Verbeterde Northern Blot detectie van kleine RNA Species in
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Het doel van deze publicatie is om te visualiseren en te discussiëren over de operatieve stappen van een Enhanced Northern Blot protocol op RNA geëxtraheerd uit Drosophila melanogaster embryo's, cellen en weefsels. Dit protocol is bijzonder bruikbaar voor de efficiënte detectie van kleine RNA species.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De laatste decennia hebben de explosie van wetenschappelijke belangstelling rond genexpressie controlemechanismen op het RNA-niveau meegemaakt. Deze tak van de moleculaire biologie is sterk aangewakkerd door de ontdekking van niet-coderende RNA's als belangrijke spelers in het post-transcriptionele regulatie. Zo'n revolutionair perspectief is gepaard gegaan en veroorzaakt door de ontwikkeling van krachtige technologieën voor het profileren van korte RNA expressie, zowel op de high-throughput niveau (genoom-brede identificatie) of als single-kandidaat-analyse (steady state accumulatie van specifieke soorten). Hoewel verschillende state-of-art strategieën zijn momenteel beschikbaar voor het doseren of het visualiseren van een dergelijke vlucht voor moleculen, Northern Blot test blijft de in aanmerking komende aanpak in de moleculaire biologie voor de onmiddellijke en nauwkeurige evaluatie van RNA-expressie. Het is een eerste stap naar de toepassing van meer geavanceerde, dure technologieën en in veel gevallen blijft preferentiële werkwijze gemakkelijk inzichtenin RNA biologie. Hier het overzicht hebben we een efficiënt protocol (Enhanced Northern Blot) voor het detecteren zwak uitgedrukt microRNAs (of andere kleine regulerende RNA-soorten) van Drosophila melanogaster hele embryo's, handmatig ontleed larvale / volwassen weefsels of in vitro gekweekte cellen. Een zeer beperkte hoeveelheid RNA is vereist en het gebruik van materiaal van flowcytometrie-geïsoleerde cellen kunnen ook overwogen.

Introduction

RNA biochemie heeft spectaculaire vooruitgang ervaren in de afgelopen jaren 1. Ons begrip van RNA potentieel in de controle van genexpressie werd barsten van het identificatienummer van krachtige noncoding ribo-regulatoren 2, door de ontdekking van nieuwe RNA gebaseerde regulerende mechanismen 3,4 en een diepere karakterisering van reeds bekende post-transcriptionele gebeurtenissen 5. Alles bij elkaar deze studies hebben toegestaan ​​RNA biologie drastisch maken de scène, steeds in de huidige wetenschappelijke landschap een belangrijk onderwerp van onderzoek. Met name de laatste jaren krijgen we een gevoel van de doordringende invloed van de 'RNA-wereld "op moleculaire neurobiologie 6, een van de meest dynamische onderzoeksgebieden in de moderne life science. In het laatste decennium van de vorige eeuw, heeft de algemene wetenschappelijke scenario is een revolutie door de ontdekking van de RNA-interferentie 7,8 en van de kleine regulerende RNA's 9,10met bijzondere aandacht voor microRNAs 11, endogeen tot expressie kleine niet-coderende RNA's betrokken bij de controle van bijna alle cellulaire functies als pleiotropische en combinatorische regulatoren van genexpressie.

Bijna 10 jaar na miRNA eerste ontdekking in Caenorhabditis elegans door Ambros en Ruvkun's laboratoria, werd hernieuwd aandacht gericht op het veld bij hoge aantallen van miRNAs werden geïdentificeerd in Drosophila en in menselijke cellen en 12-15. Sindsdien, dankzij de veelzijdige transgene benaderingen, Drosophila melanogaster heeft opviel als een waardevolle biologische context te verdiepen in miRNA biosynthese en activiteit. Drosophila miRNAs hebben verschillende functies onthuld in insect-specifieke of evolutionair geconserveerd processen, variërend van veroudering om de stofwisseling, signaalwegen , gedrag en natuurlijk, neurogenese. Langs deze richting, hebben we onlangs een nieuwe koppeling 16 in de intrigerende co onthuldrrelation optreden tussen de master-gen GCM / glijden en de RNA-pad. De fly transcriptiefactor Gcm / Glide 17-19 vormt een uniek voorbeeld van lot van de cel determinant, die dicteert de gliale versus neuronale lot keuze in multipotente vliegen neurale voorlopers 20. Twintig jaar lang onderzoek naar dit onderwerp is duidelijk onderstreept het optreden van meerdere en overlappende ingangen van genexpressie regulatie convergerende dan GCM / glijden 21-28 aan de drempelwaarden die nodig zijn voor het balanceren van de delicate verhouding tussen neuronale en gliale tegenhangers tijdens neurale ontwikkeling vast te stellen.

We ontdekten dat regulering via DMEL-miR279 targeting is een verdere controle niveau bij te dragen tot post-transcriptionele fine-tuning van GCM / glijden meningsuiting 16. Wereldwijd zijn deze onderzoekslijnen vereist specifieke methodologische verbeteringen: langs jaren hebben verschillende technologieën oorspronkelijk ontwikkeld om trad analyserennele RNA's zijn omgebouwd voor het kwantificeren van kleine niet-coderende RNA's, zoals zoals RNAse bescherming assays, cDNA arrays 29-31, real-time PCR methoden 32-35 en sequentiebepaling van 36,37. Aan de andere kant, heeft herijking van technische benaderingen voortdurende vooruitgang bevorderd in het veld.

Northern Blot assay (NB, of RNA gel blotbepaling) vormt een representatief voorbeeld: het wordt grotendeels gebruikt om RNA accumulatie profileren, omdat zij garant staat voor expressie kwantificatie evenals grootte bepalen. De intrinsieke lage sensitiviteit van de werkwijze wordt beperkt wanneer het moet worden toegepast op lage overvloedige genexpressie fijnstemmers, zoals korte RNA's. Een nadelig gevolg is het vereiste van grote hoeveelheden totaal RNA, die moeilijk zijn toepassing op specifieke biologische monsters maakt. Om bovenstaande redenen is specifiek NB varianten voor kleine RNA-detectie zijn ontwikkeld 38-40: we hebben geprofiteerd van een verbeterde NB procedure 41 (ENB, Enhanced Northern Blot), terwijl het ophelderen van de bovengenoemde wisselwerking tussen DMEL-miR279 en GCM / glide.

Deze werkwijze berust op een chemische verknopende stap gebaseerd op de activiteit van een carbodiimide derivaat [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide, EDC] nucleïnezuur bevestigen op vaste dragers. Carbodiimide is een veelzijdige verknoper waarover de vorming van amidebindingen tussen geactiveerde carboxyl of fosfaatgroepen en aminegroepen 42 katalyseren. Deze eigenschap kan worden benut om covalent paar kleine RNAs via hun mono-gefosforyleerde 5'-hydroxylgroep aminogroepen aan het oppervlak van nylon membranen. De resulterende configuratie onderdeel vergroot de toegankelijkheid van het geïmmobiliseerde nucleïnezuur en op zijn beurt de efficiëntie van probe-doel hybridisatie, wat resulteert in opmerkelijke detectieverfijning 43.

De techniek gaat ervan bijzonder relevance in Drosophila moleculaire studies, waarbij het ​​optreden van nieuwe en onderscheidende klassen van kleine niet-coderende RNA's is in opkomst 44. Hiervan rasiRNAs 45,46 vormen een specifiek subtype van piwi interactie RNAs (piRNAs 47) betrokken bij sequentie-specifieke gen-silencing. Operative details van deze werkwijze zijn volledig beschreven en gevisualiseerd hierna opzichte van de analyse van de microRNA DMEL-miR279 en DMEL-miR286 en, voor het eerst van een rasiRNA, rasi4. We geduwd deze werkwijze, die ons toegelaten onthullen slecht uitgedrukt doelen van minimale hoeveelheden RNA (minder dan 1 ug) uitersten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 Sample Collection

  1. Los semi-adherente Schneider 2 cellen (1-5 x 10 6 cellen gemiddeld), door pipetteren en oogsten ze door centrifugeren (100 g gedurende 1 min). In het geval van in vitro gekweekte hechtende cellen, trypsinize ze in normale omstandigheden of direct te verzamelen van platen in een geschikte hoeveelheid RNA extractie reagens, met behulp van een cel schraper.
  2. Voor het embryo, groeien Drosophila stammen in fly kooien en laat embryo's zich ophopen op eierleggende platen. Veeg embryo's uit door een penseel in gedestilleerd water (dH 2 O), gooi afval door zeef filteren, spoelen en embryo's terug te krijgen in een flacon 48.
  3. Als een alternatieve techniek, handmatig ontleden weefsels / organen. Isoleer testes (een preferentiële Pirna analyse) van Drosophila buik in fosfaatgebufferde zoutoplossing (PBS) onder een stereomicroscoop (vergroting 20X), met dissectie naalden of forceps zoals visualized in Sullivan et al 49.
  4. Stamper homogeniseren monsters op verslaving van 0,5 volumes van RNA-extractie reagens.

2 RNA-extractie / Analyse

  1. Instructies van onderstaande fabrikant 'presteren RNA isolatie via commerciële reagentia. LET OP! RNA-extractie agenten zijn meestal giftig en bijtend. Ook verzoeken een Proteinase K-gebaseerd protocol voor RNA isolatie 50, als volgt:
    1. Verdunnen monsters in 400 ul van Stop Mix en incubeer bij kamertemperatuur gedurende 15 minuten.
    2. Recover wateroplosbare componenten door standaard fenol: chloroform: isoamylalcohol en chloroformextracties en door ethanol (EtOH) neerslag / wassen. Lucht drogen van de monsters en mengen in diethylpyrocarbonaat (DEPC) behandelde dubbel gedistilleerd (dd) H 2 O.
  2. Beoordelen RNA concentratie door UV spectrofotometrische meting. Zorg er ook voor de RNA zuiverheid is hoog, dicht bij 2.0, based op A260 / A280 lezen.
  3. Controleer RNA preparaat denaturerende agarose gel als volgt:
    1. In een schone beker, los 1,2 g agarose in 82 ml DEPC DDH 2 O, onder voortdurend roeren. Kook totdat het volledig is opgelost.
    2. Laat de gel oplossing afkoelen; wanneer de temperatuur bereikt van 60 ° C toe te voegen 10 ml 10X 4-morfolinepropaansulfonzuur (MOPS) bufferen tot 1X uiteindelijke concentratie (FC) en 8 ml van 37% formaldehyde tot 3% FC. LET OP! Formaldehyde is een kankerverwekkende stof.
    3. Giet de gel in een horizontale elektroforese cel. Laat de gel stollen in een zuurkast gedurende ten minste 1 uur. Na het stollen, dompel de gel in MOPS 1X.
    4. Aliquot 2 ug van RNA monster en 1 ug van Ladder (gebruik een RNA-marker bij nauwkeurige evaluatie gewenst is). Voeg 3 delen agarose ladingskleurstof (ALD) RNA en Ladder. Verhit bij 70 ° C gedurende 5 minuten en onmiddellijk afkoelen op ijs. CAUTION! Inhoud van ALD (ethidiumbromide en formamide, zie ook Materiaal) zijn ingedeeld en corrosief, respectievelijk.
    5. Laad de monsters en laat de gel bij 50 V voor ongeveer 1 uur met af en toe een buffer recycling. Controleer de RNA fractionering patroon door UV-visualisatie of gel beeldvorming. Herkennen discrete banden die overeenkomen met 28S en 18S rRNA's en tRNA (zie figuur 1).
  4. Ga verder naar de Noordelijke Assay of winkel RNA bij -80 ° C.

3 Denaturing acrylamidegel Voorbereiding

  1. Gebruik een kleine verticale elektroforetische apparaten voor deze fractionering stap (plaat afmeting ongeveer 8 cm x 9 cm, kam dikte 0,75 mm).
  2. Monteer schone glazen samen in een casting frame.
  3. Bereid 10 ml van 10% acrylamide / bis-acrylamide (19 1) opgelost in 1X MOPS, 7 M ureum. Onmiddellijk voor gieten, voeg 100 pl 10% ammoniumpersulfaat en 10 ui TEMED en de oplossing snel mengen. VOORZICHTIG! Acrylamide is neurotoxisch en kankerverwekkend is.
  4. Giet de gel tussen de glasplaten en steek het goed kam voorzichtig om luchtbellen te vermijden. Laat de gel polymeriseren bij kamertemperatuur gedurende ten minste 45 minuten voor gebruik. Of bewaar de gel O / N, verpakt in water doordrenkte papieren filters en verzegeld in Saran Wrap.

4 Monstervoorbereiding

  1. Aliquot 0,5-20 ug totaal RNA voor elk monster. Als het volume groter is dan 3-4 pi, vacuüm drogen van het monster.
  2. Voor de grootte bepalen, lopen een hoeveelheid (20-30 CPS) van radioactief gemerkt lage bereik ladder parallel aan monsters, als een marker (zie rubriek 4.3 en 4.4 voor de bereiding). Behandel het parallel monsters, zoals beschreven in stap 4.5.
  3. Ladder: het opzetten van een fosfaat vooruit reactie met 0,1 ug van een 10 bp-laddertje. Incubeer bij 37 ° C gedurende 30 minuten en stop de reactie door toevoeging van ethyleendiaminetetraazijnzuur (EDTA) aan 20 mM FC.
  4. Zuiver door EtOH precipitatie / wassen, drogen aan de lucht enmengen in DDH 2 O (ongeveer 100 pl). LET OP! 32 P is een radioactieve bron.
  5. Voor elk monster een gelijk volume van acrylamide blauwe kleurstof (ABD) toe. Denatureren door verhitting bij 80 ° C gedurende 5 minuten en koel op ijs tot het laden. LET OP! Formamide (gehalte in ABD) is corrosief.

5 Elektroforetisch Fractionering

  1. Verwijder de glasplaten van de casting ondersteuning en goed monteer ze in de elektroforese cel. Vul beide binnenste en buitenste kamer met voldoende lopende buffer (RB).
  2. Verwijder voorzichtig de kam en pre-run de gel bij 200 V gedurende 10 minuten. Voor het laden van monsters, afwassen ureum afzettingen van de putten door spuiten sommige RB door middel van een injectiespuit.
  3. Gebruik platte tips zorgvuldig stratify monsters uit stap 4.5 op de bodem van elk putje. Bekijk de anode en kathode verbindingen met omgekeerde running voorkomen. Nadat de monsters Voer de gel bij 100 V gedurende 5 min, increase de spanning tot 200 V.
  4. Voor een fractionering lengte van ongeveer 7 cm, een 45 min-lange termijn voldoende is. Vermijd broomfenolblauw (tracking pigment in ABD) om de gel overstromen.
  5. Zichtbaar op de gel gefractioneerd lange RNAs door ethidiumbromide (EtBr) kleuring, als facultatieve stap:
    1. Knip 2 cm van de bovenkant van de gel en de spoel kort segment in DDH 2 O.
    2. Incubeer de gel slice bij KT 15 minuten onder zacht shacking in RB, EtBr 0,5 ug / ml FC.
    3. Destain de gel gedurende 15 minuten in RB, visualiseren lange rRNA door UV-bestraling of gel beeldvorming. Controleer RNA laden en kwaliteit (zie Figuur 1, paneel 7). LET ethidiumbromide mutageen.
  6. Ondertussen gaat blotting het onderste gedeelte van de gel met kleine RNA species.

6 Gel Blotting

  1. Snijd 6 stukjes vloeipapier aan de blotting omgeving passen en een equivalent stuk te ontladend nylon membraan. Bevochtig vellen papier, membraan en 2 onderleggers in RB. Zorg ervoor dat u volledig genieten van de pads door hen herhaaldelijk knijpen in RB.
  2. Verwijder de gel uit het apparaat en de bril openen door gemiddelde van een spatel. Gebruik een schoon mes om de putten te verwijderen. Leg een vel nat Whatman papier op de gel en til het op.
  3. Plaats het nylon membraan op het vrije oppervlak van de gel. Markeer een hoek om het filter te oriënteren volgens monster laden. Voltooi de "sandwich" (3 papieren stukken aan elke zijde). Rol een plastic staaf op het oppervlak blot, om eventuele luchtbellen te verwijderen.
  4. Leg de vlek tussen twee onderleggers en vervolgens in de blotting cassette. Monteer de cassette in de blotting module, vult de kamer met RB en controleren op de juiste richting (nylon membraan moet blijven tussen de gel en de positieve eindpunt).
  5. Transfer bij 20 V gedurende 20 minuten. Opmerking: om ervoor te zorgen homogene omstandigheden, na 10 min de blotting module en r openenraaien de sandwich van 180 ° voor het voltooien van de overdracht.

7 Membraan Crosslinking

  1. Bereid 6 ml vers Crosslinking Solution (XLS). Verzadigen een 10 cm x 10 cm (groter dan nylonmembraan) stukje vloeipapier met XLS. VOORZICHTIG! HCl (een onderdeel van XLS) is zeer corrosief.
  2. Ontmantelen van de vlek en leg het membraan op de natte 3MM filterpapier. Opmerking: RNA niet in direct contact met de verzadigde papieren. Plaats het filter en het papier tussen twee glasplaten en wikkel in Saran-wrap.
  3. Verwarm het membraan bij 60 ° C gedurende 2 uur, gevolgd door een DDH 2 O wassen. Bewaren bij -20 ° C of overgaan tot hybridisatie.

8 Membraan Prehybridisatie

  1. Als RNA laden is gecontroleerd (optionele stap 5.5), direct overgaan tot hybridisatie. Of anders, opengewerkt 1 cm van de top van het nylon filter met probe cross-hybridizatio voorkomenns aan gefractioneerde lange RNA's.
  2. Verwarm 10 ml hybridisatieoplossing (HS) bij 37 ° C. Denatureren 1 mg van de Zalm van het sperma bij 95 ° C gedurende 5 minuten, koel op ijs en voeg aan GS.
  3. Incubeer de filter HS bij 37 ° C gedurende ten minste 1 uur onder rotatie in een hybridisatie oven. Controleer of de RNA-zijde van het filter gezichten HS.

9 Probe Synthese

  1. Stel een fosfaatgroep uit reactie op 10 pmol van specifieke antisense oligonucleotide, zoals beschreven in 4.3.
  2. Voeg 5 volumes Tris-EDTA-NaCl (TEN) buffer aan de reactie en zuivering van het gemerkte primer opgenomen nucleotiden door gelexclusiechromatografie over Sephadex G-25 kolommen (of ook door EtOH precipitatie). Probe-activiteit kan worden beoordeeld door vloeistofscintillatieteller.

10 Membraan hybridisatie

  1. Vervang uitgeput HS met een verse 10 ml aliquot (bereid en aangevuld zoals boven beschreven). Verwarm de sonde op95 ° C gedurende 10 min, koel op ijs en toevoegen van nieuwe HS. Incubeer het filter bij 37 ° C ON.

11 Membraan Wassen

  1. Herstel de hybridisatie-oplossing en het op -20 ° C in een radioactiviteit afscherming box.
  2. Spoel het filter in Washing Buffer (WB) en was deze zorgvuldig gedurende 10 min bij kamertemperatuur.
  3. Gebruik een Geiger Mueller Detector voor het controleren van de resterende radioactiviteit op de hoeken filter. Als achtergrond emissie is ongeveer 5 cps, overgaan tot expositie membraan.

12 Signal Detection

  1. Expose de filter op autoradiografie films of op moleculair imager scherm ON. Reveal signalen door fotografische verwerking of digitale omzetting.
  2. Analyseer de band intensiteit door toegewijde kwantificering software (ImageJ of Optiquant).

13 Membraan Strippen

  1. Voor primaire signalen te verwijderen, onderdompelen membraan in 500 ml kokend stripoplossingVervolgens incuberen bij kamertemperatuur gedurende 1 minuut. Ga verder naar de roman (pre) hybridisatie of bewaar het filter bij -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Door het volgen van de in de tekst beschreven en schematisch weergegeven in figuur 1 algemeen procedure, onderzochten we kleine RNA expressie van complexe RNA-monsters van verschillende oorsprong. In het experiment weergegeven in figuur 1, werd RNA geïsoleerd uit Drosophila Schneider 2-cellen door Proteinase K extractie, gecontroleerd op integriteit (optionele stap: denaturerende agarose gel fractionering) en dubbel geladen. Een helft van de gel werd geblot op een membraan en neutrale chemisch verknoopt door EDC; de tweede helft werd overgebracht op een positief geladen nylon filter, vervolgens UV verknoopt (1,2 x 10 5 uJ / cm 2). De endogene expressie van twee microRNAs die behoren tot de familie DMEL-miR279 (DMEL-miR279 zelf en DMEL-miR286 15) werd geverifieerd in beide condities. De verbeterde procedure (ENB) zorgt voor een hogere gevoeligheid ten opzichte van de standaard een (SNB).

figuren 2 en 3. De experimentele reden is hetzelfde als hierboven: Hier rapporteren we de representatief resultaat van Northern Blot autoradiografische detectie van de Pirna rasi4 langs een titratie van totaal RNA geëxtraheerd uit volwassen vliegen testes. ENB al maakt het opsporen van een specifieke band bij 0,5 ug van RNA wordt geladen. De kwantificering opzij toont hoe het signaal proportioneel toeneemt met de hoeveelheid gefractioneerde RNA, wat aangeeft dat de dosis / respons-verhouding ligt in lineaire detectiegebied. Onderstaande panel bekrachtigt de verbeterde gevoeligheid van deze methode ten opzichte SNB. In dit geval wordt een detecteerbaar signaal verkregen na elektroforetische fractionering van 10 ug RNA tenminste voor de BOG.

Soortgelijke resultaten worden verkregen met een andere coderende RNA species, bijvoorbeeld, 5S rRNA, zoals in figuur 3 </ Strong>.

Figuur 1
Figuur 1 Schematische weergave van het totale Northern blot procedure. Belangrijkste procedurele stappen worden opgesomd en progressief genummerd. Resultaten worden vergeleken tussen de Enhanced Northern Blot (ENB) en Standard Northern Blot (SNB), uitgevoerd in dezelfde omstandigheden: RNA isolatie van Drosophila Schneider 2 cellen (Panel 1), elektroforese (Panel 2), overdracht (Panel 3) en hybridisatie ( paneel 5). ENB betreft de verbeterde procedure in dit verslag, dat (, linkerhelft van het membraan Panel 3) en EDC gebaseerde crosslinking (Panel 4) een neutraal filter vereist beschreven, die een covalente binding tussen doel-RNA-5'-uiteinde en membraan (vastgesteld roze stippen in Configuratiescherm 4). In SNB wordt RNA verknoping verkregen door UV-behandeling (Panel 4) op een positief geladen nylon membraan (Panel 3, rechter helft van het membraan). 5s RNA specifiek signaal is geen calibrator in vergelijkende omstandigheden, omdat het reageert ook op de verschillen tussen SNB en ENB procedure. Aldus werd een hoeveelheid (overeenkomend met 10 cps) of een 5'-gelabeld (zie punten 4.3 en 4.4 van het protocol), 50 nt lang gecodeerde oligonucleotide werd aan elk monster toegevoegd voor elektroforese kan functioneren als een "piek in" referentie ( Panel 7). Laden kan ook worden bepaald door op-gel EtBr kleuring van lange rRNA's (zie punt 5.5 van het protocol). L = Ladder. FV = Frontal View, LV = Lateral View, HV = Horizontale weergave. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 2
Figuur 2 Compartieve Northern Blot analyse van rasi4 expressie. endogene niveaus van de testis-specifieke Pirna rasi4 worden onthuld door verbeterde (ENB) of standaard (SNB) Northern Blot, uitgevoerd op steeds grotere hoeveelheden van het totaal RNA (boven elke rijstrook aangegeven) gewonnen uit volwassen Drosophila testes of uit volle buiken (Abd). Voor elke methode histogrammen opzij rapporteren de relatieve hoeveelheden rasi4 aanzien van dezelfde hoeveelheid van een "piek in" loading control. Kwantificering van de twee methoden worden gecombineerd in de sluitende grafiek hieronder de gels geplaatst. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 3
Figuur 3 Vergelijkende Northern blot analyse van 5s rRNA expressie. Als positieve controle en experimentele kalibratie eerdere analyse werd uitgebreid naar 5s rRNA. Details zoals in figuur 2. Klik hier om een grotere versie van deze afbeelding te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hoewel onze waardering voor de verfijnde verwevenheid waardoor RNA reguleert neurogenese neemt voortdurend toe, de mechanistische implicaties van RNA gebaseerde circuits beïnvloeden neurale stamcellen biologie, neuronale differentiatie / functionele integratie, ontwikkeling van neurale aandoeningen en kanker blijft onontgonnen. Het onderhoud van deze netwerken door koninkrijken maakt van de mogelijkheden van genetische systemen zoals Drosophila melanogaster instrumenteel om onontgonnen cellulaire routes, waarbij korte-coderende RNA's en transcriptiefactoren als belangrijke moleculaire spelers worden beschouwd ontrafelen. In deze visie, de profilering van de kandidaat kleine RNA expressie niveaus is propedeuse nauwkeurige functionele analyses: een voorbeeld is afkomstig uit onze recente demonstratie dat DMEL-miR279 moduleert in vivo het ACM / glide lot determinant, bereikt door middel van een verbeterde versie van Northern blotting assay als een hulpmiddel voor expressie analyse.

51, heeft NB beschouwd als een referentie-methode voor RNA-analyse. In weerwil van een aantal intrinsieke beperkingen van deze test, als de moeilijke conversie naar formaat of eventuele fouten met signaal kwantificering multiplexen, hebben de recente doorbraken in RNA moleculaire biologie deze conventionele techniek als een "quick and clean" systeem herontdekt voor het testen van endogene expressie van kleine ribonucleic zuren of voor de effectiviteit van gain of verlies-van-functie benaderingen valideren. Als paradigmatische bijvoorbeeld Northern analyse ligt aan de basis van de oorspronkelijke ontdekking van microRNA's, terwijl de aanpak blijft in de voorhoede van de relevantie ervan in de karakterisering van steeds nieuwe eigenschappen van regulerende RNA's 52.

De hier beschreven variant is gebaseerd op verhoogde gevoeligheid door chemische verknoping van RNA. We believethe methode wordt nog steeds slecht werkzaam in Drosophila, but wanneer benut tot belangrijke ontdekkingen 52, omdat daarmee mogelijk profilering RNA expressie van kleine monsters (minder dan 1 ug), met gemiddeld 10-30 voudige verbetering van RNA target detectie 41,43, zoals we verkregen in onze omstandigheden (figuren 2 en 3).

RNA integriteit vormt een cruciaal punt om consistente en reproduceerbare resultaten te verkrijgen. RNA manipulaties vereisen nauwkeurigheid en snelheid om mogelijke steekproef degradatie optreedt tussen extractie en het laden te beperken. Hiertoe moeten dienen alle oplossingen diethylpyrocarbonate- is (DEPC) behandeld vóór gebruik (2 uur incubatie in aanwezigheid van 0,1% DEPC bij 37 ° C en vervolgens geautoclaveerd) RNase-activiteit te omzeilen. Oplossing behandeling garandeert betere resultaten met betrekking tot DEPC water als oplosmiddel. Alle apparatuur zal gelijk worden gespoeld in DEPC ddH20, na het reinigen met een RNase-specifieke oppervlakte ontsmettend middel.

(bijvoorbeeld rasi4, Figuur 2) of als RNA zuiveringsproces uitgevoerd op verse monsters (bijvoorbeeld conserven in weefselopslag reagentia). Uit ervaring RNA isolatie uit gestabiliseerde monsters resulteerde aanzienlijk harder en vereist drastischer extractieomstandigheden. In standaardomstandigheden, garandeert beschreven Proteinase K-gebaseerde methode goede kwaliteit preparaten ook, (een belangrijk voorbeeld is weergegeven in Figuur 1), maar het is niet de optimale keuze voor monsters die opgeslagen reagentia.

Tenslotte, aangezien deze procedure beoogt kleine RNA specifieke detectie, speciale kolom zuivering gebaseerde kits kunnen worden gebruikt als directe kleine RNA-isolatie, alhoewel thwil moeilijker maakt om RNA integriteit verifiëren. In alternatief voor de klassieke gel gebaseerde procedure voor RNA integriteit bovenbeschreven besturing kan RNA kwaliteit worden door instrumenten on-chip geminiaturiseerde analyse van nucleïnezuur patronen.

Buffer Keuze: MOPS-NaOH-buffer (pH 7) voorgesteld als een preferentiële buffer voor zowel verbeterde Northern gel elektroforese en blotting. We hebben ook bevredigende wijze Tris-boraat-EDTA (TBE) buffer in onze experimenten. In dit geval, aangezien de aanwezigheid van nucleofiele amine groepen Tris (hydroxymethyl) aminomethaan zou hydrolyseren en inactiveren DEPC tijdens behandeling zelf, wordt aanbevolen oplossen van Tris in DEPC-behandeld water in plaats van het behandelen TBE buffer al voorbereid.

Elektroforetische Run en blotting: Pre-uitvoeren van de gel is essentieel voor het verwijderen van overtollige Persulfate en het elimineren van overmatige aandacht. Pre-run parameters moet ook worden gehandhaafd tijdens de fractionering, het vermijden van te snel electrophoRetic run. Voor het laden, moet u mogelijk Ureum sedimenten uit putten te verwijderen, door spuiten buffer binnen. Dit zal monster spill-over en garandeert nauwkeurige RNA stratificatie te beperken, produceert opgelost autoradiografische bands tijdens signalen opsporen. Elke neutrale nylon membraan kan worden gebruikt als drager voor nucleïnezuur overdracht. Laat het RNA langer dan 20-30 min geenszins uitdoen op de opgegeven voorwaarden.

Verknoping: EDC-gebaseerde chemische verknoping is de kritische methodische vooruitgang van deze verbeterde Northern blot versie. De mogelijkheid om korte RNA species neutrale oppervlakken verknopen door covalente grenzen tussen de RNA 5'mono-fosfaatgroep en nylon primaire aminen laat de meerderheid van basen voor hybridisatie. Dit verhoogt de gevoeligheid van 10-20xrespect traditionele crosslinking. Het is cruciaal om verse hoeveelheid verknopingsoplossing voorbereiding van de blotting, in voldoende hoeveelheid goede membraan verzadiging.

Hybridisatie en Wassen: Probes moeten bij voorkeur vers worden geëtiketteerd. Probe specifieke activiteit (afhankelijk van de specifieke activiteit en de hoeveelheid opgenomen radioactief gemerkt nucleotide en ook van de hoeveelheid probe voor hybridisatie) bepaalt de gevoeligheid van doeldetectie. Wanneer [γ- 32 P] ATP met een specifieke activiteit van 3000 Ci / mmol gebruikt, 10 6 cpm / pmol 100% etikettering van de 5'-uiteinden wordt verwacht.

De hybridisatie-oplossing kan worden teruggewonnen en opnieuw gebruikt, aangezien, vanwege 32 P bederf, probe activiteit helften in ongeveer 14 dagen.

Door membraan neutraliteit is lage achtergrondruis wordt na hybridisatie. Indien meer stringente omstandigheden wassen vereist, geleidelijk verminderen wasbuffer ionsterkte (tot 0,2 x SSPE) of commentaar toenemende hoeveelheden ionische detergentia (tot 0,5% SDS) en wastemperatuur verhogen tot 37 ° C.

Northern blot-analyse is essentieel bij RNA meting is vereist. Ook al is deze test de nauwkeurigheid van fluorescentie gebaseerde qPCR benaderingen voor schatting van kleine RNA's kan missen, een voordeel vloeit voort uit het gebruik van denatureren fractionering / deppen en probe-afhankelijke hybridisatie als unieke stappen voor detectie van doelwit-RNA's. Bijgevolg openbaring van specifieke signalen van het monster is direct en geen aanvullende stap van enzymatische behandeling / omzetting / versterking, zodat het gebruik van speciale commerciële kits zou impliceren vereisen. RNA-spiegels kunnen worden gekwantificeerd en vergeleken tussen meerdere monsters op enkele membranen. Zo Northern vlek wordt meestal gebruikt als een strenge validatie voor qPCR data. Impuls specifieke experimentele voorschriften werd de werkwijze is ook verbeterd in de afgelopen jaren, zowel op het niveau van gevoeligheid en resolutie zodat een beperkte hoeveelheid RNA (zie figuren 2 en 3) zijn vereist voor een succesvolle analyse.

Het protocol stelden wij kunnen worden aangepast aan een breed scala van toepassingen name wanneer materiaal beschikbaar in beperkte hoeveelheden. De biologische bron van RNA monsters kunnen heterogeen zijn: wat Drosophila betreft, embryo's of andere ontwikkelingsstadia zijn geschikt, maar ook handmatig ontleed weefsels of organen, afzonderlijke cellen sorteren geïsoleerd cytotypes of celculturen.

Zelfs indien microRNAs zijn de meest voorkomende klasse van korte regulerende RNA in de cel en belangrijkste onderwerp van onderzoek op het gebied van RNA gemedieerde genexpressie control, zij niet voorzientitute de enige familie van cellulaire-coderende RNA's. Veel clusters van kleine RNA's functioneren in rijken (bijvoorbeeld endogene siRNAs, piRNAs, snoRNAs, plantaardige tasiRNAs) en de meeste kenmerken van een vrij 5'-uiteinde (ongemodificeerde), meestal afkomstig van de endo-ribonucleolytische verwerking van precursors moleculen. Deze functie vormt de unieke structurele voorwaarde strikt noodzakelijk is voor de toepassing van de specifieke verbeterde methodologie gebaseerd op chemische verknoping, hoewel RNA grootte als goed worden beschouwd, wanneer langere RNA's worden geanalyseerd. In figuur 2 rapporteren we een Northern Blot analyse relatief detecteren van de niveaus van rasi4 54 een lid van een klasse van de kiem-lijn-specifieke kleine RNA's (Piwi-interactie RNA of piRNAs.) In het geval van slechte en specifieke expressie niveaus, de verbeterde gevoeligheid deze werkwijze kan bestraffen succesvolle resultaten, vooral omdat de gerapporteerde protocol verder kan worden verbeterd door combining met andere praktische implementaties reeds in de literatuur beschreven 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Dit werk werd ondersteund door het Institut National de la Sante et de la Recherche Medicale, giet het Centre National de la Recherche Scientifique, de Universite de Strasbourg, het Hôpital de Strasbourg, de Vereniging la Recherche sur le Cancer, het Institut National du Cancer, de Agence Nationale de la Recherche en de Elzas.

Pietro Laneve werd ondersteund door de Fondation pour la Recherche Medicale. Momenteel is hij een ontvanger van een Istituto Italiano Tecnologia (IIT) fellowship. Publicatiekosten worden ondersteund door de Neurex netwerk (TriNeuron - Programma Interreg IV Boven-Rijn)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics