs piRNAs, snoRNAs Anlagen tasiRNAs) und die meisten von ihnen sind von einem freien 5'-Terminus (unmodifiziert), dadurch gekennzeichnet, allgemein, die aus der Endo-ribonucleolytische Verarbeitung von Vorläufer-Molekülen. Diese Funktion stellt die einzigartige strukturelle Voraussetzung für die Anwendung der spezifischen verbesserte Methodik, die auf chemische Vernetzung unbedingt erforderlich, auch wenn RNA-Größen müssen auch berücksichtigt werden, wenn mehr RNAs analysiert. In Abbildung 2 Wir berichten über einen Northern Blot Analyse vergleichsweise Erfassen der Ebenen der rasi4 54 ein Mitglied einer Klasse von Keimbahn-spezifische kleine RNAs (Piwi-interagierenden RNA oder piRNAs.) Bei schlechten und spezifische Expressionsniveaus, die eine erhöhte Empfindlichkeit dieser Methode können erfolgreiche Ergebnisse zu sanktionieren, zumal die berichtet Protokoll kann durch Kamm verbessert werdenfungs es mit anderen, bereits in der Literatur beschrieben 55,56 praktischen Implementierungen.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Diese Arbeit wurde vom Institut National de la Santé et de la Recherche Médicale unterstützt, das Centre National de la Recherche Scientifique, die Université de Strasbourg, das Hôpital de Strasbourg, der Verband pour la Recherche sur le Cancer, dem Institut National du Cancer, der Agence Nationale de la Recherche und dem Elsass.

Pietro Laneve wurde von der Fondation la Recherche Médicale unterstützt gießen. Derzeit ist er ein Empfänger einer Istituto Italiano Tecnologia (IIT) Gemeinschaft. Publikationskosten werden von der Neurex Netzwerk unterstützt (TriNeuron - Programm Interreg IV Oberrhein)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics